breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence seq id position mutation annotation gene description
RA AssemblyC74_contig_1 380,718 +G coding (472/1422 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 → Amino acid permease family protein
RA AssemblyC74_contig_1 443,385 G→A intergenic (+514/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – Conserved hypothetical protein ArsC related/–
RA AssemblyC74_contig_1 443,483 (T)6→5 intergenic (+612/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – Conserved hypothetical protein ArsC related/–
RA AssemblyC74_contig_12 59,062 T→C G92G (GGA→GGG)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,113 A→G N75N (AAT→AAC)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,182 C→T L52L (TTG→TTA)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,194 2 bp→TA coding (143‑144/672 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,248 C→T A30A (GCG→GCA)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,264 G→T A25E (GCA→GAA)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_12 59,272 G→A T22T (ACC→ACT)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
RA AssemblyC74_contig_15 32,991 A→G H250H (CAT→CAC)  rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← Mobile element protein

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ AssemblyC74_contig_11 78783 78787 5 196 [0] [0] NA [rasttk_feature_annotation_tool=elepa@bvbrc] [rasttk_feature_annotation_tool=elepa@bvbrc]
* * ÷ AssemblyC74_contig_12 1 7 7 NA [0] [0] 220 –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Polygalacturonase (EC 3.2.1.15)
* * ÷ AssemblyC74_contig_12 59277 59337 61 211 [26] [0] NA rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
* * ÷ AssemblyC74_contig_35 1904–2040 2041 2–138 153 [146] [0] NA rasttk_feature_annotation_tool=annotate_proteins_si milarity rasttk_feature_annotation_tool=annotate_proteins_si milarity
* * ÷ AssemblyC74_contig_46 1 83 83 NA [0] [140] 143 –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/hypothetical protein
* * ÷ AssemblyC74_contig_48 1 21 21 NA [0] [0] 277 [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] [rasttk_feature_annotation_tool=annotate_proteins_km er_v2]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? AssemblyC74_contig_1 = 221321 (1.110)214 (0.790) 53/244 1.8 58.5% intergenic (–/‑371) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Two‑component transcriptional response regulator, OmpR family
?AssemblyC74_contig_12 8 = 0 (0.000)intergenic (–/+152) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Polygalacturonase (EC 3.2.1.15)
* ? AssemblyC74_contig_1 443129 =261 (0.910)169 (0.640) 52/248 1.7 57.4% intergenic (+258/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Conserved hypothetical protein ArsC related/–
?AssemblyC74_contig_11 = 78782 0 (0.000)coding (62/66 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_1 443402 =990 (3.440)221 (0.850) 56/258 1.2 30.9% intergenic (+531/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Conserved hypothetical protein ArsC related/–
?AssemblyC74_contig_6 = 168934 0 (0.000)intergenic (+543/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Phosphate regulon sensor protein PhoR (SphS) (EC 2.7.13.3)/–
* ? AssemblyC74_contig_1 = 4435289 (0.030)1683 (1.680)
+C
146/256 0.0 99.7% intergenic (+657/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Conserved hypothetical protein ArsC related/–
?AssemblyC74_contig_39 = 1643 0 (0.000)intergenic (‑5/–) rasttk_feature_creation_tool=RNA_reps_SSU_rRNA/– SSU rRNA ## 16S rRNA, small subunit ribosomal RNA/–
* ? AssemblyC74_contig_10 = 985640 (0.000)224 (0.720) 59/258 0.7 100% intergenic (‑281/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_50 1 = 0 (0.000)intergenic (–/‑113) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Aggregation promoting factor
* ? AssemblyC74_contig_11 1 =0 (0.000)244 (0.330) 81/258 0.2 100% intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Alcohol dehydrogenase (EC 1.1.1.1)
?AssemblyC74_contig_45 = 1002 0 (0.000)intergenic (‑96/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Integrase, catalytic region/–
* ? AssemblyC74_contig_12 58967 =315 (1.100)65 (0.790) 21/74 0.4 59.0% coding (371/672 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
?AssemblyC74_contig_12 = 59245 0 (0.000)coding (93/672 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
* ? AssemblyC74_contig_12 59059 =108 (0.380)411 (1.510)
+ATCCTG
63/246 1.0 79.5% coding (279/672 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
?AssemblyC74_contig_18 27021 = 115 (0.410)coding (2179/2232 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
* ? AssemblyC74_contig_12 = 5927626 (0.090)181 (0.640) 49/258 2.8 93.3% coding (62/672 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog
?AssemblyC74_contig_18 = 27075 0 (0.000)intergenic (+1/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
* ? AssemblyC74_contig_13 = 462400 (0.000)156 (0.680) 41/258 2.8 56.5% intergenic (‑38/–) rasttk_feature_creation_tool=tRNAscan‑SE/– tRNA‑Ser‑GGA/–
?AssemblyC74_contig_8 = 1721 240 (0.970)intergenic (+1/+137) rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity tRNA‑Asn‑GTT/FIG00629206: hypothetical protein
* ? AssemblyC74_contig_14 = 413480 (0.000)207 (0.630) 67/258 0.4 100% coding (927/927 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Phage endopeptidase
?AssemblyC74_contig_33 1 = 0 (0.000)coding (1/972 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
* ? AssemblyC74_contig_15 1 =0 (0.000)264 (0.650) 64/258 1.2 100% intergenic (–/+1116) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
?AssemblyC74_contig_52 = 702 0 (0.000)intergenic (+23/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Putative transposase InsK for insertion sequence element IS150/–
* ? AssemblyC74_contig_15 32682 =742 (2.300)259 (0.860) 84/256 0.1 37.3% coding (1059/1284 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein
?AssemblyC74_contig_30 32 = 136 (0.480)coding (32/252 nt) rasttk_feature_annotation_tool=annotate_proteins_si milarity Mobile element protein
* ? AssemblyC74_contig_15 = 360070 (0.000)283 (0.610) 83/258 0.2 100% intergenic (+1/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– FIG00632365: hypothetical protein/–
?AssemblyC74_contig_37 = 1750 0 (0.000)intergenic (‑2/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– FIG00632365: hypothetical protein/–
* ? AssemblyC74_contig_16 21870 =221 (1.000)225 (0.900) 54/258 1.4 67.1% coding (264/387 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_24 = 8654 0 (0.000)intergenic (+132/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– 1,4‑dihydroxy‑2‑naphthoate polyprenyltransferase (EC 2.5.1.74)/–
* ? AssemblyC74_contig_16 = 21988191 (0.870)252 (1.040)
+CA
62/254 0.7 72.8% coding (146/387 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_26 = 7770 0 (0.000)intergenic (+560/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Glutathione reductase (EC 1.8.1.7)/–
* ? AssemblyC74_contig_17 1 =0 (0.000)238 (0.630) 73/258 0.4 100% intergenic (–/‑262) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Protein of unknown function DUF421
?AssemblyC74_contig_57 1 = 0 (0.000)intergenic (–/+1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Mobile element protein
* ? AssemblyC74_contig_17 = 320320 (0.000)179 (0.740)
+A
35/256 2.5 77.3% intergenic (+380/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
?AssemblyC74_contig_34 2046 = 106 (0.480)intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
* ? AssemblyC74_contig_19 = 190310 (0.000)247 (0.730) 78/258 0.1 100% intergenic (+109/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28)/–
?AssemblyC74_contig_53 = 622 0 (0.000)coding (1/498 nt) rasttk_feature_annotation_tool=annotate_proteins_si milarity Mobile element protein
* ? AssemblyC74_contig_2 242781 =262 (1.070)84 (0.680)
+64 bp
25/130 1.5 40.2% intergenic (+57/‑806) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases
?AssemblyC74_contig_2 = 242837 234 (0.950)intergenic (+113/‑750) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases
* ? AssemblyC74_contig_20 1 =0 (0.000)256 (0.680) 68/258 0.6 100% intergenic (–/+131) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Mobile element protein
?AssemblyC74_contig_57 = 493 0 (0.000)coding (1/492 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein
* ? AssemblyC74_contig_20 = 158620 (0.000)210 (0.320)
+40 bp
55/178 0.2 100% intergenic (+12/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Glutathione peroxidase (EC 1.11.1.9) @ Thioredoxin peroxidase (EC 1.11.1.15)/–
?AssemblyC74_contig_31 = 3396 0 (0.000)noncoding (118/118 nt) rasttk_feature_creation_tool=RNA_reps_5S_rRNA 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation
* ? AssemblyC74_contig_21 1 =0 (0.000)183 (0.520) 56/258 1.1 100% intergenic (–/+243) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Sucrose operon repressor ScrR, LacI family
?AssemblyC74_contig_57 1 = 0 (0.000)intergenic (–/+1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Mobile element protein
* ? AssemblyC74_contig_21 = 108430 (0.000)232 (0.670) 69/258 0.3 100% intergenic (+54/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Mobile element protein/–
?AssemblyC74_contig_49 = 764 0 (0.000)intergenic (+2/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Mobile element protein/–
* ? AssemblyC74_contig_23 1 =0 (0.000)180 (0.520) 58/258 0.8 100% coding (237/237 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein
?AssemblyC74_contig_57 = 493 0 (0.000)coding (1/492 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein
* ? AssemblyC74_contig_23 = 93960 (0.000)204 (0.600) 73/258 0.2 100% intergenic (+36/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– DNA‑directed RNA polymerase beta subunit (EC 2.7.7.6)/–
?AssemblyC74_contig_49 1 = 0 (0.000)intergenic (–/‑111) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Mobile element protein
* ? AssemblyC74_contig_24 1 =0 (0.000)155 (0.620)
+CTGACGTGTCCGT
52/232 1.6 53.9% coding (1/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_24 = 215 295 (1.060)coding (215/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_24 1 =0 (0.000)126 (0.440) 57/258 1.7 100% coding (1/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_7 = 152772 0 (0.000)intergenic (+1/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
* ? AssemblyC74_contig_24 255 =295 (1.060)27 (0.480)
+103 bp
16/52 0.2 32.6% coding (255/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_24 = 265 260 (0.930)coding (265/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_24 316 =292 (1.050)32 (0.590)
+104 bp
8/50 1.6 37.5% coding (316/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_24 = 325 258 (0.930)coding (325/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_25 = 85550 (0.000)152 (0.710)
+A
33/256 2.9 74.3% intergenic (+310/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_34 2046 = 106 (0.480)intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
* ? AssemblyC74_contig_26 1 =0 (0.000)182 (0.390) 72/258 0.5 100% intergenic (–/‑20) –/rasttk_feature_creation_tool=tRNAscan‑SE –/tRNA‑Pro‑TGG
?AssemblyC74_contig_54 = 611 0 (0.000)intergenic (+1/–) rasttk_feature_creation_tool=tRNAscan‑SE/– tRNA‑Arg‑ACG/–
* ? AssemblyC74_contig_27 1 =0 (0.000)276 (0.600) 64/258 0.9 100% intergenic (–/‑26) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Undecaprenyl‑phosphate galactosephosphotransferase (EC 2.7.8.6)
?AssemblyC74_contig_37 1 = 0 (0.000)intergenic (–/‑435) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
* ? AssemblyC74_contig_27 7574 =264 (0.870)270 (0.640) 57/238 1.0 68.9% coding (551/705 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14)
?AssemblyC74_contig_37 11 = 0 (0.000)intergenic (–/‑425) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
* ? AssemblyC74_contig_27 = 77260 (0.000)269 (0.640)
+CG
66/254 0.7 100% coding (703/705 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14)
?AssemblyC74_contig_41 = 1330 0 (0.000)coding (1/411 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14)
* ? AssemblyC74_contig_27 = 77280 (0.000)273 (0.640) 64/258 0.9 100% coding (705/705 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14)
?AssemblyC74_contig_41 = 1330 0 (0.000)coding (1/411 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14)
* ? AssemblyC74_contig_28 1 =0 (0.000)381 (0.500) 107/258 0.0 100% intergenic (–/‑81) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/hypothetical protein
?AssemblyC74_contig_45 = 1002 0 (0.000)intergenic (‑96/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Integrase, catalytic region/–
* ? AssemblyC74_contig_28 = 59750 (0.000)272 (0.920) 92/258 0.0 65.3% intergenic (+36/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– YoeB toxin protein/–
?AssemblyC74_contig_30 = 330 289 (1.020)intergenic (+78/+111) rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein/hypothetical protein
* ? AssemblyC74_contig_29 1 =0 (0.000)122 (0.530) 36/258 2.4 69.7% coding (843/843 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Agmatine deiminase (EC 3.5.3.12)
?AssemblyC74_contig_34 2046 = 106 (0.480)intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
* ? AssemblyC74_contig_29 = 48920 (0.000)204 (0.860) 54/252 1.3 63.0% intergenic (‑397/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– ABC‑type antimicrobial peptide transport system, permease component/–
?AssemblyC74_contig_8 = 1721 240 (0.990)intergenic (+1/+137) rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity tRNA‑Asn‑GTT/FIG00629206: hypothetical protein
* ? AssemblyC74_contig_3 1 =0 (0.000)190 (0.620) 57/258 0.7 100% intergenic (–/‑221) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Universal stress protein family
?AssemblyC74_contig_50 1 = 0 (0.000)intergenic (–/‑113) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Aggregation promoting factor
* ? AssemblyC74_contig_3 = 2551270 (0.000)197 (0.280) 69/258 0.2 100% intergenic (‑345/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
?AssemblyC74_contig_45 = 1002 0 (0.000)intergenic (‑96/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Integrase, catalytic region/–
* ? AssemblyC74_contig_30 = 330289 (1.020)218 (0.770) 75/258 0.3 60.1% intergenic (+78/+111) rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Mobile element protein/hypothetical protein
?AssemblyC74_contig_36 = 1754 0 (0.000)intergenic (+133/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
* ? AssemblyC74_contig_31 1 =0 (0.000)935 (0.570)
+AGTGT
130/248 0.5 100% intergenic (–/‑269) –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA
?AssemblyC74_contig_39 1 = 0 (0.000)intergenic (–/+65) –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA
* ? AssemblyC74_contig_31 1 =0 (0.000)396 (0.450)
+TTTAACAACTAATGTTGTT
69/220 0.0 75.3% intergenic (–/‑269) –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA
?AssemblyC74_contig_63 = 176 305 (0.780)intergenic (+2/‑26) rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE tRNA‑Ala‑TGC/tRNA‑Met‑CAT
* ? AssemblyC74_contig_31 = 33960 (0.000)217 (0.330)
+40 bp
55/178 0.2 100% noncoding (118/118 nt) rasttk_feature_creation_tool=RNA_reps_5S_rRNA 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation
?AssemblyC74_contig_5 = 185954 0 (0.000)intergenic (‑299/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Cof protein:HAD‑superfamily hydrolase, subfamily IIB/–
* ? AssemblyC74_contig_31 = 33960 (0.000)688 (0.590) 111/258 0.1 100% noncoding (118/118 nt) rasttk_feature_creation_tool=RNA_reps_5S_rRNA 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation
?AssemblyC74_contig_54 1 = 0 (0.000)intergenic (–/‑13) –/rasttk_feature_creation_tool=tRNAscan‑SE –/tRNA‑Val‑TAC
* ? AssemblyC74_contig_31 = 33960 (0.000)333 (0.370)
+TGATGTT
70/244 0.3 76.0% noncoding (118/118 nt) rasttk_feature_creation_tool=RNA_reps_5S_rRNA 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation
?AssemblyC74_contig_8 1645 = 222 (0.900)intergenic (‑212/‑2) rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE tRNA‑Thr‑GGT/tRNA‑Asn‑GTT
* ? AssemblyC74_contig_32 1 =0 (0.000)174 (0.670)
+C
47/256 1.7 100% intergenic (–/+1197) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Programmed cell death toxin MazF
?AssemblyC74_contig_40 = 62 NA (NA)intergenic (–/+119) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Cold shock protein of CSP family
* ? AssemblyC74_contig_32 = 33110 (0.000)286 (0.760) 75/258 0.4 100% intergenic (+202/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
?AssemblyC74_contig_53 = 622 0 (0.000)coding (1/498 nt) rasttk_feature_annotation_tool=annotate_proteins_si milarity Mobile element protein
* ? AssemblyC74_contig_33 1 =0 (0.000)228 (0.660) 77/258 0.2 100% coding (1/972 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_8 = 115683 0 (0.000)coding (1791/1791 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Phage capsid and scaffold
* ? AssemblyC74_contig_33 = 30750 (0.000)176 (0.540) 77/258 0.1 100% intergenic (+2/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_4 1 = 0 (0.000)intergenic (–/‑2) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28)
* ? AssemblyC74_contig_33 = 30750 (0.000)269 (0.790) 76/258 0.2 100% intergenic (+2/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_6 1 = 0 (0.000)intergenic (–/‑63) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/hypothetical protein
* ? AssemblyC74_contig_34 1 =0 (0.000)211 (0.660) 79/258 0.0 100% intergenic (–/+363) –/rasttk_feature_creation_tool=tRNAscan‑SE –/tRNA‑Leu‑CAG
?AssemblyC74_contig_50 = 745 0 (0.000)intergenic (+8/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Aggregation promoting factor/–
* ? AssemblyC74_contig_34 2046 =106 (0.480)162 (0.690)
+T
36/256 2.4 75.5% intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
?AssemblyC74_contig_35 1 = 0 (0.000)intergenic (–/+1) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Co‑activator of prophage gene expression IbrA
* ? AssemblyC74_contig_34 2046 =106 (0.480)167 (0.470) 38/258 2.1 75.9% intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
?AssemblyC74_contig_52 1 = 0 (0.000)intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Putative transposase InsK for insertion sequence element IS150
* ? AssemblyC74_contig_34 2046 =106 (0.480)158 (0.680)
+T
33/256 2.9 75.0% intergenic (‑223/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
?AssemblyC74_contig_56 1 = 0 (0.000)intergenic (–/+1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Co‑activator of prophage gene expression IbrA
* ? AssemblyC74_contig_34 = 21070 (0.000)1586 (1.350) 119/258 0.0 100% intergenic (‑284/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/–
?AssemblyC74_contig_42 = 1243 0 (0.000)intergenic (‑13/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Mobile element protein/–
* ? AssemblyC74_contig_36 1 =0 (0.000)239 (0.570) 75/258 0.3 100% intergenic (–/‑369) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
?AssemblyC74_contig_64 = 352 0 (0.000)intergenic (+1/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
* ? AssemblyC74_contig_37 = 17500 (0.000)264 (0.620)
+AAAAAGT
84/244 0.6 100% intergenic (‑2/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– FIG00632365: hypothetical protein/–
?AssemblyC74_contig_62 1 = 0 (0.000)intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Mobile element protein
* ? AssemblyC74_contig_38 = 16520 (0.000)225 (0.720) 71/258 0.1 100% intergenic (+2/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
?AssemblyC74_contig_46 = 883 0 (0.000)intergenic (+235/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
* ? AssemblyC74_contig_38 = 16520 (0.000)105 (0.340) 46/258 0.3 100% intergenic (+2/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
?AssemblyC74_contig_59 = 453 0 (0.000)intergenic (+197/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Transposase, IS4/–
* ? AssemblyC74_contig_39 1 =0 (0.000)242 (0.230) 54/254 0.6 68.0% intergenic (–/+65) –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA
?AssemblyC74_contig_63 93 = 228 (0.590)intergenic (+11/‑9) rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE tRNA‑Pro‑TGG/tRNA‑Ala‑TGC
* ? AssemblyC74_contig_40 1 =0 (0.000)624 (0.870) 116/258 0.0 100% intergenic (–/+180) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Cold shock protein of CSP family
?AssemblyC74_contig_45 1 = 0 (0.000)coding (906/906 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Integrase, catalytic region
* ? AssemblyC74_contig_40 = 62NA (NA)140 (0.570)
+G
39/256 2.8 100% intergenic (–/+119) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Cold shock protein of CSP family
?AssemblyC74_contig_5 1 = 0 (0.000)intergenic (–/+540) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/FIG00627359: hypothetical protein
* ? AssemblyC74_contig_40 = 16040 (0.000)177 (0.490) 57/258 0.8 100% intergenic (‑113/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_52 = 702 0 (0.000)intergenic (+23/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Putative transposase InsK for insertion sequence element IS150/–
* ? AssemblyC74_contig_41 1 =0 (0.000)297 (0.690) 83/258 0.1 100% intergenic (–/+2) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
?AssemblyC74_contig_47 1 = 0 (0.000)intergenic (–/‑1) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
* ? AssemblyC74_contig_41 1 =0 (0.000)333 (0.780) 89/258 0.0 100% intergenic (–/+2) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
?AssemblyC74_contig_51 1 = 0 (0.000)intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Conserved domain protein
* ? AssemblyC74_contig_43 1 =0 (0.000)306 (0.510) 83/258 0.1 100% coding (1215/1215 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_44 = 1136 0 (0.000)coding (1/1134 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
* ? AssemblyC74_contig_43 971 =270 (0.670)245 (0.820) 54/216 0.4 68.4% coding (245/1215 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_48 22 = 0 (0.000)coding (21/843 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Chitinase (EC 3.2.1.14)
* ? AssemblyC74_contig_43 992 =240 (0.600)632 (1.250) 106/258 0.0 84.0% coding (224/1215 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_61 = 423 0 (0.000)intergenic (‑1/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
* ? AssemblyC74_contig_43 = 12170 (0.000)1051 (1.820) 91/250 0.0 73.3% intergenic (‑2/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
?AssemblyC74_contig_44 617 = 765 (1.000)coding (520/1134 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
* ? AssemblyC74_contig_44 1 =0 (0.000)283 (0.520) 74/258 1.2 100% intergenic (–/+2) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/hypothetical protein
?AssemblyC74_contig_65 = 349 0 (0.000)intergenic (‑1/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– hypothetical protein/–
* ? AssemblyC74_contig_44 1 =0 (0.000)277 (0.510) 68/258 0.5 100% intergenic (–/+2) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/hypothetical protein
?AssemblyC74_contig_66 1 = 0 (0.000)intergenic (–/‑1) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
* ? AssemblyC74_contig_44 = 810718 (0.910)313 (0.670)
+GCACTCTTGTCACCATCAAT
61/218 1.3 50.8% coding (327/1134 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_60 = 439 0 (0.000)coding (438/438 nt) rasttk_feature_annotation_tool=annotate_proteins_si milarity FIG00630508: hypothetical protein
* ? AssemblyC74_contig_44 = 11360 (0.000)304 (0.550) 70/258 0.2 100% coding (1/1134 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
?AssemblyC74_contig_48 = 844 0 (0.000)coding (843/843 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 Chitinase (EC 3.2.1.14)
* ? AssemblyC74_contig_45 = 10020 (0.000)259 (0.360) 83/258 0.0 100% intergenic (‑96/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Integrase, catalytic region/–
?AssemblyC74_contig_55 1 = 0 (0.000)intergenic (–/–) –/– –/–
* ? AssemblyC74_contig_45 = 10020 (0.000)240 (0.340) 72/258 0.2 100% intergenic (‑96/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Integrase, catalytic region/–
?AssemblyC74_contig_9 1 = 0 (0.000)intergenic (–/+1) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Transcriptional regulator SpxA1
* ? AssemblyC74_contig_47 418 =NA (NA)36 (0.080) 9/256 0.0 97.3% coding (417/879 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_61 4 = 1 (0.000)coding (419/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_47 421 =NA (NA)166 (0.590)
+GCATTCATAGAA
54/234 1.0 NA coding (420/879 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_47 = 561 NA (NA)coding (560/879 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_47 452 =NA (NA)202 (0.880)
+34 bp
59/190 0.1 NA noncoding (7/29 nt) direct CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc
?AssemblyC74_contig_47 = 882 NA (NA)intergenic (+2/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
* ? AssemblyC74_contig_47 452 =NA (NA)308 (0.910)
+34 bp
65/190 0.0 100% noncoding (7/29 nt) direct CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc
?AssemblyC74_contig_61 1 = 0 (0.000)intergenic (–/+2) –/rasttk_feature_annotation_tool=elepa@bvbrc –/hypothetical protein
* ? AssemblyC74_contig_47 486 =NA (NA)9 (0.020)
+TCGTAACATTA
4/236 0.2 27.5% coding (485/879 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_61 22 = 26 (0.040)coding (401/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_49 1 =0 (0.000)229 (0.650) 56/258 0.7 100% intergenic (–/‑111) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Mobile element protein
?AssemblyC74_contig_55 = 585 0 (0.000)intergenic (–/–) –/– –/–
* ? AssemblyC74_contig_49 = 7640 (0.000)138 (0.420) 57/258 0.1 100% intergenic (+2/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Mobile element protein/–
?AssemblyC74_contig_59 1 = 0 (0.000)intergenic (–/‑31) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Transposase, IS4
* ? AssemblyC74_contig_50 = 7450 (0.000)212 (0.670) 74/258 0.2 100% intergenic (+8/–) rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– Aggregation promoting factor/–
?AssemblyC74_contig_9 = 104617 0 (0.000)intergenic (+75/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Putative deoxyribonuclease YcfH/–
* ? AssemblyC74_contig_51 = 7230 (0.000)206 (0.460) 59/258 0.0 65.4% intergenic (+2/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Conserved domain protein/–
?AssemblyC74_contig_61 = 87 218 (0.360)coding (336/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_52 1 =0 (0.000)216 (0.460) 70/258 0.9 100% intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 –/Putative transposase InsK for insertion sequence element IS150
?AssemblyC74_contig_53 1 = 0 (0.000)intergenic (–/+2) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/Mobile element protein
* ? AssemblyC74_contig_54 = 6110 (0.000)314 (0.590) 85/258 0.0 100% intergenic (+1/–) rasttk_feature_creation_tool=tRNAscan‑SE/– tRNA‑Arg‑ACG/–
?AssemblyC74_contig_63 1 = 0 (0.000)intergenic (–/‑8) –/rasttk_feature_creation_tool=tRNAscan‑SE –/tRNA‑Pro‑TGG
* ? AssemblyC74_contig_60 1 =0 (0.000)220 (0.480) 58/258 0.0 94.4% intergenic (–/‑1) –/rasttk_feature_annotation_tool=annotate_proteins_si milarity –/FIG00630508: hypothetical protein
?AssemblyC74_contig_61 22 = 26 (0.040)coding (401/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_61 22 =26 (0.040)116 (0.230) 37/212 0.0 45.8% coding (401/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_61 = 99 253 (0.510)coding (324/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_61 = 81214 (0.350)89 (0.170)
+GTCATATTCGTAACATTT
31/222 0.0 21.8% coding (342/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_61 175 = 530 (0.870)coding (248/420 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
* ? AssemblyC74_contig_62 = 3910 (0.000)232 (0.550) 68/258 2.2 100% intergenic (+213/–) rasttk_feature_annotation_tool=annotate_proteins_si milarity/– Mobile element protein/–
?AssemblyC74_contig_64 = 352 0 (0.000)intergenic (+1/–) rasttk_feature_annotation_tool=elepa@bvbrc/– hypothetical protein/–
* ? AssemblyC74_contig_64 1 =0 (0.000)293 (0.690) 70/258 2.0 100% coding (1/351 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_65 1 = 0 (0.000)coding (348/348 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein
* ? AssemblyC74_contig_64 1 =0 (0.000)275 (0.650)
+C
69/256 2.0 100% coding (1/351 nt) rasttk_feature_annotation_tool=elepa@bvbrc hypothetical protein
?AssemblyC74_contig_65 2 = 0 (0.000)coding (347/348 nt) rasttk_feature_annotation_tool=annotate_proteins_km er_v2 hypothetical protein