breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence seq id position mutation annotation gene description
RA CP009273 1,543 G→A G403S (GGT→AGT)  thrA → Bifunctional aspartokinase/homoserine dehydrogenase 1
RA CP009273 164,770 +G coding (800/2244 nt) fhuA → ferrichrome outer membrane transporter
JC CP009273 415,065 (AAGAT)1→2 coding (19/1320 nt) brnQ → branched‑chain amino acid transport system 2 carrier protein; LIV‑II transport system for Ile, Leu, and Val
JC CP009273 1,013,537 (TTGGCA)1→2 coding (219/1761 nt) ycbZ ← putative peptidase
MC JC CP009273 1,106,933 Δ3,772 bp [opgH]–[mdtG] [opgH], yceK, msyB, [mdtG]
JC CP009273 1,257,022 (AGTGATTGGTACACGAGC)1→2 coding (310/948 nt) prs ← phosphoribosylpyrophosphate synthase
RA CP009273 1,325,806 C→T R168C (CGT→TGT)  topA → DNA topoisomerase I, omega subunit
MC JC CP009273 2,400,028 Δ9 bp coding (85‑93/939 nt) lrhA ← transcriptional repressor of flagellar, motility and chemotaxis genes
RA CP009273 2,528,814 G→A D464N (GAC→AAC)  ptsI → PEP‑protein phosphotransferase of PTS system (enzyme I)
RA CP009273 2,727,902 (C)8→9 coding (492/732 nt) yfiH ← UPF0124 family protein
MC JC CP009273 2,961,766 Δ5 bp coding (24‑28/2247 nt) ptsP ← fused PTS enzyme: PEP‑protein phosphotransferase (enzyme I)/GAF domain containing protein
RA CP009273 3,464,372 +A coding (317/1185 nt) tufA ← translation elongation factor EF‑Tu 1
JC CP009273 3,479,546 +TAA coding (68/633 nt) crp → cAMP‑activated global transcription factor, mediator of catabolite repression
RA CP009273 4,151,176 T→G V42G (GTC→GGC)  fabR → transcriptional repressor of fabA and fabB
RA CP009273 4,154,051 G→C G162A (GGA→GCA)  btuB → vitamin B12/cobalamin outer membrane transporter
RA CP009273 4,231,705 G→T R160S (CGC→AGC)  xylE ← D‑xylose transporter
JC CP009273 4,236,389 (CACCTA)1→2 intergenic (‑42/‑323) malE ← / → malK maltose transporter subunit/fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein
JC CP009273 4,237,722 (CCGCCAGAACGACGTGGTGTTGGTA)1→2 coding (1011/1116 nt) malK → fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein
JC CP009273 4,469,423 (TCTTCTTACGTACGCAAGC)1→2 intergenic (‑69/‑124) yjgM ← / → yjgN putative acetyltransferase/DUF898 family inner membrane protein
MC JC CP009273 4,581,222 Δ3 bp intergenic (‑126/‑250) yjiY ← / → tsr putative transporter/methyl‑accepting chemotaxis protein I, serine sensor receptor
RA CP009273 4,618,035 G→A A302T (GCC→ACC)  nadR → trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ CP009273 782247 783091 845 91 [88] [89] 94 gpmA gpmA
* * ÷ CP009273 1800590 1801571 982 93 [90] [88] 92 pfkB pfkB
* * ÷ CP009273 1929079 1930616 1538 91 [90] [90] 94 zwf zwf
* * ÷ CP009273 3778568 3780196 1629 94 [90] [89] 91 gpmM gpmM
* * ÷ CP009273 4097438 4098465 1028 91 [87] [87] 93 pfkA pfkA
* * ÷ CP009273 4205381 4210251 4871 94 [90] [90] 92 aceB–[arpA] aceB,aceA,[aceK],[arpA]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? CP009273 119144 =21 (0.130)156 (0.940) 112/200 0.2 88.1% coding (566/765 nt) pdhR pyruvate dehydrogenase complex repressor; autorepressor
?CP009273 = 119152 NA (NA)coding (574/765 nt) pdhR pyruvate dehydrogenase complex repressor; autorepressor
* ? CP009273 189030 =23 (0.140)171 (1.030) 110/200 0.2 88.1% coding (689/726 nt) pyrH uridylate kinase
?CP009273 = 189041 NA (NA)coding (700/726 nt) pyrH uridylate kinase
* ? CP009273 1662553 =7 (0.040)190 (1.150) 118/200 0.1 96.5% coding (269/1221 nt) mlc glucosamine anaerobic growth regulon transcriptional repressor; autorepressor
?CP009273 = 1662559 NA (NA)coding (263/1221 nt) mlc glucosamine anaerobic growth regulon transcriptional repressor; autorepressor
* ? CP009273 2006970 =55 (0.330)142 (0.870) 106/198 0.3 74.5% coding (261/1659 nt) fliF flagellar basal‑body MS‑ring and collar protein
?CP009273 = 2007005 43 (0.260)coding (296/1659 nt) fliF flagellar basal‑body MS‑ring and collar protein
* ? CP009273 2278943 =16 (0.100)152 (0.920) 100/200 0.6 90.5% coding (1089/1761 nt) yejM essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor
?CP009273 = 2278953 NA (NA)coding (1099/1761 nt) yejM essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor
* ? CP009273 3728756 =83 (0.500)177 (1.070) 116/200 0.1 71.4% coding (418/1179 nt) xylR xylose divergent operon transcriptional activator
?CP009273 = 3728788 59 (0.360)coding (450/1179 nt) xylR xylose divergent operon transcriptional activator