New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 182120219 (0.480)4 (0.110)
+GGATGCAAG
3/196 3.4 18.3% coding (13/1359 nt) chbC N,N'‑diacetylchitobiose‑specific enzyme IIC component of PTS
?NC_000913 = 2148961 20 (0.500)coding (1288/1353 nt) yegD Hsp70 chaperone family protein
Rejected: Coverage evenness skew score above cutoff.
Rejected: Frequency below/above cutoff threshold.

TTCAAGCGATGCAAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913/1821188‑1821202
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CTGCAATCGGAATGC  <  NC_000913/2148961‑2148947
               |||||||||               
TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGC  <  1:203887/39‑1
TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGC  >  2:203887/1‑39
TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATG   <  1:924800/38‑1
TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATG   >  2:924800/1‑38
               |||||||||               
TTCAAGCGATGCAAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913/1821188‑1821202
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CTGCAATCGGAATGC  <  NC_000913/2148961‑2148947

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 31 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.