| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 4094379 = | 21 (0.410) | 4 (0.080) | 3/242 | NT | 17.8% | noncoding (64/402 nt) | REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences | REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences |
| ? | NC_000913 | 4094606 = | 17 (0.350) | noncoding (291/402 nt) | REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences | REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < NC_000913/4094415‑4094379‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑gataagGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG > NC_000913/4094606‑4094676 AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG < 3:320428/108‑1AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG > 4:320428/1‑108AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGA < 1:244703/70‑1AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGA > 2:244703/1‑70 AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < NC_000913/4094415‑4094379‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑gataagGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG > NC_000913/4094606‑4094676 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 30 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |