New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 416834114 (0.120)10 (0.100) 9/158 NT 44.6% intergenic (+141/‑31) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
?NC_000913 = 4168363 NA (NA)intergenic (+163/‑9) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu

TCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGG‑TTCGAATCCCCTAGGGGA  >  NC_000913/4168343‑4168442
                    |                                                                                
tCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGATTCGAA‑CCCCtgttacc  <  2:2759295/100‑7 (MQ=1)
                    |                                                                                
TCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGG‑TTCGAATCCCCTAGGGGA  >  NC_000913/4168343‑4168442

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 22 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.