Predicted mutation
evidence seq id position mutation annotation gene description
RA W3110S.gb 698,061 (GCAC)2→3 coding (1539/1665 nt) asnB ← asparagine synthetase B

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*W3110S.gb698,0531.G81.8% 27.5 / 1.1 11coding (1547/1665 nt)asnBasparagine synthetase B
Reads supporting (aligned to +/- strand):  ref base . (0/2);  new base G (9/0);  total (9/2)
Fisher's exact test for biased strand distribution p-value = 1.82e-02
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 1.00e+00
*W3110S.gb698,0532.C81.8% 25.1 / 1.4 11coding (1547/1665 nt)asnBasparagine synthetase B
Reads supporting (aligned to +/- strand):  ref base . (0/2);  new base C (9/0);  total (9/2)
Fisher's exact test for biased strand distribution p-value = 1.82e-02
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 6.95e-01
*W3110S.gb698,0533.A81.8% 22.0 / 1.9 11coding (1547/1665 nt)asnBasparagine synthetase B
Reads supporting (aligned to +/- strand):  ref base . (0/2);  new base A (9/0);  total (9/2)
Fisher's exact test for biased strand distribution p-value = 1.82e-02
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 9.60e-01
*W3110S.gb698,0534.C81.8% 27.7 / 1.4 11coding (1547/1665 nt)asnBasparagine synthetase B
Reads supporting (aligned to +/- strand):  ref base . (0/2);  new base C (9/0);  total (9/2)
Fisher's exact test for biased strand distribution p-value = 1.82e-02
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 9.60e-01

TCGCTTTAGCGGAAGAACAAGCGACGGAAGGACCGCCCG‑‑‑‑GCACGCACTCAGCGGCGCTCGGA  >  W3110S.gb/698015‑698076
                                       ||||                       
tCGCTTTAGCGGAAGAACAAGCGACGGAAGGACCGCCCG‑‑‑‑GCACGCACTCAGCGGCGCTCgg   <  1:830307/61‑1 (MQ=255)
tCGCTTTAGCGGAAGAACAAGCGACGGAAGGACCGCCCG‑‑‑‑GCACGCACTCAGCGGCGCTCgg   <  1:86304/61‑1 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCgg   >  1:1386072/1‑61 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:1091759/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:1310596/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:1327613/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:2468288/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:2726761/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:3111558/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:612543/1‑62 (MQ=255)
    tttAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACGCACTCAGCGGCGCTCGGa  >  1:85570/1‑62 (MQ=255)
                                       ||||                       
TCGCTTTAGCGGAAGAACAAGCGACGGAAGGACCGCCCG‑‑‑‑GCACGCACTCAGCGGCGCTCGGA  >  W3110S.gb/698015‑698076

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑