New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? minE = 259394946 (0.890)3 (0.060) 3/100 NT 5.6% intergenic (‑220/+921) slp/arsC outer membrane lipoprotein/arsenate reductase
?minE = 2593974 57 (1.120)intergenic (‑245/+896) slp/arsC outer membrane lipoprotein/arsenate reductase

TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/2593903‑2593949
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑aTTGATTATTAGCACTTTATAATCATT  <  minE/2593974‑2593949
                                                                         
TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCAATGATTATTAGCACTTTATAATCA    >  1:2019619/1‑71
      AGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCATTGATTATTAGCACTTTATAATCAT   <  1:1550608/66‑1
        TGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCATTGATTATTAGCACTTTATAATCATT  >  1:1662134/1‑65
                                                                         
TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/2593903‑2593949
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑aTTGATTATTAGCACTTTATAATCATT  <  minE/2593974‑2593949

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.