Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,669,352:1 +AAC 100% coding (691/1473 nt) der ← predicted GTP‑binding protein

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,669,3521.A100.0% 17.5 / NA 7Y231? (TAC→NAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base A (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,669,3522.A100.0% 17.5 / NA 7Y231? (TAC→NAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base A (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,669,3523.C100.0% 19.6 / NA 7Y231D (TAC→GAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base C (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

TGTCACGCGTCGTGCCAGGCATGTCGTA‑‑‑AACAACAACGCGCTCTTCACCAAGAATACG  >  minE/1669325‑1669382
                            |||                              
tGTCACGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:150417/61‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:101962/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:44479/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:515247/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:555968/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:574444/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCATAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:28112/57‑1 (MQ=255)
                            |||                              
TGTCACGCGTCGTGCCAGGCATGTCGTA‑‑‑AACAACAACGCGCTCTTCACCAAGAATACG  >  minE/1669325‑1669382

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑