Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,600,586 Δ5 bp 100% coding (856‑860/1425 nt) murP → fused predicted enzyme IIBC components of PTS

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,600,5860A.100.0% 29.7 / NA 8coding (856/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base A (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5870T.100.0% 29.7 / NA 8coding (857/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5880G.100.0% 29.7 / NA 8coding (858/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base G (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5890T.100.0% 29.7 / NA 8coding (859/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5900C.100.0% 29.7 / NA 8coding (860/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base C (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619
                            |||||                             
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTaa    >  1:32821/1‑55 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1044091/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1069841/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:171714/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2095591/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2194277/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:316430/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:758857/1‑57 (MQ=255)
                            |||||                             
GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑