New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? minE 1361030 =64 (1.320)3 (0.060) 3/100 NT 4.6% intergenic (‑23/+240) yehE/mrp hypothetical protein/antiporter inner membrane protein
?minE 1361061 = 61 (1.260)intergenic (‑54/+209) yehE/mrp hypothetical protein/antiporter inner membrane protein
Rejected: Frequency below/above cutoff threshold.

TTGTTATGCACTCATTCTATCCAGGCATAACC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1361061‑1361030
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  >  minE/1361061‑1361101
                                                                         
TTGTTATGCACTCATTCTATCCAGGCATAACCAACTATAGCTGTACATCCACTACACAGCCACGAAGGAT     >  1:2775783/1‑70
   TTATGCACTCATTCTATCCAGGCATAACCAACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  <  1:1289569/70‑1
     ATGCACTCATTCTATCCAGGCATAACAAACTATAGCTGTACATCCACTA                     <  1:1558696/49‑1
                                                                         
TTGTTATGCACTCATTCTATCCAGGCATAACC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1361061‑1361030
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  >  minE/1361061‑1361101

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.