New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? Exported 142010 =25 (0.420)6 (0.100) 3/102 NT 16.2% coding (463/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
?Exported 142041 = 37 (0.630)coding (432/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase

TGCGTCAAATCTTACATACAAGAGCATTTGACA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/142042‑142010
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  Exported/142041‑142080
                                                                         
TGCGTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGC      >  1:3281139/1‑69
   GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:1647727/68‑1
   GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:2192475/68‑1
   GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:2428645/68‑1
   GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:685588/68‑1
     CAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  1:446205/1‑68
                                                                         
TGCGTCAAATCTTACATACAAGAGCATTTGACA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/142042‑142010
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  Exported/142041‑142080

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.