New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? AP009048 = 3931054106 (1.810)4 (0.070) 4/102 NT 4.0% coding (1115/1692 nt) eptB predicted metal dependent hydrolase
?AP009048 = 3931080 88 (1.500)coding (1141/1692 nt) eptB predicted metal dependent hydrolase
Rejected: Frequency below/above cutoff threshold.

ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  AP009048/3931000‑3931054
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATTGCTGCATTTCGTCTACCAGCA  <  AP009048/3931080‑3931057
                                                                               
ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATGTTGCTGCATTTCGTC          >  1:5341332/1‑71
      AGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATATTGCTGCATTTCGTCTACCA     <  1:4745831/70‑1
       GCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATGTTGCTGCATTTCGTCTACCAGC   <  1:4458671/71‑1
         AGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATATTGCTGCATTTCGTCTACCAGCA  <  1:3191925/70‑1
                                                                               
ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  AP009048/3931000‑3931054
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATTGCTGCATTTCGTCTACCAGCA  <  AP009048/3931080‑3931057

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.