breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 9,907 A→C 6.5% intergenic (+14/+21) mog → / ← satP molybdopterin adenylyltransferase/acetate/succinate:H(+) symporter
RA 9,908 G→T 8.1% intergenic (+15/+20) mog → / ← satP molybdopterin adenylyltransferase/acetate/succinate:H(+) symporter
RA 53,376 G→A 8.0% P14L (CCC→CTC)  pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 53,379 T→C 8.8% E13G (GAG→GGG)  pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 78,830 T→A 6.9% intergenic (+31/+18) setA → / ← leuD sugar exporter SetA/3‑isopropylmalate dehydratase subunit LeuD
RA 78,831 T→A 6.9% intergenic (+32/+17) setA → / ← leuD sugar exporter SetA/3‑isopropylmalate dehydratase subunit LeuD
RA 125,387 C→T 100% Q791* (CAG→TAG)  aceE → pyruvate dehydrogenase E1 component
RA 167,291 G→A 7.4% intergenic (+27/‑193) mrcB → / → fhuA peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor
RA 167,293 G→C 8.2% intergenic (+29/‑191) mrcB → / → fhuA peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor
RA 167,295 T→C 7.3% intergenic (+31/‑189) mrcB → / → fhuA peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor
MC JC 257,908 Δ776 bp 100% insB9–[crl] insB9, insA9, [crl]
RA 481,225 T→G 8.7% intergenic (‑517/+29) tomB ← / ← acrB protein that modulates Hha toxicity/multidrug efflux pump RND permease AcrB
RA 506,394 C→T 7.0% A494V (GCG→GTG)  ushA → 5'‑nucleotidase/UDP‑sugar hydrolase
RA 696,470 C→T 100% noncoding (35/75 nt) glnX ← tRNA‑Gln
JC JC 710,682 IS5 (–) +4 bp 73.6% coding (41‑44/87 nt) uof ← RyhB‑regulated fur leader peptide
RA 759,250 G→T 100% R182L (CGC→CTC)  sucA → subunit of E1(0) component of 2‑oxoglutarate dehydrogenase
RA 770,682 A→C 12.0% intergenic (+71/‑776) mngB → / → cydA alpha‑mannosidase/cytochrome bd‑I ubiquinol oxidase subunit I
RA 781,668 C→T 6.5% intergenic (+16/‑417) lysQ → / → nadA tRNA‑Lys/quinolinate synthase
RA 781,670 A→T 6.6% intergenic (+18/‑415) lysQ → / → nadA tRNA‑Lys/quinolinate synthase
RA 781,672 A→G 6.7% intergenic (+20/‑413) lysQ → / → nadA tRNA‑Lys/quinolinate synthase
RA 786,458 Δ1 bp 100% coding (826/1053 nt) aroG → 3‑deoxy‑7‑phosphoheptulonate synthase, Phe‑sensitive
RA 866,530 T→C 8.1% intergenic (‑166/‑38) moeA ← / → iaaA molybdopterin molybdotransferase/isoaspartyl dipeptidase proenzyme
RA 915,081 G→C 10.5% intergenic (‑224/+271) lysO ← / ← aqpZ L‑lysine exporter/water channel AqpZ
RA 1,151,873 T→A 7.7% intergenic (+22/‑66) acpP → / → fabF acyl carrier protein/beta‑ketoacyl‑[acyl carrier protein] synthase II
RA 1,151,874 T→A 8.0% intergenic (+23/‑65) acpP → / → fabF acyl carrier protein/beta‑ketoacyl‑[acyl carrier protein] synthase II
RA 1,159,335 G→T 6.0% intergenic (+33/+27) ptsG → / ← fhuE glucose‑specific PTS enzyme IIBC component/ferric coprogen/ferric rhodotorulic acid outer membrane transporter
RA 1,159,336 A→C 6.7% intergenic (+34/+26) ptsG → / ← fhuE glucose‑specific PTS enzyme IIBC component/ferric coprogen/ferric rhodotorulic acid outer membrane transporter
RA 1,196,220 C→T 53.1% H366H (CAC→CAT)  icd → isocitrate dehydrogenase
RA 1,196,232 C→T 47.7% T370T (ACC→ACT)  icd → isocitrate dehydrogenase
RA 1,196,245 T→C 35.4% L375L (TTA→CTA) ‡ icd → isocitrate dehydrogenase
RA 1,196,247 A→G 36.7% L375L (TTA→TTG) ‡ icd → isocitrate dehydrogenase
RA 1,211,612 A→T 9.9% intergenic (+35/+68) icdC → / ← iraM protein IcdC/anti‑adaptor protein IraM, inhibitor of sigma(S) proteolysis
RA 1,233,154 T→A 9.3% intergenic (‑124/+22) dsbB ← / ← nhaB protein thiol:quinone oxidoreductase DsbB/Na(+):H(+) antiporter NhaB
RA 1,233,157 T→A 9.1% intergenic (‑127/+19) dsbB ← / ← nhaB protein thiol:quinone oxidoreductase DsbB/Na(+):H(+) antiporter NhaB
RA 1,273,229 A→T 6.2% intergenic (+27/+17) chaC → / ← ychN glutathione‑specific gamma‑glutamylcyclotransferase/DsrE/F sulfur relay family protein YchN
RA 1,285,193 T→A 7.1% W19R (TGG→AGG)  narJ → nitrate reductase 1 molybdenum cofactor assembly chaperone
JC JC 1,293,032 IS1 (–) +8 bp 100% intergenic (‑110/‑488) hns ← / → tdk DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase
MC JC 1,299,499 Δ1,199 bp 100% insH21 insH21
RA 1,309,041 T→C 6.9% D410G (GAC→GGC)  kch ← K(+) channel Kch
RA 1,344,036 G→C 7.0% T104S (ACT→AGT)  yciT ← putative DNA‑binding transcriptional regulator YciT
RA 1,376,207 C→A 9.1% A58A (GCC→GCA)  ycjR → putative ketohexose‑3‑epimerase YcjR
RA 1,382,000 C→T 10.1% C18C (TGC→TGT)  ompG → outer membrane porin G
RA 1,382,003 A→G 13.7% A19A (GCA→GCG)  ompG → outer membrane porin G
RA 1,482,224 T→G 8.1% intergenic (+23/+31) ynbD → / ← azoR putative phosphatase/FMN dependent NADH:quinone oxidoreductase
RA 1,524,458:1 +T 8.9% intergenic (+90/+23) yncE → / ← ansP PQQ‑like domain‑containing protein YncE/L‑asparagine transporter
RA 1,524,463 Δ1 bp 8.7% intergenic (+95/+18) yncE → / ← ansP PQQ‑like domain‑containing protein YncE/L‑asparagine transporter
RA 1,557,194 A→C 12.2% L282R (CTG→CGG)  ddpF ← putative D,D‑dipeptide ABC transporter ATP‑binding subunit DdpF
RA 1,557,197 G→T 11.4% P281Q (CCG→CAG)  ddpF ← putative D,D‑dipeptide ABC transporter ATP‑binding subunit DdpF
RA 1,674,955 A→T 7.0% intergenic (+8/+17) tqsA → / ← pntB autoinducer 2 exporter/pyridine nucleotide transhydrogenase subunit beta
RA 1,674,958 A→T 7.4% intergenic (+11/+14) tqsA → / ← pntB autoinducer 2 exporter/pyridine nucleotide transhydrogenase subunit beta
RA 1,703,251 A→T 10.5% intergenic (+17/+17) add → / ← ydgJ adenosine deaminase/putative oxidoreductase YdgJ
RA 1,703,252 A→T 10.0% intergenic (+18/+16) add → / ← ydgJ adenosine deaminase/putative oxidoreductase YdgJ
RA 1,764,427 G→A 33.2% intergenic (‑41/+286) sufA ← / ← rydB iron‑sulfur cluster insertion protein SufA/small regulatory RNA RydB
RA 1,865,682 G→C 5.4% intergenic (‑46/+44) yeaE ← / ← mipA methylglyoxal reductase YeaE/scaffolding protein that interacts with murein polymerase and murein hydrolase
RA 1,948,179 T→A 6.6% intergenic (‑28/+1) yebC ← / ← nudB putative transcriptional regulator YebC/dihydroneopterin triphosphate diphosphatase
RA 1,948,180 T→A 6.6% *151C (TGA→TGT)  nudB ← dihydroneopterin triphosphate diphosphatase
MC JC 1,978,503 Δ776 bp 100% insB‑5–insA‑5 insB‑5, insA‑5
JC JC 1,979,486 IS5 (+) +4 bp 100% intergenic (‑271/‑264) insA‑5 ← / → uspC IS1 protein InsA/universal stress protein C
RA 2,132,787 A→C 100% I204S (ATC→AGC)  wcaA ← putative colanic acid biosynthesis glycosyl transferase
RA 2,173,361 Δ2 bp 100% pseudogene (917‑918/1358 nt) gatC ← galactitol‑specific PTS enzyme IIC component
RA 2,373,177 G→A 7.7% G96S (GGC→AGC)  arnF → undecaprenyl‑phosphate‑alpha‑L‑Ara4N flippase ‑ ArnF subunit
RA 2,373,180 T→C 7.7% W97R (TGG→CGG)  arnF → undecaprenyl‑phosphate‑alpha‑L‑Ara4N flippase ‑ ArnF subunit
RA 2,383,956 A→T 8.9% intergenic (+32/+39) elaD → / ← yfbK protease ElaD/IPR002035/DUF3520 domain‑containing protein YfbK
RA 2,383,959 A→T 9.1% intergenic (+35/+36) elaD → / ← yfbK protease ElaD/IPR002035/DUF3520 domain‑containing protein YfbK
RA 2,394,770 T→C 17.7% T93A (ACT→GCT)  nuoL ← NADH:quinone oxidoreductase subunit L
JC 2,399,711 Δ123 bp 38.5% coding (333‑455/2727 nt) nuoG ← NADH:quinone oxidoreductase subunit G
RA 2,432,985 A→G 11.1% intergenic (‑43/+27) folC ← / ← accD bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta
RA 2,432,990 G→C 9.7% intergenic (‑48/+22) folC ← / ← accD bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta
RA 2,432,995 C→T 8.7% intergenic (‑53/+17) folC ← / ← accD bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta
JC 2,436,385 Δ97 bp 64.4% coding (169‑265/1014 nt) usg ← putative semialdehyde dehydrogenase Usg
RA 2,440,866 A→G 5.9% L247P (CTG→CCG)  fabB ← beta‑ketoacyl‑[acyl carrier protein] synthase I
RA 2,621,591 A→T 8.2% Q132L (CAA→CTA)  purM → phosphoribosylformylglycinamide cyclo‑ligase
RA 2,622,348:1 +A 10.0% coding (115/639 nt) purN → phosphoribosylglycinamide formyltransferase 1
RA 2,622,354 Δ1 bp 10.0% coding (121/639 nt) purN → phosphoribosylglycinamide formyltransferase 1
RA 2,661,969 C→G 100% V55L (GTT→CTT)  iscR ← DNA‑binding transcriptional dual regulator IscR
RA 2,753,755 A→G 6.9% T51A (ACG→GCG)  bamE → outer membrane protein assembly factor BamE
RA 2,761,620 T→G 11.7% K641Q (AAG→CAG)  abpB ← CP4‑57 prophage; putative helicase YfjK
RA 2,761,623 C→A 10.5% V640L (GTA→TTA)  abpB ← CP4‑57 prophage; putative helicase YfjK
RA 2,929,722 G→A 8.5% V49V (GTG→GTA)  sdaB → L‑serine deaminase II
RA 2,936,359 T→A 10.6% V259D (GTT→GAT)  fucI → L‑fucose isomerase
RA 3,007,466 T→C 9.8% intergenic (+14/‑44) ygeW → / → ygeX putative carbamoyltransferase YgeW/2,3‑diaminopropionate ammonia‑lyase
RA 3,007,473 G→A 9.0% intergenic (+21/‑37) ygeW → / → ygeX putative carbamoyltransferase YgeW/2,3‑diaminopropionate ammonia‑lyase
RA 3,041,632 T→A 100% V107E (GTG→GAG)  ygfZ → folate‑binding protein
RA 3,156,590 C→A 7.4% intergenic (+72/‑33) yqhD → / → dkgA NADPH‑dependent aldehyde reductase YqhD/methylglyoxal reductase DkgA
RA 3,156,591 T→G 8.2% intergenic (+73/‑32) yqhD → / → dkgA NADPH‑dependent aldehyde reductase YqhD/methylglyoxal reductase DkgA
RA 3,208,201 G→A 8.0% V60M (GTG→ATG)  ttdT → L‑tartrate:succinate antiporter
RA 3,288,032 C→A 6.5% intergenic (+22/‑58) yraH → / → yraI putative fimbrial protein YraH/putative fimbrial chaperone YraI
RA 3,288,033 T→G 6.7% intergenic (+23/‑57) yraH → / → yraI putative fimbrial protein YraH/putative fimbrial chaperone YraI
RA 3,324,952 A→G 9.3% intergenic (‑41/+49) folP ← / ← ftsH dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH
RA 3,324,955 A→G 8.3% intergenic (‑44/+46) folP ← / ← ftsH dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH
RA 3,324,956 C→T 8.2% intergenic (‑45/+45) folP ← / ← ftsH dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH
RA 3,324,959 C→T 8.1% intergenic (‑48/+42) folP ← / ← ftsH dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH
RA 3,368,142 A→T 7.8% M106L (ATG→TTG)  yhcG → DUF1016 domain‑containing protein YhcG
RA 3,396,961 C→A 11.4% A279S (GCG→TCG)  rng ← RNase G
RA 3,396,962 T→G 14.4% R278R (CGA→CGC)  rng ← RNase G
RA 3,473,614 C→T 12.4% W156* (TGG→TGA)  rpsG ← 30S ribosomal subunit protein S7
RA 3,560,455:1 +G 100% pseudogene (151/758 nt) glpR ← DNA‑binding transcriptional repressor GlpR
RA 3,577,476 G→A 6.9% G39G (GGC→GGT)  gntK ← D‑gluconate kinase, thermostable
RA 3,637,645:1 +T 100% coding (4/1500 nt) pitA → metal phosphate:H(+) symporter PitA
RA 3,708,427 G→A 9.1% intergenic (‑722/+189) dppA ← / ← proK dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro
RA 3,708,428 T→A 9.4% intergenic (‑723/+188) dppA ← / ← proK dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro
RA 3,708,429 T→C 9.9% intergenic (‑724/+187) dppA ← / ← proK dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro
RA 3,722,300 G→T 6.5% intergenic (+251/+28) insK → / ← glyS IS150 conserved protein InsB/glycine‑‑tRNA ligase subunit beta
RA 3,722,301 A→C 6.4% intergenic (+252/+27) insK → / ← glyS IS150 conserved protein InsB/glycine‑‑tRNA ligase subunit beta
RA 3,798,234 A→T 9.8% intergenic (+27/+5) waaL → / ← waaU O‑antigen ligase/putative ADP‑heptose:LPS heptosyltransferase 4
RA 3,798,235 A→T 9.8% intergenic (+28/+4) waaL → / ← waaU O‑antigen ligase/putative ADP‑heptose:LPS heptosyltransferase 4
MC JC 3,815,859 Δ82 bp 100% [rph] [rph]
RA 3,900,545 A→T 7.8% A11A (GCT→GCA)  yieL ← putative hydrolase YieL
MC JC 4,001,645 Δ5 bp 100% coding (220‑224/951 nt) corA → Ni(2(+))/Co(2(+))/Mg(2(+)) transporter
RA 4,088,091 G→C 13.1% intergenic (+34/+16) yiiG → / ← frvR DUF3829 domain‑containing lipoprotein YiiG/putative transcriptional regulator FrvR
RA 4,184,543 C→A 100% P1100Q (CCG→CAG)  rpoB → RNA polymerase subunit beta
RA 4,270,146 T→C 7.7% intergenic (+19/‑92) aphA → / → yjbQ acid phosphatase/phosphotransferase/UPF0047 protein YjbQ
RA 4,296,060 C→T 37.1% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,296,380:1 +CG 100% intergenic (+586/+56) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,561,590 A→C 10.6% L362L (CTT→CTG)  yjiJ ← putative transporter YjiJ

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3423735–3424534 3424534 1–800 24 [23] [23] 24 [rrfD]–[rrlD] [rrfD],[rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 225154 =NA (NA)5 (0.100) 5/252 NT NA noncoding (1384/1542 nt) rrsH 16S ribosomal RNA
?NC_000913 225176 = NA (NA)noncoding (1406/1542 nt) rrsH 16S ribosomal RNA
* ? NC_000913 = 315646NA (NA)7 (0.140) 7/252 NT NA noncoding (418/1255 nt) IS3 repeat region
?NC_000913 = 315665 NA (NA)noncoding (437/1255 nt) IS3 repeat region
* ? NC_000913 315892 =NA (NA)4 (0.080) 4/256 NT NA noncoding (664/1255 nt) IS3 repeat region
?NC_000913 315923 = NA (NA)noncoding (695/1255 nt) IS3 repeat region
* ? NC_000913 316099 =NA (NA)4 (0.080) 3/246 NT NA noncoding (871/1255 nt) IS3 repeat region
?NC_000913 316185 = NA (NA)noncoding (957/1255 nt) IS3 repeat region
* ? NC_000913 508581 =NA (NA)3 (0.070)
+GTTCAGGCACAAGTTTGTAG
3/222 NT NA intergenic (+22/+294) ybaQ/copA putative DNA‑binding transcriptional regulator YbaQ/Cu(+) exporting P‑type ATPase
?NC_000913 508630 = NA (NA)intergenic (+71/+245) ybaQ/copA putative DNA‑binding transcriptional regulator YbaQ/Cu(+) exporting P‑type ATPase
* ? NC_000913 = 508686NA (NA)4 (0.080) 3/248 NT NA noncoding (32/34 nt) other REP48c
?NC_000913 = 4027405 NA (NA)noncoding (2/34 nt) other REP291b
* ? NC_000913 566777 =NA (NA)2317 (43.360) 256/260 NT 97.8% noncoding (1/1258 nt) IS3 repeat region
?NC_000913 = 572471 52 (0.970)coding (6/456 nt) ybcN DLP12 prophage; DNA base‑flipping protein
* ? NC_000913 = 57247152 (0.970)8 (0.200)
+34 bp
7/194 NT 23.8% coding (6/456 nt) ybcN DLP12 prophage; DNA base‑flipping protein
?NC_000913 = 2170235 17 (0.320)noncoding (65/1258 nt) IS3 repeat region
* ? NC_000913 591569 =62 (1.150)4 (0.080) 4/250 NT 6.6% coding (1610/2238 nt) nfrB bacteriophage N4 receptor, inner membrane subunit
?NC_000913 591595 = 54 (1.050)coding (1584/2238 nt) nfrB bacteriophage N4 receptor, inner membrane subunit
* ? NC_000913 644857 =48 (0.890)3 (0.060) 3/246 NT 6.3% coding (147/807 nt) rna RNase I
?NC_000913 644879 = 44 (0.870)coding (125/807 nt) rna RNase I
* ? NC_000913 1207790 =5 (0.090)11 (0.230) 11/230 NT 72.4% coding (290/630 nt) ycfK e14 prophage; protein StfP
?NC_000913 1209619 = 4 (0.080)pseudogene (37/537 nt) stfE e14 prophage; putative side tail fiber protein fragment
* ? NC_000913 = 12078054 (0.070)8 (0.170) 8/230 NT 68.1% coding (305/630 nt) ycfK e14 prophage; protein StfP
?NC_000913 = 1209602 4 (0.080)pseudogene (54/537 nt) stfE e14 prophage; putative side tail fiber protein fragment
* ? NC_000913 = 123458953 (0.980)3 (0.060) 3/250 NT 5.6% coding (129/1542 nt) nhaB Na(+):H(+) antiporter NhaB
?NC_000913 = 1234598 50 (0.970)coding (120/1542 nt) nhaB Na(+):H(+) antiporter NhaB
* ? NC_000913 1550509 =50 (0.930)3 (0.060) 3/248 NT 5.9% coding (49/885 nt) fdnH formate dehydrogenase N subunit beta
?NC_000913 1550536 = 49 (0.960)coding (76/885 nt) fdnH formate dehydrogenase N subunit beta
* ? NC_000913 2026671 =39 (0.720)3 (0.060) 3/250 NT 7.2% coding (1347/1695 nt) dgcQ putative diguanylate cyclase DgcQ
?NC_000913 2026688 = 40 (0.780)coding (1330/1695 nt) dgcQ putative diguanylate cyclase DgcQ
* ? NC_000913 2049991 =52 (0.970)3 (0.060) 3/252 NT 5.9% coding (5054/7077 nt) yeeJ inverse autotransporter adhesin
?NC_000913 2050006 = 45 (0.870)coding (5069/7077 nt) yeeJ inverse autotransporter adhesin
* ? NC_000913 = 215460036 (0.670)3 (0.060) 3/246 NT 7.2% coding (585/1248 nt) mdtA multidrug efflux pump membrane fusion protein MdtA
?NC_000913 = 2154615 44 (0.870)coding (600/1248 nt) mdtA multidrug efflux pump membrane fusion protein MdtA
* ? NC_000913 = 2443842NA (NA)3 (0.060) 3/248 NT NA noncoding (28/37 nt) other REP171b
?NC_000913 = 2443861 NA (NA)noncoding (9/37 nt) other REP171b
* ? NC_000913 = 253370552 (0.970)3 (0.060) 3/246 NT 5.9% intergenic (+325/‑59) cysK/ptsH O‑acetylserine sulfhydrylase A/phosphocarrier protein HPr
?NC_000913 = 2533719 47 (0.930)intergenic (+339/‑45) cysK/ptsH O‑acetylserine sulfhydrylase A/phosphocarrier protein HPr
* ? NC_000913 = 293961872 (1.340)4 (0.070) 3/260 NT 5.3% coding (251/732 nt) fucR DNA‑binding transcriptional activator FucR
?NC_000913 = 2939635 71 (1.330)coding (268/732 nt) fucR DNA‑binding transcriptional activator FucR
* ? NC_000913 3297649 =50 (0.930)4 (0.080) 4/252 NT 7.8% coding (490/1041 nt) yraQ permease family protein YraQ
?NC_000913 3297673 = 47 (0.910)coding (466/1041 nt) yraQ permease family protein YraQ
* ? NC_000913 3423373 =70 (1.300)4 (0.080) 4/258 NT 6.3% intergenic (+179/+50) yhdZ/rrfF putative ABC transporter ATP‑binding subunit YhdZ/5S ribosomal RNA
?NC_000913 3423668 = 50 (0.940)noncoding (120/120 nt) rrfD 5S ribosomal RNA
* ? NC_000913 = 357121547 (0.870)3 (0.060) 3/252 NT 6.0% coding (105/1974 nt) glgX limit dextrin alpha‑1,6‑glucohydrolase
?NC_000913 = 3571246 49 (0.950)coding (74/1974 nt) glgX limit dextrin alpha‑1,6‑glucohydrolase
* ? NC_000913 3639740 =51 (0.950)3 (0.060) 3/254 NT 6.0% intergenic (‑20/‑371) uspB/uspA putative universal stress (ethanol tolerance) protein B/universal stress global stress response regulator
?NC_000913 3639764 = 45 (0.860)intergenic (‑44/‑347) uspB/uspA putative universal stress (ethanol tolerance) protein B/universal stress global stress response regulator
* ? NC_000913 = 374491357 (1.060)3 (0.060) 3/246 NT 5.1% coding (110/1278 nt) yiaN 2,3‑diketo‑L‑gulonate:Na(+) symporter ‑ membrane subunit
?NC_000913 = 3744918 58 (1.150)coding (115/1278 nt) yiaN 2,3‑diketo‑L‑gulonate:Na(+) symporter ‑ membrane subunit
* ? NC_000913 = 3943624NA (NA)6 (0.120) 4/248 NT 14.3% intergenic (+114/‑80) gltU/rrlC tRNA‑Glu/23S ribosomal RNA
?NC_000913 = 4037457 38 (0.710)intergenic (+122/‑62) alaT/rrlA tRNA‑Ala/23S ribosomal RNA
* ? NC_000913 = 399803647 (0.870)5 (0.090) 5/258 NT 9.0% coding (54/2163 nt) uvrD ssDNA translocase and dsDNA helicase ‑ DNA helicase II
?NC_000913 = 3998077 55 (1.040)coding (95/2163 nt) uvrD ssDNA translocase and dsDNA helicase ‑ DNA helicase II
* ? NC_000913 4240741 =61 (1.130)3 (0.060) 3/242 NT 5.1% intergenic (+6/+38) psiE/xylE putative phosphate starvation‑inducible protein/D‑xylose:H(+) symporter
?NC_000913 4240769 = 55 (1.110)intergenic (+34/+10) psiE/xylE putative phosphate starvation‑inducible protein/D‑xylose:H(+) symporter
* ? NC_000913 4363384 =51 (0.950)3 (0.060) 3/246 NT 6.4% coding (1659/1698 nt) dsbD protein disulfide oxidoreductase ‑ DsbDreduced
?NC_000913 4363422 = 40 (0.790)coding (1621/1698 nt) dsbD protein disulfide oxidoreductase ‑ DsbDreduced
* ? NC_000913 = 442544351 (0.950)3 (0.060) 3/256 NT 5.7% coding (326/396 nt) rpsF 30S ribosomal subunit protein S6
?NC_000913 = 4425453 49 (0.930)coding (336/396 nt) rpsF 30S ribosomal subunit protein S6
* ? NC_000913 = 450960356 (1.040)3 (0.060) 3/246 NT 5.2% noncoding (597/795 nt) IS911 repeat region
?NC_000913 = 4509607 57 (1.130)noncoding (601/795 nt) IS911 repeat region
* ? NC_000913 = 451364749 (0.910)5 (0.100) 5/254 NT 9.2% coding (662/903 nt) fecB ferric citrate ABC transporter periplasmic binding protein
?NC_000913 = 4513662 51 (0.980)coding (647/903 nt) fecB ferric citrate ABC transporter periplasmic binding protein