breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 4,009 T→C 11.1% D92D (GAT→GAC)  thrC → threonine synthase
RA 124,241 C→T 100% Q409* (CAG→TAG)  aceE → pyruvate dehydrogenase E1 component
RA 151,522 G→T 12.7% A26A (GCC→GCA)  yadK ← putative fimbrial protein YadK
RA 252,564 T→C 15.4% Y88Y (TAT→TAC)  yafO → ribosome‑dependent mRNA interferase toxin YafO
MC JC 257,908 Δ776 bp 100% insB9–[crl] insB9, insA9, [crl]
JC 439,240 (TCGGCAAACCGCCGCTACTTT)1→2 32.6% coding (938/1863 nt) dxs ← 1‑deoxy‑D‑xylulose‑5‑phosphate synthase
RA 635,361 G→A 14.8% Q6* (CAA→TAA) 
C403C (TGC→TGT) 
ybdM ←
ybdN ←
ParB‑like nuclease domain‑containing protein YbdM
putative PAPS reductase/DUF3440 domain‑containing protein YbdN
RA 672,110 G→A 12.2% T26I (ACC→ATC)  lptE ← lipopolysaccharide assembly protein LptE
RA 672,113 T→C 13.8% D25G (GAT→GGT)  lptE ← lipopolysaccharide assembly protein LptE
RA 674,768 G→T 100% R6S (CGC→AGC)  leuS ← leucine‑‑tRNA ligase
RA 696,470 C→T 100% noncoding (35/75 nt) glnX ← tRNA‑Gln
RA 754,446 A→G 100% L8P (CTC→CCC)  gltA ← citrate synthase
RA 760,485 G→A 100% G594S (GGC→AGC)  sucA → subunit of E1(0) component of 2‑oxoglutarate dehydrogenase
RA 793,581 G→T 19.8% L70I (CTC→ATC)  modF ← ABC family protein ModF
RA 882,734 T→C 14.9% M1M (ATG→GTG) † deoR ← DNA‑binding transcriptional repressor DeoR
RA 1,020,166 C→T 14.4% intergenic (‑113/+244) ompA ← / ← sulA outer membrane porin A/cell division inhibitor SulA
RA 1,151,736 T→C 81.7% V41A (GTT→GCT)  acpP → acyl carrier protein
RA 1,196,803 A→C 13.1% intergenic (+430/+64) icd → / ← ymfD isocitrate dehydrogenase/e14 prophage; putative SAM‑dependent methyltransferase
JC JC 1,293,032 IS1 (–) +8 bp 100% intergenic (‑110/‑488) hns ← / → tdk DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase
MC JC 1,299,499 Δ1,199 bp 100% insH21 insH21
RA 1,426,178 A→T 7.6% intergenic (+198/‑276) ydaY → / → ynaA Rac prophage; putative uncharacterized protein YdaY/Rac prophage; putative prophage tail length tape measure domain‑containing protein YnaA
JC JC 1,572,474 IS5 (+) +4 bp 100% coding (2726‑2729/2796 nt) pqqL ← putative zinc peptidase
JC JC 1,907,799 IS5 (+) +4 bp 14.8% intergenic (‑208/+459) yobF ← / ← yebO DUF2527 domain‑containing protein YobF/uncharacterized protein YebO
MC JC 1,978,503 Δ776 bp 100% insB‑5–insA‑5 insB‑5, insA‑5
JC JC 1,979,486 IS5 (+) +4 bp 100% intergenic (‑271/‑264) insA‑5 ← / → uspC IS1 protein InsA/universal stress protein C
RA 2,132,787 A→C 100% I204S (ATC→AGC)  wcaA ← putative colanic acid biosynthesis glycosyl transferase
RA 2,173,361 Δ2 bp 100% pseudogene (917‑918/1358 nt) gatC ← galactitol‑specific PTS enzyme IIC component
RA 2,368,101 T→C 100% A21A (GCT→GCC)  arnA → fused UDP‑4‑amino‑4‑deoxy‑L‑arabinose formyltransferase/UDP‑glucuronate dehydrogenase
RA 2,661,821 C→G 100% C104S (TGC→TCC)  iscR ← DNA‑binding transcriptional dual regulator IscR
RA 2,737,631:1 +A 61.5% coding (33/48 nt) pheL → phe operon leader peptide
RA 3,041,634 A→C 100% T108P (ACC→CCC)  ygfZ → folate‑binding protein
RA 3,560,455:1 +G 100% pseudogene (151/758 nt) glpR ← DNA‑binding transcriptional repressor GlpR
RA 3,596,017 G→A 10.0% R129R (CGC→CGT)  livH ← branched chain amino acid/phenylalanine ABC transporter membrane subunit LivH
RA 3,657,599 T→A 10.0% intergenic (+32/+387) hdeD → / ← arrS acid‑resistance membrane protein/small regulatory RNA ArrS
RA 3,657,601 G→C 10.0% intergenic (+34/+385) hdeD → / ← arrS acid‑resistance membrane protein/small regulatory RNA ArrS
RA 3,657,603 T→A 9.8% intergenic (+36/+383) hdeD → / ← arrS acid‑resistance membrane protein/small regulatory RNA ArrS
MC JC 3,815,859 Δ82 bp 100% [rph] [rph]
MC JC 4,001,645 Δ5 bp 100% coding (220‑224/951 nt) corA → Ni(2(+))/Co(2(+))/Mg(2(+)) transporter
RA 4,033,610 G→A 62.5% G156S (GGT→AGT)  trkH → K(+) transporter TrkH
RA 4,184,543 C→A 100% P1100Q (CCG→CAG)  rpoB → RNA polymerase subunit beta
RA 4,196,219 A→C 100% intergenic (‑120/+113) thiC ← / ← rsd phosphomethylpyrimidine synthase/regulator of sigma D
RA 4,296,060 C→T 24.4% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,296,380:1 +CG 100% intergenic (+586/+56) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,605,176 T→C 12.5% Q163R (CAG→CGG)  fhuF ← hydroxamate siderophore iron reductase

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 366222 366390 169 9 [7] [7] 8 [lacZ] [lacZ]
* * ÷ NC_000913 3423760–3424234 3424531–3424238 5–772 8 [7] [7] 9 [rrfD]–[rrlD] [rrfD],[rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 216058NA (NA)4 (0.150) 4/250 NT NA noncoding (32/34 nt) other REP16a
?NC_000913 = 1068451 NA (NA)noncoding (2/34 nt) other REP92b
* ? NC_000913 = 315572NA (NA)3 (0.110) 3/244 NT NA noncoding (344/1255 nt) IS3 repeat region
?NC_000913 = 315588 NA (NA)noncoding (360/1255 nt) IS3 repeat region
* ? NC_000913 = 315852NA (NA)31 (1.110) 10/256 NT NA noncoding (624/1255 nt) IS3 repeat region
?NC_000913 = 315875 NA (NA)noncoding (647/1255 nt) IS3 repeat region
* ? NC_000913 = 354605NA (NA)5 (0.180) 4/250 NT NA noncoding (6/28 nt) other REPt26a
?NC_000913 = 354653 NA (NA)noncoding (13/36 nt) other REP26b
* ? NC_000913 566777 =NA (NA)1239 (43.470) 234/262 NT 98.0% noncoding (1/1258 nt) IS3 repeat region
?NC_000913 = 572471 25 (0.870)coding (6/456 nt) ybcN DLP12 prophage; DNA base‑flipping protein
* ? NC_000913 = 57247125 (0.870)8 (0.380)
+34 bp
8/196 NT 35.1% coding (6/456 nt) ybcN DLP12 prophage; DNA base‑flipping protein
?NC_000913 = 2170235 15 (0.520)noncoding (65/1258 nt) IS3 repeat region
* ? NC_000913 = 91815421 (0.730)4 (0.140) 4/264 NT 17.0% coding (967/993 nt) ybjX DUF535 domain‑containing protein YbjX
?NC_000913 = 918201 18 (0.630)coding (920/993 nt) ybjX DUF535 domain‑containing protein YbjX
* ? NC_000913 1207790 =4 (0.140)13 (0.520) 10/232 NT 85.2% coding (290/630 nt) ycfK e14 prophage; protein StfP
?NC_000913 1209619 = 1 (0.040)pseudogene (37/537 nt) stfE e14 prophage; putative side tail fiber protein fragment
* ? NC_000913 = 12078054 (0.140)14 (0.560) 13/232 NT 86.1% coding (305/630 nt) ycfK e14 prophage; protein StfP
?NC_000913 = 1209602 1 (0.040)pseudogene (54/537 nt) stfE e14 prophage; putative side tail fiber protein fragment
* ? NC_000913 = 206347833 (1.150)3 (0.110) 3/252 NT 9.0% coding (990/1080 nt) cobT nicotinate‑nucleotide‑‑dimethylbenzimidazole phosphoribosyltransferase
?NC_000913 = 2063498 29 (1.060)coding (970/1080 nt) cobT nicotinate‑nucleotide‑‑dimethylbenzimidazole phosphoribosyltransferase
* ? NC_000913 2894073 =23 (0.800)3 (0.110) 3/256 NT 11.9% coding (155/261 nt) ygcO putative 4Fe‑4S cluster‑containing protein
?NC_000913 2894099 = 22 (0.790)coding (181/261 nt) ygcO putative 4Fe‑4S cluster‑containing protein