breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation annotation gene description
MC JC 257,908 Δ776 bp [crl] [crl]
RA 264,098 G→T L50L (CTC→CTA)  ykfH ← uncharacterized protein
RA 389,925 (T)6→7 intergenic (‑198/‑326) hemB ← / → yaiT 5‑aminolevulinate dehydratase (porphobilinogen synthase)/pseudogene, autotransporter family;putative structure; Not classified; interrupted by IS3; putative flagellin structural protein
RA 482,230 G→A P725L (CCG→CTG)  acrB ← multidrug efflux system protein
RA 1,158,559 C→T Q231* (CAG→TAG)  ptsG → fused glucose‑specific PTS enzymes: IIB component/IIC component
RA 1,197,502 C→T G11R (GGA→AGA)  ymfD ← e14 prophage; putative SAM‑dependent methyltransferase
RA 1,544,022 C→A L13F (TTG→TTT)  narU ← nitrate/nitrite transporter
RA 1,726,165 A→G Y48C (TAC→TGC)  nemR → transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated
RA 1,774,576 G→A G263E (GGG→GAG)  ydiB → quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding
MC JC 1,978,503 Δ776 bp insB1–insA insB1, insA
RA 2,106,741 A→T S162S (TCT→TCA)  wbbH ← O‑antigen polymerase
RA 2,173,363 Δ2 bp intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,679,525 G→T A1074D (GCT→GAT)  yphG ← DUF4380 domain‑containing TPR repeat protein
RA 2,795,396 C→A Q382K (CAG→AAG)  gabP → gamma‑aminobutyrate transporter
RA 2,817,170 C→A E112* (GAA→TAA)  yqaB ← fructose‑1‑P and 6‑phosphogluconate phosphatase
RA 2,976,638 T→G S14A (TCA→GCA)  galR → galactose‑inducible d‑galactose regulon transcriptional repressor; autorepressor
RA 3,560,455 +G intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
RA 4,183,136 G→T R637L (CGT→CTT)  rpoB → RNA polymerase, beta subunit
RA 4,296,363 +GC intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,604,698 C→A A186E (GCA→GAA)  bglJ → bgl operon transcriptional activator

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913_3_hsa_tpiA 366300 366350 51 6 [5] [4] 6 [lacZ] [lacZ]
* * ÷ NC_000913_3_hsa_tpiA 3423764–3424232 3424554–3424239 8–791 6 [5] [5] 6 [rrfD]–[rrlD] [rrfD],[rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913_3_hsa_tpiA = 15151825 (1.050)7 (0.320) 5/264 2.3 22.5% coding (82/597 nt) yadK putative fimbrial‑like adhesin protein
?NC_000913_3_hsa_tpiA = 151522 25 (1.130)coding (78/597 nt) yadK putative fimbrial‑like adhesin protein
* ? NC_000913_3_hsa_tpiA = 225281NA (NA)6 (0.260) 5/274 2.4 NA noncoding (1511/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913_3_hsa_tpiA = 225293 NA (NA)noncoding (1523/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913_3_hsa_tpiA = 65682813 (0.550)4 (0.170) 4/280 2.8 22.3% coding (272/561 nt) pagP phospholipid:lipid A palmitoyltransferase
?NC_000913_3_hsa_tpiA = 656848 15 (0.640)coding (292/561 nt) pagP phospholipid:lipid A palmitoyltransferase
* ? NC_000913_3_hsa_tpiA 1207790 =3 (0.130)17 (0.810) 15/252 0.5 87.9% coding (290/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913_3_hsa_tpiA 1209619 = 2 (0.100)pseudogene (1/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913_3_hsa_tpiA = 12078053 (0.130)20 (0.950) 19/252 0.2 89.6% coding (305/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913_3_hsa_tpiA = 1209602 2 (0.100)pseudogene (18/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913_3_hsa_tpiA = 12994980 (0.000)20 (0.870) 20/276 0.3 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913_3_hsa_tpiA 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913_3_hsa_tpiA = 2714357NA (NA)4 (0.200)
+GCGGCGTGAACGCCTTATCC
4/244 2.5 NA noncoding (75/98 nt) RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913_3_hsa_tpiA = 3563652 NA (NA)noncoding (71/98 nt) RIP256 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP256 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913_3_hsa_tpiA 2729955 =NA (NA)4 (0.180) 4/272 2.7 NA noncoding (1203/1542 nt) rrsG 16S ribosomal RNA of rrnG operon
?NC_000913_3_hsa_tpiA 2729972 = NA (NA)noncoding (1186/1542 nt) rrsG 16S ribosomal RNA of rrnG operon