breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 1,699 G→T 5.7% P41Q (CCG→CAG)  parA ← chromosome partition protein
RA 1,706 G→C 7.2% L39V (CTC→GTC)  parA ← chromosome partition protein
RA 1,707 G→C 8.3% D38E (GAC→GAG)  parA ← chromosome partition protein
RA 12,688 A→T 6.0% Q156L (CAG→CTG)  recF → DNA replication/repair protein
RA 12,696 C→T 5.8% L159L (CTG→TTG)  recF → DNA replication/repair protein
RA 21,472 C→T 7.0% D425D (GAC→GAT)  PP_0016 → hypothetical protein
RA 26,844 A→T 8.1% intergenic (+40/+145) PP_0021 → / ← PP_0022 hypothetical protein/hypothetical protein
RA 40,952 T→C 6.4% W162R (TGG→CGG)  oprP → porin P
RA 42,123 C→T 5.9% R23C (CGC→TGC)  PP_0039 → hypothetical protein
RA 54,899 T→C 6.6% *225Q (TAG→CAG)  czcR‑II → response regulator
RA 58,435 G→C 5.7% intergenic (‑346/+342) PP_5424 ← / ← PP_0050 hypothetical protein/hypothetical protein
RA 58,437 T→A 5.6% intergenic (‑348/+340) PP_5424 ← / ← PP_0050 hypothetical protein/hypothetical protein
RA 58,439 G→C 5.4% intergenic (‑350/+338) PP_5424 ← / ← PP_0050 hypothetical protein/hypothetical protein
RA 79,895 C→A 5.5% P217Q (CCG→CAG)  PP_0069 → rossmann fold nucleotide‑binding protein
RA 85,066 T→C 9.8% intergenic (+44/+86) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,074 A→G 9.8% intergenic (+52/+78) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,077 T→G 9.5% intergenic (+55/+75) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,078:1 +T 10.2% intergenic (+56/+74) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,081 T→G 11.8% intergenic (+59/+71) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,088 C→A 9.9% intergenic (+66/+64) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,091 Δ1 bp 10.0% intergenic (+69/+61) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,093 C→A 11.1% intergenic (+71/+59) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,096 C→T 10.5% intergenic (+74/+56) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 85,104 G→A 11.9% intergenic (+82/+48) aroE → / ← PP_0075 shikimate 5‑dehydrogenase/choline sulfate transporter
RA 86,240 G→T 5.2% L160M (CTG→ATG)  PP_0075 ← choline sulfate transporter
RA 86,245 A→C 5.2% M158R (ATG→AGG)  PP_0075 ← choline sulfate transporter
RA 92,184 G→T 7.8% L66M (CTG→ATG)  trpA ← tryptophan synthase subunit alpha
RA 92,186 T→C 7.9% Q65R (CAG→CGG) ‡ trpA ← tryptophan synthase subunit alpha
RA 92,187 G→A 8.0% Q65* (CAG→TAG) ‡ trpA ← tryptophan synthase subunit alpha
RA 92,189 A→C 8.1% I64S (ATC→AGC)  trpA ← tryptophan synthase subunit alpha
RA 92,443 G→A 6.4% S384L (TCG→TTG)  trpB ← tryptophan synthase subunit beta
RA 122,215 C→G 5.6% intergenic (+25/+36) katE → / ← PP_0116 hydroperoxidase/putative lipoprotein
RA 122,222 A→C 5.7% intergenic (+32/+29) katE → / ← PP_0116 hydroperoxidase/putative lipoprotein
RA 122,223 T→A 5.1% intergenic (+33/+28) katE → / ← PP_0116 hydroperoxidase/putative lipoprotein
RA 122,224 G→T 5.1% intergenic (+34/+27) katE → / ← PP_0116 hydroperoxidase/putative lipoprotein
RA 127,121 C→G 6.7% intergenic (‑31/+39) thrB ← / ← PP_0122 homoserine kinase/hypothetical protein
RA 127,122 C→G 7.6% intergenic (‑32/+38) thrB ← / ← PP_0122 homoserine kinase/hypothetical protein
RA 127,123 G→C 7.9% intergenic (‑33/+37) thrB ← / ← PP_0122 homoserine kinase/hypothetical protein
RA 133,296 C→G 5.8% P25R (CCG→CGG)  PP_0128 → hypothetical protein
RA 138,949 G→A 11.2% R519W (CGG→TGG)  kinB ← alginate biosynthesis sensor protein KinB
RA 138,950 T→G 11.4% R518S (AGA→AGC) ‡ kinB ← alginate biosynthesis sensor protein KinB
RA 138,951 C→A 10.9% R518I (AGA→ATA) ‡ kinB ← alginate biosynthesis sensor protein KinB
RA 138,952 T→C 11.2% R518G (AGA→GGA) ‡ kinB ← alginate biosynthesis sensor protein KinB
RA 158,997 G→T 6.1% Y464* (TAC→TAA)  PP_0149 ← hypothetical protein
RA 159,000 G→C 6.0% G463G (GGC→GGG) ‡ PP_0149 ← hypothetical protein
RA 159,001 C→G 6.0% G463A (GGC→GCC) ‡ PP_0149 ← hypothetical protein
RA 159,004 A→T 6.0% L462Q (CTG→CAG)  PP_0149 ← hypothetical protein
RA 159,007 C→G 6.1% R461P (CGC→CCC) ‡ PP_0149 ← hypothetical protein
RA 159,008 G→C 6.1% R461G (CGC→GGC) ‡ PP_0149 ← hypothetical protein
RA 159,011 A→C 6.0% L460V (TTA→GTA)  PP_0149 ← hypothetical protein
RA 186,766 T→C 6.2% T51A (ACC→GCC)  PP_0163 ← transcriptional regulator
RA 195,559 C→A 36.2% T355T (ACC→ACA)  PP_0168 → putative surface adhesion protein
RA 195,628 C→T 10.4% D378D (GAC→GAT)  PP_0168 → putative surface adhesion protein
RA 195,629 A→G 10.4% T379A (ACC→GCC)  PP_0168 → putative surface adhesion protein
RA 195,634 C→T 46.2% T380T (ACC→ACT)  PP_0168 → putative surface adhesion protein
RA 195,724 A→G 7.3% V410V (GTA→GTG)  PP_0168 → putative surface adhesion protein
RA 196,306 T→C 17.8% N604N (AAT→AAC)  PP_0168 → putative surface adhesion protein
RA 196,327 A→C 18.9% T611T (ACA→ACC)  PP_0168 → putative surface adhesion protein
RA 196,351 C→G 20.2% T619T (ACC→ACG)  PP_0168 → putative surface adhesion protein
RA 196,372 A→G 10.5% K626K (AAA→AAG)  PP_0168 → putative surface adhesion protein
RA 196,390 T→C 23.7% D632D (GAT→GAC)  PP_0168 → putative surface adhesion protein
RA 196,795 G→C 7.8% T767T (ACG→ACC)  PP_0168 → putative surface adhesion protein
RA 196,879 G→A 19.5% V795V (GTG→GTA)  PP_0168 → putative surface adhesion protein
RA 197,032 C→T 5.5% T846T (ACC→ACT)  PP_0168 → putative surface adhesion protein
RA 197,089 T→C 11.1% N865N (AAT→AAC)  PP_0168 → putative surface adhesion protein
RA 197,179 A→G 5.2% V895V (GTA→GTG)  PP_0168 → putative surface adhesion protein
RA 197,185 C→T 5.4% T897T (ACC→ACT)  PP_0168 → putative surface adhesion protein
RA 197,551 C→G 6.1% T1019T (ACC→ACG)  PP_0168 → putative surface adhesion protein
RA 197,572 G→A 13.5% K1026K (AAG→AAA)  PP_0168 → putative surface adhesion protein
RA 197,590 T→C 16.4% D1032D (GAT→GAC)  PP_0168 → putative surface adhesion protein
RA 197,632 T→C 10.7% T1046T (ACT→ACC)  PP_0168 → putative surface adhesion protein
RA 197,695 G→C 10.8% T1067T (ACG→ACC)  PP_0168 → putative surface adhesion protein
RA 201,385 T→C 6.6% N2297N (AAT→AAC)  PP_0168 → putative surface adhesion protein
RA 205,651 C→G 7.6% V3719V (GTC→GTG)  PP_0168 → putative surface adhesion protein
RA 205,663 C→T 8.0% G3723G (GGC→GGT)  PP_0168 → putative surface adhesion protein
RA 213,220 G→C 7.8% V6242V (GTG→GTC)  PP_0168 → putative surface adhesion protein
RA 220,562 C→G 6.7% intergenic (+19/‑109) PP_0168 → / → PP_5431 putative surface adhesion protein/hypothetical protein
RA 220,563 A→T 7.8% intergenic (+20/‑108) PP_0168 → / → PP_5431 putative surface adhesion protein/hypothetical protein
RA 233,832 A→T 13.9% intergenic (+20/+43) PP_0180 → / ← PP_0181 cytochrome c family protein/hypothetical protein
RA 233,833 C→G 13.1% intergenic (+21/+42) PP_0180 → / ← PP_0181 cytochrome c family protein/hypothetical protein
RA 233,834 A→T 13.1% intergenic (+22/+41) PP_0180 → / ← PP_0181 cytochrome c family protein/hypothetical protein
RA 239,052 C→T 5.5% P45S (CCA→TCA) ‡ hemD → uroporphyrinogen‑III synthase
RA 239,053 C→T 5.7% P45L (CCA→CTA) ‡ hemD → uroporphyrinogen‑III synthase
RA 239,060 G→A 5.2% R47R (CGG→CGA)  hemD → uroporphyrinogen‑III synthase
RA 239,062 T→A 5.3% L48Q (CTG→CAG)  hemD → uroporphyrinogen‑III synthase
RA 239,064 T→C 5.2% S49P (TCG→CCG)  hemD → uroporphyrinogen‑III synthase
RA 262,940 G→C 6.9% intergenic (+175/‑310) PP_0211 → / → gabD‑I hypothetical protein/succinate‑semialdehyde dehydrogenase
RA 262,942 A→C 6.8% intergenic (+177/‑308) PP_0211 → / → gabD‑I hypothetical protein/succinate‑semialdehyde dehydrogenase
RA 262,944 C→G 6.6% intergenic (+179/‑306) PP_0211 → / → gabD‑I hypothetical protein/succinate‑semialdehyde dehydrogenase
RA 262,946 G→T 6.8% intergenic (+181/‑304) PP_0211 → / → gabD‑I hypothetical protein/succinate‑semialdehyde dehydrogenase
RA 262,948 G→C 7.8% intergenic (+183/‑302) PP_0211 → / → gabD‑I hypothetical protein/succinate‑semialdehyde dehydrogenase
RA 268,744 T→A 7.6% intergenic (‑75/+25) PP_0216 ← / ← desA sensory box/GGDEF family protein/delta‑9 fatty acid desaturase
RA 268,746 G→C 7.1% intergenic (‑77/+23) PP_0216 ← / ← desA sensory box/GGDEF family protein/delta‑9 fatty acid desaturase
RA 271,316 A→G 5.5% H406R (CAC→CGC)  PP_0218 → sensory box protein
RA 278,742:1 +A 100% intergenic (‑237/+77) PP_0224 ← / ← sctC DszC family monooxygenase/sulfur compound ABC transporter ATP‑binding protein
RA 284,586 T→A 17.7% intergenic (+33/+30) betT‑II → / ← atsK choline/carnitine/betaine transporter/alpha‑ketoglutarate‑dependent sulfonate dioxygenase
RA 284,587 T→A 17.7% intergenic (+34/+29) betT‑II → / ← atsK choline/carnitine/betaine transporter/alpha‑ketoglutarate‑dependent sulfonate dioxygenase
RA 288,015 G→C 5.1% Y31* (TAC→TAG) ‡ tauA ← taurine ABC transporter substrate‑binding protein
RA 288,016 T→C 5.2% Y31C (TAC→TGC) ‡ tauA ← taurine ABC transporter substrate‑binding protein
RA 307,865:1 +C 100% intergenic (+880/‑989) hslO → / → PP_0254 molecular chaperone HslO/hypothetical protein
RA 308,738 C→T 7.1% intergenic (+1753/‑116) hslO → / → PP_0254 molecular chaperone HslO/hypothetical protein
RA 308,739 A→G 6.8% intergenic (+1754/‑115) hslO → / → PP_0254 molecular chaperone HslO/hypothetical protein
RA 313,965 C→G 7.4% V192V (GTG→GTC) ‡ yrfG ← purine nucleotidase
RA 313,966 A→T 6.6% V192E (GTG→GAG) ‡ yrfG ← purine nucleotidase
RA 313,967 C→G 7.2% V192L (GTG→CTG) ‡ yrfG ← purine nucleotidase
RA 317,012 C→T 6.4% A307T (GCA→ACA)  dctD‑I ← C4‑dicarboxylate transport transcriptional regulator
RA 322,133 G→A 14.6% intergenic (+420/+38) aguA → / ← PP_0267 agmatine deiminase/ferric siderophore receptor
RA 322,140 T→C 10.7% intergenic (+427/+31) aguA → / ← PP_0267 agmatine deiminase/ferric siderophore receptor
RA 326,065 C→A 8.3% *556Y (TAG→TAT)  PP_0269 ← glutamate synthase large subunit
RA 326,068 T→G 7.4% A555A (GCA→GCC)  PP_0269 ← glutamate synthase large subunit
RA 328,510 A→G 6.6% L247P (CTG→CCG)  PP_0270 ← sensor histidine kinase
RA 335,433 C→T 13.1% intergenic (‑38/+166) PP_0277 ← / ← PP_5437 hypothetical protein/hypothetical protein
RA 335,434 A→T 12.8% intergenic (‑39/+165) PP_0277 ← / ← PP_5437 hypothetical protein/hypothetical protein
RA 335,435 A→G 12.8% intergenic (‑40/+164) PP_0277 ← / ← PP_5437 hypothetical protein/hypothetical protein
RA 336,124:1 +T 100% coding (209/237 nt) PP_0278 → hypothetical protein
RA 337,809 A→G 16.7% intergenic (‑59/+70) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,816:1 +A 15.0% intergenic (‑66/+63) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,819 A→C 15.0% intergenic (‑69/+60) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,822 C→G 14.3% intergenic (‑72/+57) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,825 G→T 13.3% intergenic (‑75/+54) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,827 Δ1 bp 12.8% intergenic (‑77/+52) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 337,836 C→T 13.6% intergenic (‑86/+43) PP_0279 ← / ← PP_0280 hypothetical protein/amino acid ABC transporter permease
RA 344,032 A→G 7.2% intergenic (+121/+68) PP_5440 → / ← PP_t72 hypothetical protein/tRNA‑Phe
RA 344,041 Δ1 bp 6.8% intergenic (+130/+59) PP_5440 → / ← PP_t72 hypothetical protein/tRNA‑Phe
RA 344,045:1 +T 6.7% intergenic (+134/+55) PP_5440 → / ← PP_t72 hypothetical protein/tRNA‑Phe
RA 346,118 G→A 6.2% N576N (AAC→AAT) ‡ PP_0287 ← hypothetical protein
RA 346,119 T→A 6.1% N576I (AAC→ATC) ‡ PP_0287 ← hypothetical protein
RA 346,120 T→C 6.2% N576D (AAC→GAC) ‡ PP_0287 ← hypothetical protein
RA 353,067 A→G 100% intergenic (+34/+84) hisF → / ← cbcV imidazole glycerol phosphate synthase subunit HisF/choline/betaine/carnitine ABC transporter ATP binding protein
RA 373,407 C→G 5.0% L217V (CTG→GTG)  dgcB → dimethylglycine dehydrogenase subunit
RA 384,498 G→A 5.4% A326T (GCA→ACA)  PP_0320 → methyl‑accepting chemotaxis transducer
RA 387,791 T→G 7.0% S311A (TCC→GCC) ‡ glyA‑I → serine hydroxymethyltransferase
RA 387,792 C→T 6.9% S311F (TCC→TTC) ‡ glyA‑I → serine hydroxymethyltransferase
RA 387,798 G→C 7.1% G313A (GGC→GCC)  glyA‑I → serine hydroxymethyltransferase
RA 387,804 A→G 7.1% D315G (GAC→GGC) ‡ glyA‑I → serine hydroxymethyltransferase
RA 387,805 C→A 7.8% D315E (GAC→GAA) ‡ glyA‑I → serine hydroxymethyltransferase
RA 421,154 Δ1 bp 5.3% intergenic (+11/+7) PP_0347 → / ← PP_0348 hypothetical protein/hypothetical protein
RA 421,161 T→A 5.6% *929C (TGA→TGT)  PP_0348 ← hypothetical protein
RA 421,165 T→C 5.5% H928R (CAC→CGC)  PP_0348 ← hypothetical protein
RA 421,167:1 +A 5.7% coding (2781/2787 nt) PP_0348 ← hypothetical protein
RA 431,343 A→G 5.1% I324T (ATC→ACC)  PP_0354 ← CBS domain‑containing protein
RA 431,362 C→T 5.9% V318I (GTT→ATT)  PP_0354 ← CBS domain‑containing protein
RA 432,993 A→T 9.2% intergenic (+18/+29) PP_0355 → / ← glcB two‑component system response regulator/malate synthase G
RA 432,994 A→T 9.2% intergenic (+19/+28) PP_0355 → / ← glcB two‑component system response regulator/malate synthase G
RA 432,995 A→T 9.2% intergenic (+20/+27) PP_0355 → / ← glcB two‑component system response regulator/malate synthase G
RA 436,580 G→C 5.4% H236Q (CAC→CAG)  PP_0358 ← membrane protein
RA 461,030 C→G 5.1% V479L (GTG→CTG)  pqqF ← coenzyme PQQ synthesis protein F
RA 471,066 T→C 10.2% intergenic (‑110/+18) PP_0386 ← / ← rpoD sensory box protein/RNA polymerase sigma 70 factor
RA 471,067 G→A 9.9% intergenic (‑111/+17) PP_0386 ← / ← rpoD sensory box protein/RNA polymerase sigma 70 factor
RA 474,163 G→C 5.7% A274A (GCC→GCG)  dnaG ← DNA primase
RA 483,095 C→T 6.6% Q448Q (CAG→CAA)  yeaG ← protein kinase
RA 487,825 G→C 5.6% R159R (CGC→CGG)  pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 487,829 A→G 5.4% L158P (CTG→CCG)  pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 487,831 G→C 5.3% G157G (GGC→GGG) ‡ pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 487,833 C→T 5.6% G157S (GGC→AGC) ‡ pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 487,837 G→C 5.4% T155T (ACC→ACG)  pdxA ← 4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA 499,203 A→G 100% intergenic (+47/‑249) uhpA → / → PP_0411 two‑component system response regulator UhpA/polyamine ABC transporter ATP‑binding protein
RA 503,831 A→T 6.8% intergenic (+34/‑117) PP_0414 → / → rpe polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA 503,832 A→T 6.8% intergenic (+35/‑116) PP_0414 → / → rpe polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA 503,837:1 +C 5.6% intergenic (+40/‑111) PP_0414 → / → rpe polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA 532,676 G→T 7.0% intergenic (+19/‑60) PP_t03 → / → tufA tRNA‑Thr/elongation factor Tu‑A
RA 532,677 A→T 7.2% intergenic (+20/‑59) PP_t03 → / → tufA tRNA‑Thr/elongation factor Tu‑A
RA 532,678 A→T 7.6% intergenic (+21/‑58) PP_t03 → / → tufA tRNA‑Thr/elongation factor Tu‑A
RA 532,679 A→C 7.6% intergenic (+22/‑57) PP_t03 → / → tufA tRNA‑Thr/elongation factor Tu‑A
RA 539,941 T→G 6.9% R773R (CGT→CGG)  rpoB → DNA‑directed RNA polymerase subunit beta
RA 539,942 C→A 6.7% P774T (CCG→ACG)  rpoB → DNA‑directed RNA polymerase subunit beta
RA 541,437 A→G 6.9% Q1272R (CAG→CGG)  rpoB → DNA‑directed RNA polymerase subunit beta
RA 541,440 C→T 6.4% P1273L (CCG→CTG)  rpoB → DNA‑directed RNA polymerase subunit beta
RA 550,549 C→G 7.2% intergenic (+30/‑112) tufB → / → rpsJ elongation factor Tu‑B/30S ribosomal protein S10
RA 557,332 Δ1 bp 7.4% intergenic (+75/‑134) rpsN → / → rpsH 30S ribosomal protein S14/30S ribosomal protein S8
RA 557,336:1 +A 7.7% intergenic (+79/‑130) rpsN → / → rpsH 30S ribosomal protein S14/30S ribosomal protein S8
RA 564,377:1 +A 5.5% intergenic (+29/‑144) rplQ → / → katA 50S ribosomal protein L17/catalase
RA 564,382 Δ1 bp 5.3% intergenic (+34/‑139) rplQ → / → katA 50S ribosomal protein L17/catalase
RA 591,079 G→A 8.3% R109H (CGC→CAC)  PP_0501 → NAD‑dependent epimerase/dehydratase family protein
RA 591,082 T→C 8.4% V110A (GTG→GCG)  PP_0501 → NAD‑dependent epimerase/dehydratase family protein
RA 604,470 C→G 5.4% P101R (CCA→CGA)  nusB → transcription antitermination protein
RA 616,452 G→T 8.1% noncoding (70/142 nt) PP_mr11 ← FMN regulatory region
RA 625,062 C→T 6.9% intergenic (‑156/+27) PP_0537 ← / ← ppa transcriptional regulator/inorganic pyrophosphatase
RA 625,063 A→T 6.7% intergenic (‑157/+26) PP_0537 ← / ← ppa transcriptional regulator/inorganic pyrophosphatase
RA 625,064 A→T 6.8% intergenic (‑158/+25) PP_0537 ← / ← ppa transcriptional regulator/inorganic pyrophosphatase
RA 625,065 A→G 6.8% intergenic (‑159/+24) PP_0537 ← / ← ppa transcriptional regulator/inorganic pyrophosphatase
RA 628,160 A→T 5.9% I212N (ATT→AAT)  eutC ← ethanolamine ammonia‑lyase subunit beta
RA 635,840 G→T 7.3% E22* (GAA→TAA) ‡ mpl → UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA 635,841 A→T 6.4% E22V (GAA→GTA) ‡ mpl → UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA 644,546 C→G 11.1% E157D (GAG→GAC)  acoA ← acetoin:2,6‑dichlorophenolindophenol oxidoreductase subunit alpha
RA 648,287 A→C 11.5% intergenic (+56/+35) acoR → / ← accC acetoin catabolism regulatory protein/acetyl‑CoA carboxylase biotin carboxylase subunit
RA 650,231 C→T 5.5% intergenic (‑75/+25) accB ← / ← aroQ‑I acetyl‑CoA carboxylase biotin carboxyl carrier subunit/type II 3‑dehydroquinate dehydratase
RA 655,060 G→A 6.1% A428V (GCC→GTC)  PP_0563 ← two‑component system response regulator
RA 655,067 T→C 6.0% T426A (ACC→GCC)  PP_0563 ← two‑component system response regulator
RA 668,263 G→T 10.2% F87L (TTC→TTA) ‡ PP_0571 ← membrane protein
RA 668,264 A→C 11.3% F87C (TTC→TGC) ‡ PP_0571 ← membrane protein
RA 679,882 G→T 5.6% G257C (GGT→TGT)  PP_0582 → thiolase family protein
RA 679,889 C→A 5.4% S259Y (TCC→TAC)  PP_0582 → thiolase family protein
RA 697,203 T→C 7.8% intergenic (+130/‑621) mmsA‑I → / → PP_16SD methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA 697,214 T→C 7.7% intergenic (+141/‑610) mmsA‑I → / → PP_16SD methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA 697,225 C→G 9.6% intergenic (+152/‑599) mmsA‑I → / → PP_16SD methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA 697,228 C→G 9.0% intergenic (+155/‑596) mmsA‑I → / → PP_16SD methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA 697,481 G→A 7.4% intergenic (+408/‑343) mmsA‑I → / → PP_16SD methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA 699,722 A→G 38.3% intergenic (+115/‑129) PP_t06 → / → PP_23SD tRNA‑Ala/23S ribosomal RNA
RA 707,055 C→T 8.4% intergenic (+231/+15) PP_0599 → / ← rpsT paraquat‑inducible protein B/30S ribosomal protein S20
RA 715,009:1 +T 6.8% intergenic (+75/+2) ispH → / ← PP_0607 4‑hydroxy‑3‑methylbut‑2‑enyl diphosphate reductase/type IV pili biogenesis protein FimT
RA 715,016 Δ1 bp 6.7% coding (478/483 nt) PP_0607 ← type IV pili biogenesis protein FimT
RA 733,645 A→T 10.8% intergenic (+19/‑28) PP_t09 → / → PP_t10 tRNA‑Lys/tRNA‑Pro
RA 733,646 A→T 10.9% intergenic (+20/‑27) PP_t09 → / → PP_t10 tRNA‑Lys/tRNA‑Pro
RA 733,647 A→T 10.5% intergenic (+21/‑26) PP_t09 → / → PP_t10 tRNA‑Lys/tRNA‑Pro
RA 743,266 G→A 33.3% R456Q (CGG→CAG)  PP_0635 → group II intron‑encoding maturase
RA 743,269 T→C 33.2% L457P (CTC→CCC)  PP_0635 → group II intron‑encoding maturase
RA 743,272 G→A 30.8% G458E (GGG→GAG)  PP_0635 → group II intron‑encoding maturase
RA 743,275 T→C 30.8% L459P (CTG→CCG)  PP_0635 → group II intron‑encoding maturase
RA 743,439 T→G 5.3% intergenic (+118/+156) PP_0635 → / ← PP_0636 group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA 743,440 T→A 5.3% intergenic (+119/+155) PP_0635 → / ← PP_0636 group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA 743,441 C→A 5.5% intergenic (+120/+154) PP_0635 → / ← PP_0636 group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA 772,178 T→C 10.8% intergenic (+39/‑160) PP_0663 → / → PP_0664 AsnC family transcriptional regulator/homoserine dehydrogenase
RA 772,179 T→G 11.8% intergenic (+40/‑159) PP_0663 → / → PP_0664 AsnC family transcriptional regulator/homoserine dehydrogenase
RA 772,182 C→A 11.6% intergenic (+43/‑156) PP_0663 → / → PP_0664 AsnC family transcriptional regulator/homoserine dehydrogenase
RA 772,183 G→A 11.6% intergenic (+44/‑155) PP_0663 → / → PP_0664 AsnC family transcriptional regulator/homoserine dehydrogenase
RA 780,556 A→C 5.2% intergenic (‑86/+36) PP_0670 ← / ← glyA‑II bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA 780,558 T→A 5.5% intergenic (‑88/+34) PP_0670 ← / ← glyA‑II bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA 780,560 G→T 7.8% intergenic (‑90/+32) PP_0670 ← / ← glyA‑II bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA 797,982 T→G 10.3% intergenic (+40/‑46) PP_0683 → / → fklB‑I hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA 797,983 T→A 10.4% intergenic (+41/‑45) PP_0683 → / → fklB‑I hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA 797,986 T→A 10.4% intergenic (+44/‑42) PP_0683 → / → fklB‑I hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA 797,987 C→A 10.7% intergenic (+45/‑41) PP_0683 → / → fklB‑I hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA 798,662 C→A 7.3% intergenic (+17/+10) fklB‑I → / ← PP_0685 FKBP‑type peptidyl‑prolyl cis‑trans isomerase/hypothetical protein
RA 801,355 A→G 5.2% intergenic (+28/‑161) rpmA → / → obg 50S ribosomal protein L27/GTPase Obg
RA 801,356 T→C 5.2% intergenic (+29/‑160) rpmA → / → obg 50S ribosomal protein L27/GTPase Obg
RA 801,357 G→A 5.3% intergenic (+30/‑159) rpmA → / → obg 50S ribosomal protein L27/GTPase Obg
RA 801,358 C→T 5.4% intergenic (+31/‑158) rpmA → / → obg 50S ribosomal protein L27/GTPase Obg
RA 802,770 T→C 7.9% intergenic (+28/‑58) obg → / → proB GTPase Obg/glutamate 5‑kinase
RA 802,771 C→A 8.0% intergenic (+29/‑57) obg → / → proB GTPase Obg/glutamate 5‑kinase
RA 802,772 T→G 8.0% intergenic (+30/‑56) obg → / → proB GTPase Obg/glutamate 5‑kinase
RA 802,773 G→A 7.9% intergenic (+31/‑55) obg → / → proB GTPase Obg/glutamate 5‑kinase
RA 809,094 A→C 5.4% R88R (CGT→CGG)  PP_0695 ← hypothetical protein
RA 812,048 T→C 6.2% Q68Q (CAA→CAG)  PP_0698 ← LysR family transcriptional regulator
RA 863,898 T→A 8.5% intergenic (+15/+21) hemH → / ← uraA ferrochelatase/uracil permease
RA 863,899 T→A 8.5% intergenic (+16/+20) hemH → / ← uraA ferrochelatase/uracil permease
RA 863,900 T→A 8.5% intergenic (+17/+19) hemH → / ← uraA ferrochelatase/uracil permease
RA 866,724 C→T 6.6% A59A (GCC→GCT)  PP_0748 → hypothetical protein
RA 866,725 G→A 6.6% D60N (GAC→AAC) ‡ PP_0748 → hypothetical protein
RA 866,726 A→T 6.6% D60V (GAC→GTC) ‡ PP_0748 → hypothetical protein
RA 866,732 C→T 6.4% A62V (GCT→GTT)  PP_0748 → hypothetical protein
RA 866,734 G→T 6.2% E63* (GAA→TAA) ‡ PP_0748 → hypothetical protein
RA 866,735 A→C 5.8% E63A (GAA→GCA) ‡ PP_0748 → hypothetical protein
RA 866,737 A→G 6.0% T64A (ACC→GCC)  PP_0748 → hypothetical protein
RA 866,743 A→T 6.7% I66L (ATA→TTA) ‡ PP_0748 → hypothetical protein
RA 866,744 T→C 6.4% I66T (ATA→ACA) ‡ PP_0748 → hypothetical protein
RA 866,745 A→G 6.3% I66M (ATA→ATG) ‡ PP_0748 → hypothetical protein
RA 873,425 T→C 8.2% L20P (CTT→CCT)  PP_5457 → hypothetical protein
RA 874,538 C→T 9.7% V39V (GTC→GTT)  PP_0759 → hypothetical protein
RA 874,539 G→C 9.9% E40Q (GAA→CAA) ‡ PP_0759 → hypothetical protein
RA 874,540 A→G 9.7% E40G (GAA→GGA) ‡ PP_0759 → hypothetical protein
RA 875,283 A→C 6.9% intergenic (+22/+24) PP_0759 → / ← PP_0760 hypothetical protein/membrane protein
RA 875,284 T→A 6.5% intergenic (+23/+23) PP_0759 → / ← PP_0760 hypothetical protein/membrane protein
RA 875,285 G→T 6.8% intergenic (+24/+22) PP_0759 → / ← PP_0760 hypothetical protein/membrane protein
RA 875,954 A→G 9.7% intergenic (‑63/+24) PP_0760 ← / ← PP_mr65 membrane protein/YybP‑YkoY
RA 875,956 G→C 9.8% intergenic (‑65/+22) PP_0760 ← / ← PP_mr65 membrane protein/YybP‑YkoY
RA 875,960 G→A 9.8% intergenic (‑69/+18) PP_0760 ← / ← PP_mr65 membrane protein/YybP‑YkoY
RA 889,441 A→C 10.0% intergenic (+178/‑16) PP_0769 → / → PP_0770 sensor histidine kinase/PemI‑like protein
RA 889,444 T→A 9.8% intergenic (+181/‑13) PP_0769 → / → PP_0770 sensor histidine kinase/PemI‑like protein
RA 889,445 T→A 9.8% intergenic (+182/‑12) PP_0769 → / → PP_0770 sensor histidine kinase/PemI‑like protein
RA 889,448 G→T 9.8% intergenic (+185/‑9) PP_0769 → / → PP_0770 sensor histidine kinase/PemI‑like protein
RA 900,289 T→A 6.1% L133L (CTT→CTA)  PP_0784 → hypothetical protein
RA 914,624 Δ1 bp 7.0% coding (1335/1743 nt) fruA → PTS fructose transporter subunit IIBC
RA 925,901 C→T 7.1% W242* (TGG→TAG) ‡ PP_0805 ← outer membrane efflux protein
RA 925,902 A→G 7.1% W242R (TGG→CGG) ‡ PP_0805 ← outer membrane efflux protein
RA 927,770 A→C 5.1% L5951R (CTG→CGG) ‡ PP_0806 ← surface adhesion protein
RA 927,771 G→T 5.3% L5951M (CTG→ATG) ‡ PP_0806 ← surface adhesion protein
RA 932,428 A→G 5.7% G4398G (GGT→GGC)  PP_0806 ← surface adhesion protein
RA 932,432 T→C 6.2% D4397G (GAC→GGC)  PP_0806 ← surface adhesion protein
RA 932,435 G→A 6.4% A4396V (GCC→GTC)  PP_0806 ← surface adhesion protein
RA 932,439 C→T 6.5% A4395T (GCC→ACC)  PP_0806 ← surface adhesion protein
RA 932,444 G→T 5.5% T4393K (ACA→AAA)  PP_0806 ← surface adhesion protein
RA 941,990 G→A 5.2% P1211L (CCC→CTC)  PP_0806 ← surface adhesion protein
RA 943,611 C→G 5.1% G671R (GGG→CGG)  PP_0806 ← surface adhesion protein
RA 955,149 A→G 20.6% intergenic (+103/‑210) cyoE → / → alaC protoheme IX farnesyltransferase/aminotransferase
RA 955,151 G→A 20.6% intergenic (+105/‑208) cyoE → / → alaC protoheme IX farnesyltransferase/aminotransferase
RA 955,152 T→A 20.6% intergenic (+106/‑207) cyoE → / → alaC protoheme IX farnesyltransferase/aminotransferase
RA 955,153 T→C 20.6% intergenic (+107/‑206) cyoE → / → alaC protoheme IX farnesyltransferase/aminotransferase
RA 955,155 C→T 23.3% intergenic (+109/‑204) cyoE → / → alaC protoheme IX farnesyltransferase/aminotransferase
RA 961,720 A→T 5.8% L232Q (CTG→CAG)  selD ← selenide, water dikinase
RA 971,677 C→T 7.1% intergenic (+32/‑32) yajC → / → secD protein translocase subunit YajC/protein translocase subunit SecD
RA 971,678 A→T 6.8% intergenic (+33/‑31) yajC → / → secD protein translocase subunit YajC/protein translocase subunit SecD
RA 971,679 A→G 6.8% intergenic (+34/‑30) yajC → / → secD protein translocase subunit YajC/protein translocase subunit SecD
RA 983,581 T→A 7.9% intergenic (+39/‑50) iscX → / → ndk cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA 983,584 A→T 8.0% intergenic (+42/‑47) iscX → / → ndk cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA 983,587 T→A 8.2% intergenic (+45/‑44) iscX → / → ndk cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA 1,013,228 A→T 22.2% intergenic (+56/+75) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,234 C→A 19.4% intergenic (+62/+69) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,235 A→T 18.4% intergenic (+63/+68) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,241 G→C 18.5% intergenic (+69/+62) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,242 G→C 18.8% intergenic (+70/+61) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,248 A→T 21.9% intergenic (+76/+55) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,249 T→G 25.0% intergenic (+77/+54) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,255 A→T 23.5% intergenic (+83/+48) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,286 C→T 9.5% intergenic (+114/+17) prfC → / ← potF‑I peptide chain release factor 3/putrescine‑binding protein
RA 1,013,757 T→A 5.9% Y209F (TAC→TTC)  potF‑I ← putrescine‑binding protein
RA 1,013,761 G→T 5.4% P208T (CCT→ACT)  potF‑I ← putrescine‑binding protein
RA 1,013,762 C→G 6.0% R207R (CGG→CGC)  potF‑I ← putrescine‑binding protein
RA 1,013,765 C→G 6.0% V206V (GTG→GTC) ‡ potF‑I ← putrescine‑binding protein
RA 1,013,766 A→C 6.0% V206G (GTG→GGG) ‡ potF‑I ← putrescine‑binding protein
RA 1,017,834 C→T 8.3% G10S (GGT→AGT)  PP_5461 ← hypothetical protein
RA 1,017,836 A→T 8.3% L9* (TTA→TAA) ‡ PP_5461 ← hypothetical protein
RA 1,017,837 A→T 8.3% L9I (TTA→ATA) ‡ PP_5461 ← hypothetical protein
RA 1,017,839 A→G 8.3% L8P (CTT→CCT)  PP_5461 ← hypothetical protein
RA 1,034,960 T→C 5.3% L333L (TTG→CTG)  PP_0892 → phospholipase family protein
RA 1,034,963 A→T 5.3% T334S (ACA→TCA)  PP_0892 → phospholipase family protein
RA 1,034,966 G→A 5.5% A335T (GCG→ACG)  PP_0892 → phospholipase family protein
RA 1,041,198 G→T 5.4% A46D (GCT→GAT)  PP_0900 ← PAP2 family protein
RA 1,046,227 C→G 7.2% M717I (ATG→ATC)  PP_0906 ← RND family multidrug transporter
RA 1,046,230 C→G 7.6% S716S (TCG→TCC)  PP_0906 ← RND family multidrug transporter
RA 1,047,736 G→A 6.0% S214S (TCC→TCT)  PP_0906 ← RND family multidrug transporter
RA 1,054,462 A→C 8.8% M1G (GTG→GGG) †‡ PP_0912 ← hypothetical protein
RA 1,054,463 C→T 8.8% M1M (GTG→ATG) †‡ PP_0912 ← hypothetical protein
RA 1,054,464 A→T 8.8% intergenic (‑1/+36) PP_0912 ← / ← PP_0913 hypothetical protein/hypothetical protein
RA 1,054,465 A→G 8.9% intergenic (‑2/+35) PP_0912 ← / ← PP_0913 hypothetical protein/hypothetical protein
RA 1,054,466 G→T 9.7% intergenic (‑3/+34) PP_0912 ← / ← PP_0913 hypothetical protein/hypothetical protein
RA 1,060,961 A→G 6.4% E56G (GAG→GGG)  PP_0918 → 3‑beta hydroxysteroid dehydrogenase/isomerase family protein
RA 1,066,335 T→C 7.2% S89G (AGC→GGC)  PP_0924 ← hypothetical protein
RA 1,066,338 T→C 7.2% S88G (AGC→GGC)  PP_0924 ← hypothetical protein
RA 1,066,339 G→A 7.3% A87A (GCC→GCT)  PP_0924 ← hypothetical protein
RA 1,066,342 G→A 7.2% A86A (GCC→GCT)  PP_0924 ← hypothetical protein
RA 1,069,781 A→G 7.0% S315G (AGC→GGC)  aroP‑I → aromatic amino acid transport protein
RA 1,070,246:1 +GA 100% intergenic (+46/+96) aroP‑I → / ← PP_0928 aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA 1,070,260 G→C 61.6% intergenic (+60/+82) aroP‑I → / ← PP_0928 aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA 1,070,263 G→C 55.2% intergenic (+63/+79) aroP‑I → / ← PP_0928 aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA 1,075,486 C→G 6.6% I68M (ATC→ATG)  mreB → cell wall structural actin‑like protein MreB
RA 1,075,487 C→G 6.6% R69G (CGT→GGT)  mreB → cell wall structural actin‑like protein MreB
RA 1,075,492 C→G 6.4% T70T (ACC→ACG)  mreB → cell wall structural actin‑like protein MreB
RA 1,075,493 C→G 6.3% H71D (CAT→GAT)  mreB → cell wall structural actin‑like protein MreB
RA 1,088,661 T→G 6.2% intergenic (+157/‑97) pmbA → / → PP_0943 regulatory protease/hypothetical protein
RA 1,088,662 C→A 6.3% intergenic (+158/‑96) pmbA → / → PP_0943 regulatory protease/hypothetical protein
RA 1,093,922 A→T 5.8% L82Q (CTG→CAG)  ptsN ← phosphotransferase system subunit IIA
RA 1,094,117 Δ1 bp 6.5% coding (50/465 nt) ptsN ← phosphotransferase system subunit IIA
RA 1,094,123 A→C 7.7% V15G (GTG→GGG)  ptsN ← phosphotransferase system subunit IIA
RA 1,094,125 G→T 7.3% L14L (CTC→CTA) ‡ ptsN ← phosphotransferase system subunit IIA
RA 1,094,126 A→C 6.5% L14R (CTC→CGC) ‡ ptsN ← phosphotransferase system subunit IIA
RA 1,094,128 G→T 6.7% S13S (TCC→TCA)  ptsN ← phosphotransferase system subunit IIA
RA 1,094,133:1 +T 6.3% coding (34/465 nt) ptsN ← phosphotransferase system subunit IIA
RA 1,105,119 C→T 6.6% A174V (GCC→GTC) ‡ hisG → ATP phosphoribosyltransferase
RA 1,105,120 C→G 6.1% A174A (GCC→GCG) ‡ hisG → ATP phosphoribosyltransferase
RA 1,105,121 A→G 6.6% T175A (ACG→GCG)  hisG → ATP phosphoribosyltransferase
RA 1,115,625 A→T 6.7% L736* (TTG→TAG) ‡ valS ← valine‑‑tRNA ligase
RA 1,115,626 A→T 6.6% L736M (TTG→ATG) ‡ valS ← valine‑‑tRNA ligase
RA 1,120,469 T→A 6.4% intergenic (‑211/‑91) pepA ← / → PP_0982 cytosol aminopeptidase/YjgP/YjgQ family permease
RA 1,120,470 T→A 6.4% intergenic (‑212/‑90) pepA ← / → PP_0982 cytosol aminopeptidase/YjgP/YjgQ family permease
RA 1,120,471 T→A 6.4% intergenic (‑213/‑89) pepA ← / → PP_0982 cytosol aminopeptidase/YjgP/YjgQ family permease
RA 1,126,645:1 +C 100% intergenic (‑99/+50) tdcG‑II ← / ← gcvP‑I L‑serine dehydratase/glycine dehydrogenase
RA 1,145,433 C→T 12.5% intergenic (‑100/+41) hemO ← / ← PP_1006 heme oxygenase/heme receptor
RA 1,145,440 G→A 10.6% intergenic (‑107/+34) hemO ← / ← PP_1006 heme oxygenase/heme receptor
RA 1,145,441 T→C 10.6% intergenic (‑108/+33) hemO ← / ← PP_1006 heme oxygenase/heme receptor
RA 1,145,448 A→G 10.0% intergenic (‑115/+26) hemO ← / ← PP_1006 heme oxygenase/heme receptor
RA 1,184,585 G→C 40.5% intergenic (‑201/‑211) mltF ← / → purL membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA 1,184,588 G→C 44.0% intergenic (‑204/‑208) mltF ← / → purL membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA 1,184,605 C→T 17.9% intergenic (‑221/‑191) mltF ← / → purL membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA 1,184,612 A→T 11.1% intergenic (‑228/‑184) mltF ← / → purL membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA 1,189,035 A→G 8.8% intergenic (+25/+17) PP_1038 → / ← tatC‑I hypothetical protein/Sec‑independent protein translocase protein
RA 1,189,036 C→T 8.4% intergenic (+26/+16) PP_1038 → / ← tatC‑I hypothetical protein/Sec‑independent protein translocase protein
RA 1,189,494 T→G 6.7% E107A (GAA→GCA) ‡ tatC‑I ← Sec‑independent protein translocase protein
RA 1,189,495 C→A 5.8% E107* (GAA→TAA) ‡ tatC‑I ← Sec‑independent protein translocase protein
RA 1,201,597 A→T 6.0% P135P (CCA→CCT) 
M1M (ATG→TTG) †
xcpV →
xcpW →
type II secretion pathway protein XcpV
type II secretion pathway protein XcpW
RA 1,202,857 G→T 6.2% R229L (CGG→CTG)  xcpY → type II secretion pathway protein XcpY
RA 1,210,827 T→A 17.6% intergenic (+17/+20) ytnA → / ← PP_1060 amino acid permease YtnA/glutamate synthase large subunit
RA 1,210,828 T→A 12.1% intergenic (+18/+19) ytnA → / ← PP_1060 amino acid permease YtnA/glutamate synthase large subunit
RA 1,210,829 T→A 12.1% intergenic (+19/+18) ytnA → / ← PP_1060 amino acid permease YtnA/glutamate synthase large subunit
RA 1,212,380 T→A 7.5% E29D (GAA→GAT)  PP_1060 ← glutamate synthase large subunit
RA 1,212,520 C→T 100% intergenic (‑54/+134) PP_1060 ← / ← PP_1061 glutamate synthase large subunit/ATP‑dependent DNA helicase
RA 1,215,084 G→T 7.2% Y625* (TAC→TAA) ‡ PP_1061 ← ATP‑dependent DNA helicase
RA 1,215,086 A→G 7.0% Y625H (TAC→CAC) ‡ PP_1061 ← ATP‑dependent DNA helicase
RA 1,215,087 G→C 9.1% D624E (GAC→GAG)  PP_1061 ← ATP‑dependent DNA helicase
RA 1,215,092 G→C 8.3% L623V (CTC→GTC)  PP_1061 ← ATP‑dependent DNA helicase
RA 1,215,093 C→T 7.2% L622L (TTG→TTA) ‡ PP_1061 ← ATP‑dependent DNA helicase
RA 1,215,095 A→C 7.2% L622V (TTG→GTG) ‡ PP_1061 ← ATP‑dependent DNA helicase
RA 1,224,630 C→T 7.9% W16* (TGG→TGA) ‡ gltK ← glutamate/aspartate ABC transporter permease
RA 1,224,631 C→G 7.9% W16S (TGG→TCG) ‡ gltK ← glutamate/aspartate ABC transporter permease
RA 1,224,632 A→G 7.3% W16R (TGG→CGG) ‡ gltK ← glutamate/aspartate ABC transporter permease
RA 1,226,127 C→A 5.1% G122C (GGC→TGC)  gltI ← glutamate/aspartate ABC transporter substrate‑binding protein
RA 1,226,707 T→A 10.7% intergenic (‑217/‑114) gltI ← / → PP_1072 glutamate/aspartate ABC transporter substrate‑binding protein/leucine‑rich repeat‑containing protein
RA 1,226,710 T→A 10.2% intergenic (‑220/‑111) gltI ← / → PP_1072 glutamate/aspartate ABC transporter substrate‑binding protein/leucine‑rich repeat‑containing protein
RA 1,230,583 G→T 7.0% V1255F (GTC→TTC)  PP_1072 → leucine‑rich repeat‑containing protein
RA 1,235,928 G→T 6.2% R87R (CGC→CGA)  glpF ← aquaglyceroporin
RA 1,242,983 G→A 8.3% intergenic (‑99/‑126) PP_1083 ← / → tsaA (2Fe‑2S)‑binding protein/peroxiredoxin
RA 1,244,368 A→G 11.4% G39G (GGT→GGC) ‡ rnt ← ribonuclease T
RA 1,244,369 C→G 11.4% G39A (GGT→GCT) ‡ rnt ← ribonuclease T
RA 1,244,370 C→T 11.3% G39S (GGT→AGT) ‡ rnt ← ribonuclease T
RA 1,269,389 C→G 6.0% D15H (GAT→CAT)  PP_1109 ← GntR family transcriptional regulator
RA 1,275,084 G→C 13.7% intergenic (‑281/+31) PP_5462 ← / ← PP_5463 hypothetical protein/hypothetical protein
RA 1,275,087 G→C 15.2% intergenic (‑284/+28) PP_5462 ← / ← PP_5463 hypothetical protein/hypothetical protein
RA 1,287,868 C→G 5.9% T417T (ACC→ACG)  PP_1125 → putative Helicase
RA 1,293,255 T→G 5.1% A286A (GCT→GCG)  PP_1128 → OmpA family protein
RA 1,293,264 C→A 5.1% A289A (GCC→GCA)  PP_1128 → OmpA family protein
RA 1,294,413 C→T 8.8% R11Q (CGG→CAG)  PP_1130 ← hypothetical protein
RA 1,294,415 G→C 9.5% C10W (TGC→TGG) ‡ PP_1130 ← hypothetical protein
RA 1,294,417 A→G 8.4% C10R (TGC→CGC) ‡ PP_1130 ← hypothetical protein
RA 1,311,322 C→G 5.8% A71P (GCA→CCA)  PP_1144 ← membrane protein
RA 1,313,631 G→C 6.3% A342A (GCC→GCG)  rapA ← RNA polymerase‑associated protein RapA
RA 1,313,636 G→C 5.3% R341G (CGC→GGC)  rapA ← RNA polymerase‑associated protein RapA
RA 1,320,300 T→A 9.4% T811S (ACA→TCA)  PP_1154 ← sensory box protein
RA 1,320,303 C→G 9.5% V810L (GTG→CTG)  PP_1154 ← sensory box protein
RA 1,320,306 T→A 10.7% T809S (ACA→TCA)  PP_1154 ← sensory box protein
RA 1,327,121 C→T 56.2% intergenic (+97/‑196) PP_16SE → / → PP_23SE 16S ribosomal RNA/23S ribosomal RNA
RA 1,342,251 C→T 11.5% intergenic (‑35/+20) PP_1166 ← / ← PP_1167 DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA 1,342,252 A→T 11.1% intergenic (‑36/+19) PP_1166 ← / ← PP_1167 DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA 1,342,253 A→G 11.3% intergenic (‑37/+18) PP_1166 ← / ← PP_1167 DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA 1,352,288 C→T 6.2% E24K (GAA→AAA)  PP_1178 ← hypothetical protein
RA 1,352,293 G→T 6.1% S22* (TCG→TAG) ‡ PP_1178 ← hypothetical protein
RA 1,352,294 A→C 7.0% S22A (TCG→GCG) ‡ PP_1178 ← hypothetical protein
RA 1,352,299 A→G 6.2% F20S (TTC→TCC)  PP_1178 ← hypothetical protein
RA 1,376,322 G→C 6.4% intergenic (+31/+18) kup → / ← PP_1201 potassium transport system protein Kup/hypothetical protein
RA 1,376,323 A→T 6.4% intergenic (+32/+17) kup → / ← PP_1201 potassium transport system protein Kup/hypothetical protein
RA 1,383,254 A→T 13.0% L16Q (CTG→CAG)  PP_1204 ← lipoprotein
RA 1,384,157 T→G 14.3% I292L (ATT→CTT)  proS ← proline‑‑tRNA ligase
RA 1,384,159 A→T 14.3% L291Q (CTG→CAG)  proS ← proline‑‑tRNA ligase
RA 1,384,161 C→A 13.4% K290N (AAG→AAT)  proS ← proline‑‑tRNA ligase
RA 1,397,101 G→C 6.4% V17L (GTC→CTC)  tolA → colicin S4/filamentous phage transport protein
RA 1,399,148 Δ1 bp 6.6% coding (981/1302 nt) tolB → Tol biopolymer transport system protein
RA 1,400,872 C→A 5.6% intergenic (+35/‑134) ybgF → / → queE TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA 1,400,874 A→T 7.0% intergenic (+37/‑132) ybgF → / → queE TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA 1,400,876 T→G 6.3% intergenic (+39/‑130) ybgF → / → queE TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA 1,401,650 T→C 6.5% R215R (CGT→CGC)  queE → 7‑carboxy‑7‑deazaguanine synthase
RA 1,403,590 G→A 17.8% intergenic (‑56/+25) PP_1227 ← / ← PP_1228 membrane protein/methyl‑accepting chemotaxis transducer
RA 1,416,862 G→A 5.7% R37Q (CGG→CAG)  PP_1239 → metallo‑beta‑lactamase family protein
RA 1,416,868 T→A 5.7% L39Q (CTG→CAG)  PP_1239 → metallo‑beta‑lactamase family protein
RA 1,419,548:1 +C 100% intergenic (‑37/+99) PP_1242 ← / ← PP_1244 hypothetical protein/hypothetical protein
RA 1,435,815 A→T 6.4% L50Q (CTG→CAG)  PP_1256 ← alpha‑ketoglutarate semialdehyde dehydrogenase
RA 1,435,822 A→T 8.1% C48S (TGC→AGC)  PP_1256 ← alpha‑ketoglutarate semialdehyde dehydrogenase
RA 1,450,049 G→A 7.6% R7C (CGC→TGC)  PP_1268 ← HtrA suppressor protein SohA
RA 1,450,925 C→T 15.0% R37W (CGG→TGG)  PP_1270 → LysR family transcriptional regulator
RA 1,453,671 C→T 7.1% A102V (GCG→GTG)  PP_1272 → multidrug MFS transporter membrane fusion protein
RA 1,457,917 T→G 8.6% V92V (GTT→GTG)  PP_1276 → hypothetical protein
RA 1,457,918 C→A 7.3% H93N (CAC→AAC)  PP_1276 → hypothetical protein
RA 1,472,713 C→G 6.0% S38S (TCG→TCC)  alg8 ← glycosyltransferase Alg8
RA 1,481,515 T→C 6.2% S75G (AGC→GGC)  rhlB ← ATP‑dependent RNA helicase RhlB
RA 1,483,879 C→A 7.3% intergenic (+24/‑44) yhdW → / → yhdX amino acid ABC transporter‑binding protein YhdW/amino acid ABC transporter permease
RA 1,489,370 A→G 8.3% intergenic (+169/‑34) ybgI → / → cysD metal‑binding hydrolase/oxidase/sulfate adenylyltransferase subunit 2
RA 1,494,903 C→T 6.9% intergenic (‑33/+62) PP_1306 ← / ← PP_1307 Pyocin S‑type killer domain‑containing protein/AsnC family transcriptional regulator
RA 1,495,650 G→A 6.4% A27T (GCC→ACC)  mdeA → methionine gamma‑lyase
RA 1,495,653 C→A 5.9% L28M (CTG→ATG) ‡ mdeA → methionine gamma‑lyase
RA 1,495,654 T→G 6.1% L28R (CTG→CGG) ‡ mdeA → methionine gamma‑lyase
RA 1,495,657 T→C 6.6% V29A (GTG→GCG)  mdeA → methionine gamma‑lyase
RA 1,496,815 T→G 7.9% intergenic (+47/+25) mdeA → / ← PP_1309 methionine gamma‑lyase/hypothetical protein
RA 1,496,816 T→C 7.8% intergenic (+48/+24) mdeA → / ← PP_1309 methionine gamma‑lyase/hypothetical protein
RA 1,496,817 G→A 7.7% intergenic (+49/+23) mdeA → / ← PP_1309 methionine gamma‑lyase/hypothetical protein
RA 1,496,818 C→A 9.0% intergenic (+50/+22) mdeA → / ← PP_1309 methionine gamma‑lyase/hypothetical protein
RA 1,499,480 2 bp→AC 100% intergenic (+57/‑106) trpS → / → zapE tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA 1,499,498 1 bp→CG 100% intergenic (+75/‑89) trpS → / → zapE tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA 1,499,506:1 +C 100% intergenic (+83/‑81) trpS → / → zapE tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA 1,504,067 T→A 9.2% intergenic (+34/‑229) rpsI → / → petA 30S ribosomal protein S9/ubiquinol‑cytochrome c reductase iron‑sulfur subunit
RA 1,504,068 T→A 9.1% intergenic (+35/‑228) rpsI → / → petA 30S ribosomal protein S9/ubiquinol‑cytochrome c reductase iron‑sulfur subunit
RA 1,505,538 G→T 8.7% G217V (GGC→GTC)  petB → cytochrome b
RA 1,505,544 A→C 5.4% D219A (GAC→GCC)  petB → cytochrome b
RA 1,517,281 C→A 8.2% A157A (GCC→GCA)  murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA 1,517,282 G→C 10.1% V158L (GTG→CTG) ‡ murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA 1,517,283 T→G 8.8% V158G (GTG→GGG) ‡ murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA 1,521,246 T→G 8.7% F168C (TTC→TGC) ‡ murD → UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA 1,521,247 C→G 8.7% F168L (TTC→TTG) ‡ murD → UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA 1,521,248 C→A 8.7% Q169K (CAG→AAG)  murD → UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA 1,521,990 C→T 7.2% A416V (GCC→GTC)  murD → UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA 1,533,185 C→G 5.1% T399S (ACC→AGC) ‡ secA → protein translocase subunit SecA
RA 1,533,186 C→T 5.1% T399T (ACC→ACT) ‡ secA → protein translocase subunit SecA
RA 1,544,489 C→A 25.0% intergenic (+48/+66) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,544,492 G→C 22.8% intergenic (+51/+63) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,544,494 C→G 31.3% intergenic (+53/+61) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,544,499 C→G 31.2% intergenic (+58/+56) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,544,501 G→C 31.3% intergenic (+60/+54) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,544,504 T→G 27.8% intergenic (+63/+51) mdfA → / ← ampG multidrug MFS transporter/muropeptide permease AmpG
RA 1,549,895 A→T 9.4% I99F (ATC→TTC)  groL → chaperonin GroEL
RA 1,549,900 C→T 9.4% V100V (GTC→GTT)  groL → chaperonin GroEL
RA 1,549,901 A→G 9.4% N101D (AAC→GAC)  groL → chaperonin GroEL
RA 1,549,906 A→T 9.6% E102D (GAA→GAT)  groL → chaperonin GroEL
RA 1,555,388 A→C 15.6% intergenic (+26/+48) sbcB → / ← PP_1366 exodeoxyribonuclease I/transcriptional regulator MvaT
RA 1,555,389 T→A 15.9% intergenic (+27/+47) sbcB → / ← PP_1366 exodeoxyribonuclease I/transcriptional regulator MvaT
RA 1,555,390 G→T 16.0% intergenic (+28/+46) sbcB → / ← PP_1366 exodeoxyribonuclease I/transcriptional regulator MvaT
RA 1,561,513 T→A 5.3% N193I (AAC→ATC) ‡ pctA ← methyl‑accepting chemotaxis protein PctA
RA 1,561,514 T→C 5.2% N193D (AAC→GAC) ‡ pctA ← methyl‑accepting chemotaxis protein PctA
RA 1,567,267 T→C 7.0% intergenic (+71/‑250) pcaR → / → pcaK pca regulon transcriptional regulator/4‑hydroxybenzoate transporter
RA 1,572,248 T→C 5.6% L124L (TTG→CTG) ‡ pcaB → 3‑carboxy‑cis,cis‑muconate cycloisomerase
RA 1,572,249 T→A 5.6% L124* (TTG→TAG) ‡ pcaB → 3‑carboxy‑cis,cis‑muconate cycloisomerase
RA 1,572,889 C→A 7.6% A337A (GCC→GCA)  pcaB → 3‑carboxy‑cis,cis‑muconate cycloisomerase
RA 1,572,890 C→G 7.2% L338V (CTG→GTG) ‡ pcaB → 3‑carboxy‑cis,cis‑muconate cycloisomerase
RA 1,572,891 T→G 7.5% L338R (CTG→CGG) ‡ pcaB → 3‑carboxy‑cis,cis‑muconate cycloisomerase
RA 1,580,604 C→T 7.3% V265I (GTC→ATC)  ttgB ← efflux pump membrane protein TtgB
RA 1,580,605 A→G 7.2% D264D (GAT→GAC)  ttgB ← efflux pump membrane protein TtgB
RA 1,580,995 C→A 100% K134N (AAG→AAT)  ttgB ← efflux pump membrane protein TtgB
RA 1,582,780 T→A 8.4% intergenic (‑226/‑32) ttgA ← / → ttgR efflux pump periplasmic linker TtgA/HTH‑type transcriptional regulator TtgR
RA 1,582,787 T→G 7.8% intergenic (‑233/‑25) ttgA ← / → ttgR efflux pump periplasmic linker TtgA/HTH‑type transcriptional regulator TtgR
RA 1,591,982 C→A 14.0% intergenic (‑89/‑114) PP_1395 ← / → PP_1396 AraC family transcriptional regulator/hypothetical protein
RA 1,591,987 T→G 11.4% intergenic (‑94/‑109) PP_1395 ← / → PP_1396 AraC family transcriptional regulator/hypothetical protein
RA 1,598,170 T→C 5.5% I198V (ATC→GTC)  dctB ← C4‑dicarboxylate transport sensor protein
RA 1,598,813 C→A 5.3% intergenic (‑52/+79) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,828 A→G 9.2% intergenic (‑67/+64) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,831 C→G 9.1% intergenic (‑70/+61) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,832 T→C 9.1% intergenic (‑71/+60) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,833 G→A 8.6% intergenic (‑72/+59) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,834 C→G 8.4% intergenic (‑73/+58) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,598,837 C→T 8.6% intergenic (‑76/+55) dctB ← / ← bglX C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA 1,620,347 G→C 5.9% intergenic (‑113/‑88) opdH ← / → tctD tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA 1,620,348 C→G 6.2% intergenic (‑114/‑87) opdH ← / → tctD tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA 1,620,349 G→C 6.4% intergenic (‑115/‑86) opdH ← / → tctD tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA 1,622,913 C→T 6.7% L148L (TTG→TTA) ‡ PP_1422 ← hypothetical protein
RA 1,622,914 A→T 6.3% L148* (TTG→TAG) ‡ PP_1422 ← hypothetical protein
RA 1,622,915 A→G 6.3% L148L (TTG→CTG) ‡ PP_1422 ← hypothetical protein
RA 1,625,207 G→T 7.1% intergenic (+30/+27) PP_1425 → / ← nadB hypothetical protein/L‑aspartate oxidase
RA 1,625,208 A→C 7.6% intergenic (+31/+26) PP_1425 → / ← nadB hypothetical protein/L‑aspartate oxidase
RA 1,637,315 T→C 7.9% intergenic (+24/+42) pdxJ → / ← PP_1437 pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA 1,637,325 A→T 13.0% intergenic (+34/+32) pdxJ → / ← PP_1437 pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA 1,637,326 A→T 13.1% intergenic (+35/+31) pdxJ → / ← PP_1437 pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA 1,637,342 A→G 10.1% intergenic (+51/+15) pdxJ → / ← PP_1437 pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA 1,637,344 C→T 7.7% intergenic (+53/+13) pdxJ → / ← PP_1437 pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA 1,639,575 C→T 9.7% intergenic (‑165/‑146) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,639,576 G→T 9.2% intergenic (‑166/‑145) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,639,580 G→A 9.4% intergenic (‑170/‑141) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,639,581 T→C 9.8% intergenic (‑171/‑140) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,639,585 A→C 9.2% intergenic (‑175/‑136) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,639,586 A→G 9.4% intergenic (‑176/‑135) czcR‑III ← / → PP_1439 response regulator/hypothetical protein
RA 1,642,271 G→C 12.5% intergenic (‑99/+53) PP_1442 ← / ← lon‑I hypothetical protein/DNA‑binding ATP‑dependent protease
RA 1,642,277 G→C 11.9% intergenic (‑105/+47) PP_1442 ← / ← lon‑I hypothetical protein/DNA‑binding ATP‑dependent protease
RA 1,642,278 C→G 11.7% intergenic (‑106/+46) PP_1442 ← / ← lon‑I hypothetical protein/DNA‑binding ATP‑dependent protease
RA 1,642,279 G→C 11.6% intergenic (‑107/+45) PP_1442 ← / ← lon‑I hypothetical protein/DNA‑binding ATP‑dependent protease
RA 1,642,285 G→C 11.8% intergenic (‑113/+39) PP_1442 ← / ← lon‑I hypothetical protein/DNA‑binding ATP‑dependent protease
RA 1,652,200 A→G 5.2% intergenic (+119/+42) PP_1448 → / ← PP_1449 membrane protein/hypothetical protein
RA 1,657,538 T→A 7.6% D319V (GAC→GTC)  PP_1450 ← TPS family activation/secretion protein
RA 1,663,075 A→T 6.2% intergenic (+21/+17) purT → / ← yhjE phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA 1,663,076 A→T 6.2% intergenic (+22/+16) purT → / ← yhjE phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA 1,663,077 A→T 6.2% intergenic (+23/+15) purT → / ← yhjE phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA 1,676,160 C→G 6.0% intergenic (+22/‑38) hom → / → thrC homoserine dehydrogenase/threonine synthase
RA 1,676,163 C→G 6.2% intergenic (+25/‑35) hom → / → thrC homoserine dehydrogenase/threonine synthase
RA 1,677,420 T→G 5.6% L408R (CTG→CGG) ‡ thrC → threonine synthase
RA 1,677,421 G→C 5.7% L408L (CTG→CTC) ‡ thrC → threonine synthase
RA 1,677,428 G→C 6.3% A411P (GCG→CCG) ‡ thrC → threonine synthase
RA 1,677,429 C→A 5.5% A411E (GCG→GAG) ‡ thrC → threonine synthase
RA 1,690,412 G→A 6.1% T140M (ACG→ATG) ‡ ydcS ← polyamine ABC transporter, periplasmic polyamine‑binding protein
RA 1,690,413 T→C 6.1% T140A (ACG→GCG) ‡ ydcS ← polyamine ABC transporter, periplasmic polyamine‑binding protein
RA 1,703,248 A→G 30.3% intergenic (+97/‑70) lysS → / → PP_1497 lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA 1,703,250 G→C 27.7% intergenic (+99/‑68) lysS → / → PP_1497 lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA 1,703,252 C→T 29.4% intergenic (+101/‑66) lysS → / → PP_1497 lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA 1,706,336 T→G 8.7% M134R (ATG→AGG)  PP_1500 → lipoprotein
RA 1,706,338 G→C 8.7% A135P (GCC→CCC) ‡ PP_1500 → lipoprotein
RA 1,706,340 C→A 8.7% A135A (GCC→GCA) ‡ PP_1500 → lipoprotein
RA 1,710,161 T→A 9.2% A260A (GCT→GCA)  ppc → phosphoenolpyruvate carboxylase
RA 1,710,935 T→C 5.7% L518L (CTT→CTC)  ppc → phosphoenolpyruvate carboxylase
RA 1,712,951 T→A 11.7% intergenic (+34/‑106) adk → / → tsaB adenylate kinase/endopeptidase
RA 1,712,952 T→A 11.6% intergenic (+35/‑105) adk → / → tsaB adenylate kinase/endopeptidase
RA 1,714,464 C→A 6.2% P103Q (CCG→CAG)  PP_1509 → hypothetical protein
RA 1,730,146 G→C 5.1% A314A (GCC→GCG) ‡ dapE ← succinyl‑diaminopimelate desuccinylase
RA 1,730,148 C→A 5.1% A314S (GCC→TCC) ‡ dapE ← succinyl‑diaminopimelate desuccinylase
RA 1,730,159 T→G 5.9% D310A (GAC→GCC)  dapE ← succinyl‑diaminopimelate desuccinylase
RA 1,730,161 G→C 5.1% L309L (CTC→CTG)  dapE ← succinyl‑diaminopimelate desuccinylase
RA 1,741,930 C→G 6.1% intergenic (‑18/+66) PP_1538 ← / ← PP_1539 hypothetical protein/hypothetical protein
RA 1,741,935 C→G 7.6% intergenic (‑23/+61) PP_1538 ← / ← PP_1539 hypothetical protein/hypothetical protein
RA 1,761,927 A→T 7.5% N359Y (AAC→TAC) ‡ PP_1567 → capsid protein
RA 1,761,928 A→T 7.5% N359I (AAC→ATC) ‡ PP_1567 → capsid protein
RA 1,784,030 G→A 7.1% A16V (GCG→GTG)  glnD ← uridylyltransferase
RA 1,822,188 G→T 6.5% intergenic (+30/+28) PP_mr22 → / ← fdxA PrrB_RsmZ ncRNA/ferredoxin 1
RA 1,822,189 A→T 6.6% intergenic (+31/+27) PP_mr22 → / ← fdxA PrrB_RsmZ ncRNA/ferredoxin 1
RA 1,822,190 A→C 6.6% intergenic (+32/+26) PP_mr22 → / ← fdxA PrrB_RsmZ ncRNA/ferredoxin 1
RA 1,825,091 G→C 6.3% R55G (CGC→GGC)  mutS ← DNA mismatch repair protein MutS
RA 1,835,165 A→G 7.2% F132L (TTT→CTT)  PP_1639 ← SprT family protein
MC JC 1,843,382 Δ8 bp 100% coding (1405‑1412/2754 nt) gacS ← sensor protein GacS
RA 1,859,527 A→C 9.4% intergenic (‑119/+37) PP_1662 ← / ← PP_1663 hypothetical protein/hypothetical protein
RA 1,859,529 T→A 9.1% intergenic (‑121/+35) PP_1662 ← / ← PP_1663 hypothetical protein/hypothetical protein
RA 1,859,531 G→T 9.2% intergenic (‑123/+33) PP_1662 ← / ← PP_1663 hypothetical protein/hypothetical protein
RA 1,863,829 T→C 6.0% T145T (ACT→ACC)  PP_1667 → transporter
RA 1,893,945 G→C 10.4% R24P (CGT→CCT) ‡ PP_1699 → 2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA 1,893,946 T→A 9.8% R24R (CGT→CGA) ‡ PP_1699 → 2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA 1,893,947 G→C 10.0% G25R (GGG→CGG)  PP_1699 → 2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA 1,897,179 T→C 6.5% intergenic (‑32/+112) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,185 C→T 8.6% intergenic (‑38/+106) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,188 G→A 8.2% intergenic (‑41/+103) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,189 A→C 8.4% intergenic (‑42/+102) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,203 G→T 9.7% intergenic (‑56/+88) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,207 T→A 9.5% intergenic (‑60/+84) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,897,211 A→C 9.1% intergenic (‑64/+80) PP_mr24 ← / ← rdgC mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA 1,903,525 G→C 12.3% intergenic (+50/‑221) PP_1703 → / → nirB assimilatory nitrate reductase/sulfite reductase/nitrite reductase large subunit
RA 1,903,526 G→C 12.2% intergenic (+51/‑220) PP_1703 → / → nirB assimilatory nitrate reductase/sulfite reductase/nitrite reductase large subunit
RA 1,906,456 G→T 6.5% V53V (GTG→GTT)  nirD → nitrite reductase
RA 1,914,237 C→G 5.0% P202A (CCG→GCG)  pcaQ → transcriptional regulator PcaQ
RA 1,918,256 C→G 10.9% intergenic (‑32/+86) PP_1718 ← / ← prc EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA 1,918,257 T→C 11.1% intergenic (‑33/+85) PP_1718 ← / ← prc EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA 1,918,258 G→A 11.3% intergenic (‑34/+84) PP_1718 ← / ← prc EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA 1,918,259 C→G 11.3% intergenic (‑35/+83) PP_1718 ← / ← prc EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA 1,932,638:1 +C 100% intergenic (‑105/+45) rluA ← / ← minE bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA/cell division topological specificity factor
RA 1,938,846 C→G 5.4% P70P (CCG→CCC)  PP_1738 ← hypothetical protein
RA 1,951,835 A→C 5.3% I569S (ATC→AGC)  mnmC ← methyltransferase/FAD‑dependent oxidoreductase
RA 1,951,838 G→T 5.6% P568H (CCT→CAT) ‡ mnmC ← methyltransferase/FAD‑dependent oxidoreductase
RA 1,951,839 G→C 5.8% P568A (CCT→GCT) ‡ mnmC ← methyltransferase/FAD‑dependent oxidoreductase
RA 1,977,148 C→A 5.3% A271E (GCG→GAG)  PP_1770 → 3‑phosphoshikimate 1‑carboxyvinyltransferase
RA 1,978,708 C→G 12.7% F45L (TTC→TTG)  cmk → cytidylate kinase
RA 1,993,602 G→T 5.5% intergenic (+40/+58) PP_1780 → / ← PP_1781 mannosyltransferase/acyltransferase
RA 1,993,604 A→C 5.3% intergenic (+42/+56) PP_1780 → / ← PP_1781 mannosyltransferase/acyltransferase
RA 1,995,952 G→T 8.2% intergenic (‑198/+87) PP_mr26 ← / ← rfbC C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA 1,995,954 G→T 6.5% intergenic (‑200/+85) PP_mr26 ← / ← rfbC C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA 1,995,955 A→T 6.6% intergenic (‑201/+84) PP_mr26 ← / ← rfbC C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA 1,995,956 A→C 6.6% intergenic (‑202/+83) PP_mr26 ← / ← rfbC C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA 1,995,958 A→C 6.6% intergenic (‑204/+81) PP_mr26 ← / ← rfbC C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA 2,007,238 G→A 5.4% L42L (CTG→TTG)  PP_1790 ← acylneuraminate cytidylyltransferase
RA 2,007,239 T→C 5.4% Q41Q (CAA→CAG)  PP_1790 ← acylneuraminate cytidylyltransferase
RA 2,015,317 T→A 6.7% E57D (GAA→GAT)  PP_1794 ← hypothetical protein
RA 2,023,484 Δ1 bp 5.6% coding (516/897 nt) rmd → oxidoreductase Rmd
RA 2,023,489 A→G 5.3% E174G (GAG→GGG)  rmd → oxidoreductase Rmd
RA 2,023,495 T→C 5.3% F176S (TTC→TCC)  rmd → oxidoreductase Rmd
RA 2,023,499:1 +C 5.3% coding (531/897 nt) rmd → oxidoreductase Rmd
RA 2,034,007 G→T 5.1% K496N (AAG→AAT)  pgi‑I → glucose 6‑phosphate isomerase
RA 2,052,784 G→T 8.2% intergenic (+16/+34) prmB → / ← PP_1828 N5‑glutamine S‑adenosyl‑L‑methionine‑dependent methyltransferase/hypothetical protein
RA 2,052,786 A→C 7.4% intergenic (+18/+32) prmB → / ← PP_1828 N5‑glutamine S‑adenosyl‑L‑methionine‑dependent methyltransferase/hypothetical protein
RA 2,054,316 G→C 5.2% P104A (CCG→GCG)  PP_1829 ← alpha/beta family hydrolase
RA 2,054,324 G→C 5.4% A101G (GCC→GGC)  PP_1829 ← alpha/beta family hydrolase
RA 2,068,151 A→T 7.1% intergenic (‑96/+25) plsC ← / ← PP_1845 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/enoyl‑CoA hydratase/isomerase family protein
RA 2,077,428 T→C 6.2% F51S (TTC→TCC)  PP_1853 → LysR family transcriptional regulator
RA 2,090,926 T→C 5.7% R84R (CGT→CGC)  deaD → ATP‑dependent DEAD‑box RNA helicase DeaD
RA 2,090,928 A→G 5.7% E85G (GAG→GGG)  deaD → ATP‑dependent DEAD‑box RNA helicase DeaD
RA 2,095,189 G→C 11.5% intergenic (‑240/+77) htpX ← / ← alaA protease HtpX/glutamate‑pyruvate aminotransferase
RA 2,128,229 A→T 10.0% A1200A (GCA→GCT)  PP_1887 → hypothetical protein
RA 2,128,232 A→T 10.3% Q1201H (CAA→CAT)  PP_1887 → hypothetical protein
RA 2,128,233 A→T 9.6% M1202L (ATG→TTG)  PP_1887 → hypothetical protein
RA 2,128,236 A→T 10.0% S1203C (AGC→TGC)  PP_1887 → hypothetical protein
RA 2,131,375 A→G 5.3% M275T (ATG→ACG)  fimD ← type I pili subunit FimD
RA 2,131,450 G→T 5.3% T250K (ACG→AAG) ‡ fimD ← type I pili subunit FimD
RA 2,131,451 T→G 6.4% T250P (ACG→CCG) ‡ fimD ← type I pili subunit FimD
RA 2,131,452 C→A 6.1% L249L (CTG→CTT) ‡ fimD ← type I pili subunit FimD
RA 2,131,453 A→C 5.3% L249R (CTG→CGG) ‡ fimD ← type I pili subunit FimD
RA 2,132,962 G→A 9.1% T17M (ACG→ATG)  PP_1890 ← type I pili chaperone protein FimC
RA 2,135,131 C→A 5.1% K540N (AAG→AAT)  fadE ← medium‑long chain acyl‑CoA dehydrogenase
RA 2,138,409 T→G 5.5% L171R (CTG→CGG)  yadG → ABC transporter ATP‑binding protein
RA 2,171,668 G→A 6.4% intergenic (+203/+200) PP_5484 → / ← PP_1924 hypothetical protein/phosphinothricin N‑acetyltransferase
RA 2,184,221 C→A 5.2% P93P (CCC→CCA)  PP_5490 → site‑specific DNA recombinase
RA 2,184,222 T→G 5.3% W94G (TGG→GGG)  PP_5490 → site‑specific DNA recombinase
RA 2,242,037 G→A 7.1% intergenic (+35/‑27) PP_t28 → / → PP_t29 tRNA‑Glu/tRNA‑Ala
RA 2,242,040 G→A 7.1% intergenic (+38/‑24) PP_t28 → / → PP_t29 tRNA‑Glu/tRNA‑Ala
RA 2,242,046 T→C 7.2% intergenic (+44/‑18) PP_t28 → / → PP_t29 tRNA‑Glu/tRNA‑Ala
RA 2,242,049 T→C 7.3% intergenic (+47/‑15) PP_t28 → / → PP_t29 tRNA‑Glu/tRNA‑Ala
RA 2,246,241 C→T 18.3% intergenic (+30/+61) ibpA → / ← PP_1983 small heat shock protein IbpA/PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
RA 2,246,242 A→G 18.3% intergenic (+31/+60) ibpA → / ← PP_1983 small heat shock protein IbpA/PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
RA 2,254,518 T→G 5.4% P279P (CCT→CCG)  leuB → 3‑isopropylmalate dehydrogenase
RA 2,254,521 C→G 5.3% C280W (TGC→TGG)  leuB → 3‑isopropylmalate dehydrogenase
RA 2,254,524 C→A 5.1% H281Q (CAC→CAA)  leuB → 3‑isopropylmalate dehydrogenase
RA 2,255,974 G→T 9.8% intergenic (+34/‑670) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,255,975 T→C 9.9% intergenic (+35/‑669) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,255,976 G→A 9.8% intergenic (+36/‑668) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,255,977 A→C 10.1% intergenic (+37/‑667) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,256,224 G→T 9.0% intergenic (+284/‑420) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,256,225 G→C 9.8% intergenic (+285/‑419) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,256,226 A→C 10.0% intergenic (+286/‑418) asd → / → PP_1990 aspartate‑semialdehyde dehydrogenase/transposase
RA 2,264,563 G→A 100% M171I (ATG→ATA)  accD → acetyl‑CoA carboxylase carboxyltransferase subunit beta
RA 2,273,052 A→G 10.3% intergenic (+17/+274) PP_2003 → / ← PP_2004 hypothetical protein/AraC family transcriptional regulator
RA 2,273,062 C→G 10.4% intergenic (+27/+264) PP_2003 → / ← PP_2004 hypothetical protein/AraC family transcriptional regulator
RA 2,273,066 A→T 10.8% intergenic (+31/+260) PP_2003 → / ← PP_2004 hypothetical protein/AraC family transcriptional regulator
RA 2,273,070 C→G 10.6% intergenic (+35/+256) PP_2003 → / ← PP_2004 hypothetical protein/AraC family transcriptional regulator
RA 2,282,770 T→G 39.8% intergenic (‑162/+67) PP_2010 ← / ← PP_2011 cytochrome b561/hypothetical protein
RA 2,282,774 G→C 43.5% intergenic (‑166/+63) PP_2010 ← / ← PP_2011 cytochrome b561/hypothetical protein
RA 2,282,775 G→C 43.8% intergenic (‑167/+62) PP_2010 ← / ← PP_2011 cytochrome b561/hypothetical protein
RA 2,282,779 C→A 44.8% intergenic (‑171/+58) PP_2010 ← / ← PP_2011 cytochrome b561/hypothetical protein
RA 2,294,021 T→A 11.1% L6M (TTG→ATG)  PP_2020 → lipoprotein
RA 2,298,604 G→A 5.1% D506D (GAC→GAT)  sbcC ← exonuclease subunit SbcC
RA 2,316,255:1 +C 5.9% coding (59/1548 nt) PP_2038 → long‑chain‑fatty‑acid‑‑CoA ligase
RA 2,316,260 Δ1 bp 6.1% coding (64/1548 nt) PP_2038 → long‑chain‑fatty‑acid‑‑CoA ligase
RA 2,320,804 A→C 5.8% V146G (GTG→GGG)  PP_2041 ← LysR family transcriptional regulator
RA 2,325,726 C→G 6.1% A526A (GCG→GCC)  PP_2045 ← metallo‑beta‑lactamase family protein
RA 2,335,393 A→T 5.8% F355Y (TTC→TAC)  PP_2052 ← bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
RA 2,336,497 C→T 13.6% intergenic (‑41/+39) PP_2052 ← / ← PP_5500 bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA 2,336,498 A→T 13.5% intergenic (‑42/+38) PP_2052 ← / ← PP_5500 bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA 2,336,499 A→G 13.6% intergenic (‑43/+37) PP_2052 ← / ← PP_5500 bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA 2,344,669 C→A 12.8% intergenic (‑20/+55) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,344,674 Δ1 bp 11.0% intergenic (‑25/+50) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,344,681 A→C 10.5% intergenic (‑32/+43) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,344,682 G→T 10.7% intergenic (‑33/+42) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,344,688:1 +C 8.0% intergenic (‑39/+36) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,344,693 T→G 7.8% intergenic (‑44/+31) PP_2061 ← / ← PP_2062 hypothetical protein/hypothetical protein
RA 2,350,523 C→G 6.0% G910G (GGC→GGG)  PP_2065 → multidrug RND transporter
RA 2,350,525 T→C 6.0% L911P (CTG→CCG)  PP_2065 → multidrug RND transporter
RA 2,376,708 T→C 5.6% intergenic (+69/‑136) PP_2083 → / → PP_2084 lipase/ribonuclease activity regulator
RA 2,385,793 Δ1 bp 6.1% coding (85/576 nt) PP_2093 ← two‑component system response regulator NasT
RA 2,385,797:1 +A 5.8% coding (81/576 nt) PP_2093 ← two‑component system response regulator NasT
RA 2,389,141 T→C 6.3% M1T (ATG→ACG) † rlmKL → 23S rRNA (guanine(2445)‑N(2))/(guanine(2069)‑N(7))‑ methyltransferase
RA 2,389,144 G→A 6.3% R2H (CGT→CAT)  rlmKL → 23S rRNA (guanine(2445)‑N(2))/(guanine(2069)‑N(7))‑ methyltransferase
RA 2,395,035 G→A 7.2% L120L (CTG→TTG)  dacB ← D‑alanyl‑D‑alanine carboxypeptidase
RA 2,409,206 C→G 5.6% E748Q (GAG→CAG)  acnA‑I ← aconitate hydratase
RA 2,419,540 C→T 6.0% P231S (CCG→TCG)  ctpH → methyl‑accepting chemotaxis protein CtpH
RA 2,420,598 Δ1 bp 10.4% intergenic (+81/+26) ctpH → / ← PP_t62 methyl‑accepting chemotaxis protein CtpH/tRNA‑Pro
RA 2,420,602:1 +T 10.3% intergenic (+85/+22) ctpH → / ← PP_t62 methyl‑accepting chemotaxis protein CtpH/tRNA‑Pro
RA 2,421,944 G→C 6.1% G78R (GGC→CGC)  moeA → molybdenum::molybdopterin ligase
RA 2,421,952 G→C 5.5% P80P (CCG→CCC)  moeA → molybdenum::molybdopterin ligase
RA 2,440,461:1 +A 5.3% intergenic (+26/‑50) pcaF‑II → / → PP_2138 beta‑ketoadipyl‑CoA thiolase subunit beta/hypothetical protein
RA 2,440,466 Δ1 bp 5.4% intergenic (+31/‑45) pcaF‑II → / → PP_2138 beta‑ketoadipyl‑CoA thiolase subunit beta/hypothetical protein
RA 2,445,044 T→G 8.3% E156D (GAA→GAC) ‡ lexA‑I ← transcriptional repressor
RA 2,445,045 T→A 7.3% E156V (GAA→GTA) ‡ lexA‑I ← transcriptional repressor
RA 2,445,046 C→A 8.3% E156* (GAA→TAA) ‡ lexA‑I ← transcriptional repressor
RA 2,453,596 G→A 5.4% A508V (GCC→GTC)  mfd ← transcription‑repair coupling factor
RA 2,453,602 T→A 5.2% Q506L (CAG→CTG)  mfd ← transcription‑repair coupling factor
RA 2,453,608 T→C 5.3% D504G (GAC→GGC)  mfd ← transcription‑repair coupling factor
RA 2,458,107 T→C 5.6% intergenic (+179/‑26) PP_2150 → / → sthA thiamine biosynthesis lipoprotein/pyridine nucleotide transhydrogenase
RA 2,460,731 G→C 6.7% L25V (CTG→GTG)  PP_2153 ← hypothetical protein
RA 2,460,732 G→C 6.8% H24Q (CAC→CAG)  PP_2153 ← hypothetical protein
RA 2,464,992 C→T 5.9% A216T (GCC→ACC)  PP_2157 ← sensor histidine kinase
RA 2,469,842 T→C 10.9% intergenic (+11/+24) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,844 G→A 12.2% intergenic (+13/+22) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,851 A→T 12.2% intergenic (+20/+15) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,852 A→T 13.1% intergenic (+21/+14) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,853 A→T 13.9% intergenic (+22/+13) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,860 T→C 11.6% intergenic (+29/+6) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,469,862 G→A 10.9% intergenic (+31/+4) vacJ → / ← PP_2164 lipoprotein VacJ/hypothetical protein
RA 2,474,141 C→T 25.0% intergenic (‑46/+134) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,143 T→C 29.9% intergenic (‑48/+132) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,148 T→C 23.1% intergenic (‑53/+127) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,149 C→T 22.5% intergenic (‑54/+126) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,154 A→G 22.5% intergenic (‑59/+121) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,155 G→A 24.9% intergenic (‑60/+120) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,160 G→A 26.3% intergenic (‑65/+115) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,474,162 A→G 26.3% intergenic (‑67/+113) PP_2167 ← / ← tal PhoD‑like phosphatase/transaldolase
RA 2,475,280 A→G 8.4% intergenic (‑79/+78) tal ← / ← dusA transaldolase/tRNA dihydrouridine synthase DusA
RA 2,475,283 C→A 8.2% intergenic (‑82/+75) tal ← / ← dusA transaldolase/tRNA dihydrouridine synthase DusA
RA 2,475,286 T→G 8.3% intergenic (‑85/+72) tal ← / ← dusA transaldolase/tRNA dihydrouridine synthase DusA
RA 2,475,289 C→T 8.2% intergenic (‑88/+69) tal ← / ← dusA transaldolase/tRNA dihydrouridine synthase DusA
RA 2,517,557 G→C 6.0% intergenic (+54/‑24) PP_2210 → / → PP_2211 LysR family transcriptional regulator/AraC family transcriptional regulator
RA 2,530,959 A→C 9.7% T66T (ACA→ACC)  PP_2219 → hypothetical protein
RA 2,538,457 C→T 9.6% L194L (CTG→CTA) ‡ mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,459 G→T 9.3% L194M (CTG→ATG) ‡ mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,465 T→G 9.4% K192Q (AAG→CAG)  mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,467 T→A 9.4% D191V (GAC→GTC)  mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,469 C→A 8.8% L190L (CTG→CTT)  mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,475 A→C 8.8% Y188* (TAT→TAG) ‡ mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,538,477 A→G 8.7% Y188H (TAT→CAT) ‡ mrpAB ← K(+)/H(+) antiporter subunit A/B
RA 2,539,129 G→C 5.9% intergenic (‑91/+60) mrpAB ← / ← PP_2231 K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA 2,539,130 C→T 5.9% intergenic (‑92/+59) mrpAB ← / ← PP_2231 K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA 2,539,134 G→C 6.1% intergenic (‑96/+55) mrpAB ← / ← PP_2231 K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA 2,539,138 A→G 6.2% intergenic (‑100/+51) mrpAB ← / ← PP_2231 K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA 2,539,139 G→C 6.2% intergenic (‑101/+50) mrpAB ← / ← PP_2231 K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA 2,540,809 T→A 11.8% intergenic (+22/+27) PP_2232 → / ← PP_2233 XRE family transcriptional regulator/isochorismatase family hydrolase
RA 2,540,810 G→C 11.9% intergenic (+23/+26) PP_2232 → / ← PP_2233 XRE family transcriptional regulator/isochorismatase family hydrolase
RA 2,540,811 T→A 10.8% intergenic (+24/+25) PP_2232 → / ← PP_2233 XRE family transcriptional regulator/isochorismatase family hydrolase
RA 2,546,823 T→C 9.8% intergenic (+22/+18) PP_2238 → / ← PP_5504 metallopeptidase/hypothetical protein
RA 2,546,826 G→A 9.8% intergenic (+25/+15) PP_2238 → / ← PP_5504 metallopeptidase/hypothetical protein
RA 2,548,024 A→G 5.9% L60L (TTG→CTG)  rhtA ← threonine/homoserine exporter
RA 2,559,991 T→G 6.0% intergenic (+16/‑48) fepA → / → PP_2243 ferric enterobactin transport system outer membrane subunit/hypothetical protein
RA 2,574,849 T→C 7.1% V9A (GTG→GCG)  PP_2258 → sensory box protein
RA 2,574,852 A→C 7.0% D10A (GAC→GCC)  PP_2258 → sensory box protein
RA 2,574,854 G→A 7.5% A11T (GCG→ACG)  PP_2258 → sensory box protein
RA 2,576,169 T→G 5.4% L449R (CTG→CGG)  PP_2258 → sensory box protein
RA 2,591,521 C→T 8.0% A146V (GCG→GTG)  PP_2269 → N‑acetylmuramoyl‑L‑alanine amidase
RA 2,601,180 C→T 13.1% L219L (CTC→CTT)  PP_2279 → head‑to‑tail joining protein
RA 2,601,181 A→G 13.1% K220E (AAG→GAG)  PP_2279 → head‑to‑tail joining protein
RA 2,633,457 T→G 6.5% intergenic (+100/‑82) hupB → / → PP_2304 DNA binding regulator subunit beta B/peptidyl‑prolyl cis‑trans isomerase D
RA 2,633,458 C→A 6.6% intergenic (+101/‑81) hupB → / → PP_2304 DNA binding regulator subunit beta B/peptidyl‑prolyl cis‑trans isomerase D
RA 2,644,840 G→C 5.2% P825R (CCG→CGG) ‡ PP_2316 ← ABC transporter permease
RA 2,644,841 G→C 5.3% P825A (CCG→GCG) ‡ PP_2316 ← ABC transporter permease
RA 2,650,088 C→A 8.1% intergenic (+27/+107) PP_2320 → / ← oprI hypothetical protein/major outer membrane lipoprotein
RA 2,650,160 A→T 8.3% intergenic (+99/+35) PP_2320 → / ← oprI hypothetical protein/major outer membrane lipoprotein
RA 2,650,161 A→T 8.1% intergenic (+100/+34) PP_2320 → / ← oprI hypothetical protein/major outer membrane lipoprotein
RA 2,654,962 G→A 5.0% T217T (ACG→ACA)  cysB → transcriptional regulator CysB
RA 2,659,276 T→C 5.3% T354A (ACC→GCC)  PP_2331 ← membrane protein
RA 2,666,641 T→A 6.9% L835Q (CTG→CAG)  acnA‑II → aconitate hydratase
RA 2,669,671 T→G 9.7% intergenic (+38/+37) prpD → / ← acnB 2‑methylcitrate dehydratase/aconitate hydratase B
RA 2,669,674 C→A 9.7% intergenic (+41/+34) prpD → / ← acnB 2‑methylcitrate dehydratase/aconitate hydratase B
RA 2,721,382 T→A 8.0% intergenic (‑344/‑98) PP_2381 ← / → PP_2382 hypothetical protein/putative transporter
RA 2,721,384 G→T 8.0% intergenic (‑346/‑96) PP_2381 ← / → PP_2382 hypothetical protein/putative transporter
RA 2,721,390 T→A 8.3% intergenic (‑352/‑90) PP_2381 ← / → PP_2382 hypothetical protein/putative transporter
RA 2,721,398 A→C 8.7% intergenic (‑360/‑82) PP_2381 ← / → PP_2382 hypothetical protein/putative transporter
RA 2,721,400 T→A 8.7% intergenic (‑362/‑80) PP_2381 ← / → PP_2382 hypothetical protein/putative transporter
RA 2,726,160 G→A 7.3% Q166* (CAG→TAG)  PP_2387 ← hypothetical protein
RA 2,726,161 G→C 8.5% Y165* (TAC→TAG) ‡ PP_2387 ← hypothetical protein
RA 2,726,162 T→C 7.2% Y165C (TAC→TGC) ‡ PP_2387 ← hypothetical protein
RA 2,740,843 Δ1 bp 5.3% coding (3222/4494 nt) PP_2395 → leucine‑rich repeat‑containing protein
RA 2,741,748 C→A 12.0% P1376Q (CCA→CAA)  PP_2395 → leucine‑rich repeat‑containing protein
RA 2,741,751 T→G 7.9% L1377W (TTG→TGG)  PP_2395 → leucine‑rich repeat‑containing protein
RA 2,745,175 G→T 10.4% intergenic (+18/+17) PP_2399 → / ← PP_2400 hypothetical protein/hypothetical protein
RA 2,745,176 C→G 10.4% intergenic (+19/+16) PP_2399 → / ← PP_2400 hypothetical protein/hypothetical protein
RA 2,745,177 A→C 9.5% intergenic (+20/+15) PP_2399 → / ← PP_2400 hypothetical protein/hypothetical protein
RA 2,774,810 T→C 9.3% P234P (CCA→CCG) ‡ PP_5521 ← hypothetical protein
RA 2,774,811 G→C 9.1% P234R (CCA→CGA) ‡ PP_5521 ← hypothetical protein
RA 2,774,812 G→A 8.7% P234S (CCA→TCA) ‡ PP_5521 ← hypothetical protein
RA 2,776,838 C→A 13.3% A395A (GCC→GCA)  sotB → sugar efflux transporter
RA 2,776,839 G→A 11.9% V396I (GTT→ATT) ‡ sotB → sugar efflux transporter
RA 2,776,840 T→C 12.1% V396A (GTT→GCT) ‡ sotB → sugar efflux transporter
RA 2,776,841 T→G 12.1% V396V (GTT→GTG) ‡ sotB → sugar efflux transporter
RA 2,787,623 G→A 13.0% intergenic (+70/‑55) ahpC → / → ahpF peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA 2,787,629 C→G 12.8% intergenic (+76/‑49) ahpC → / → ahpF peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA 2,787,630 C→G 12.8% intergenic (+77/‑48) ahpC → / → ahpF peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA 2,787,636 T→C 13.8% intergenic (+83/‑42) ahpC → / → ahpF peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA 2,799,171 A→G 13.0% intergenic (‑185/+31) PP_2452 ← / ← ansB hypothetical protein/glutaminase‑asparaginase
RA 2,799,177 C→T 12.3% intergenic (‑191/+25) PP_2452 ← / ← ansB hypothetical protein/glutaminase‑asparaginase
RA 2,799,180 A→G 12.0% intergenic (‑194/+22) PP_2452 ← / ← ansB hypothetical protein/glutaminase‑asparaginase
RA 2,799,186 C→T 11.1% intergenic (‑200/+16) PP_2452 ← / ← ansB hypothetical protein/glutaminase‑asparaginase
RA 2,799,301 A→G 8.2% A330A (GCT→GCC) ‡ ansB ← glutaminase‑asparaginase
RA 2,799,302 G→C 8.1% A330G (GCT→GGT) ‡ ansB ← glutaminase‑asparaginase
RA 2,799,303 C→T 7.9% A330T (GCT→ACT) ‡ ansB ← glutaminase‑asparaginase
RA 2,801,973 C→A 5.6% R119R (CGC→CGA)  rbsA‑I → ribose ABC transporter ‑ ATP‑binding subunit
RA 2,801,975 T→G 5.7% F120C (TTC→TGC)  rbsA‑I → ribose ABC transporter ‑ ATP‑binding subunit
RA 2,802,991 A→C 8.5% K459Q (AAG→CAG) ‡ rbsA‑I → ribose ABC transporter ‑ ATP‑binding subunit
RA 2,802,992 A→T 8.5% K459M (AAG→ATG) ‡ rbsA‑I → ribose ABC transporter ‑ ATP‑binding subunit
RA 2,802,993 G→T 8.5% K459N (AAG→AAT) ‡ rbsA‑I → ribose ABC transporter ‑ ATP‑binding subunit
JC 2,837,076 (CATGGTGG)13→1 24.5% intergenic (‑28/+60) sad‑I ← / ← PP_2489 NAD+‑dependent succinate semialdehyde dehydrogenase/xenobiotic reductase
RA 2,844,675 T→C 8.5% intergenic (‑35/+45) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,844,678 A→T 6.9% intergenic (‑38/+42) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,844,679 A→T 6.4% intergenic (‑39/+41) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,844,682 A→T 7.9% intergenic (‑42/+38) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,844,683 A→T 7.0% intergenic (‑43/+37) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,844,686 G→A 7.1% intergenic (‑46/+34) PP_2495 ← / ← PP_2496 hypothetical protein/hypothetical protein
RA 2,868,876 G→C 8.5% intergenic (+415/‑516) PP_2520 → / → PP_2522 hypothetical protein/transposase
RA 2,868,877 G→C 8.5% intergenic (+416/‑515) PP_2520 → / → PP_2522 hypothetical protein/transposase
RA 2,885,718 T→G 7.1% E54A (GAG→GCG)  PP_2541 ← transcriptional factor‑like protein
RA 2,885,724 A→T 7.0% L52Q (CTG→CAG)  PP_2541 ← transcriptional factor‑like protein
RA 2,885,730 C→A 6.9% R50L (CGC→CTC)  PP_2541 ← transcriptional factor‑like protein
RA 2,892,031 G→A 6.6% A246V (GCC→GTC)  PP_2547 ← LysR family transcriptional regulator
RA 2,921,460 G→A 100% G3494R (GGG→AGG)  PP_2561 → hemolysin‑type calcium‑binding bacteriocin
RA 2,941,835 C→T 6.5% R122H (CGT→CAT)  PP_2575 ← hypothetical protein
RA 2,951,334 G→C 9.5% intergenic (‑113/+48) oguA ← / ← PP_2585 8‑oxoguanine deaminase/alpha‑ketoglutaric semialdehyde dehydrogenase
RA 2,958,799 G→C 15.2% intergenic (+65/+77) PP_2589 → / ← PP_2590 aldehyde dehydrogenase family protein/ferric siderophore receptor
RA 2,973,809 A→G 7.5% L22P (CTG→CCG)  PP_2600 ← hypothetical protein
RA 2,973,811 C→G 8.9% G21G (GGG→GGC) ‡ PP_2600 ← hypothetical protein
RA 2,973,813 C→T 8.0% G21R (GGG→AGG) ‡ PP_2600 ← hypothetical protein
RA 2,985,345 G→A 6.9% S20F (TCC→TTC)  PP_2611 ← membrane protein
RA 3,004,819 A→G 7.2% H467R (CAC→CGC)  PP_2627 → membrane protein
RA 3,019,936 T→A 8.6% N158K (AAT→AAA)  PP_2638 → cellulose synthase operon protein C
RA 3,023,034 G→A 7.7% intergenic (+53/‑285) PP_2638 → / → dapA‑II cellulose synthase operon protein C/4‑hydroxy‑tetrahydrodipicolinate synthase
RA 3,025,532 G→A 8.0% V368V (GTC→GTT)  PP_2641 ← iron‑sulfur cluster‑binding protein
RA 3,030,719 C→T 8.6% P9L (CCG→CTG)  mgtA → ATP‑dependent magnesium transporter
RA 3,030,722 A→G 8.4% Q10R (CAG→CGG)  mgtA → ATP‑dependent magnesium transporter
RA 3,043,569 C→A 10.5% D76E (GAC→GAA)  pstS → phosphate ABC transporter substrate‑binding protein
RA 3,043,570 T→G 10.9% F77V (TTC→GTC)  pstS → phosphate ABC transporter substrate‑binding protein
RA 3,048,604 G→T 12.5% intergenic (+59/‑237) PP_2661 → / → PP_2662 hypothetical protein/hypothetical protein
RA 3,048,605 A→C 12.5% intergenic (+60/‑236) PP_2661 → / → PP_2662 hypothetical protein/hypothetical protein
RA 3,065,902 G→C 8.7% G12G (GGG→GGC)  PP_2678 → hydrolase
RA 3,065,904 T→G 8.5% L13R (CTG→CGG)  PP_2678 → hydrolase
RA 3,065,907 C→A 8.5% P14Q (CCG→CAG)  PP_2678 → hydrolase
RA 3,065,909 G→C 8.2% A15P (GCC→CCC)  PP_2678 → hydrolase
RA 3,067,430 G→T 7.5% A157S (GCC→TCC)  qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,433 C→T 8.1% L158L (CTG→TTG)  qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,436 A→T 8.3% N159Y (AAC→TAC) ‡ qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,437 A→T 8.3% N159I (AAC→ATC) ‡ qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,440 A→G 8.1% K160R (AAG→AGG)  qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,443 A→C 8.5% D161A (GAC→GCC)  qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,067,448 G→A 7.4% G163S (GGC→AGC)  qedH‑II → quinoprotein ethanol dehydrogenase
RA 3,079,889 G→A 11.1% A61V (GCC→GTC)  PP_2689 ← endoribonuclease
RA 3,104,368 T→G 5.8% V299G (GTC→GGC)  PP_2714 → sensor histidine kinase
RA 3,105,532 Δ1 bp 7.4% coding (20/702 nt) arsH ← ArsH protein
RA 3,105,669 G→C 12.0% L123V (CTG→GTG)  PP_2716 ← arsenate reductase
RA 3,105,670 T→A 11.2% T122T (ACA→ACT) ‡ PP_2716 ← arsenate reductase
RA 3,105,671 G→C 11.9% T122R (ACA→AGA) ‡ PP_2716 ← arsenate reductase
RA 3,112,856 A→T 8.0% L97L (CTT→CTA) ‡ PP_2727 ← C factor cell‑cell signaling protein
RA 3,112,857 A→G 8.2% L97P (CTT→CCT) ‡ PP_2727 ← C factor cell‑cell signaling protein
RA 3,131,465 C→T 6.4% S115L (TCG→TTG)  PP_2748 → ABC transporter ATP‑binding protein
RA 3,136,826 G→A 8.9% V10I (GTC→ATC)  PP_2753 → ABC transporter ATP‑binding protein
RA 3,144,909 T→C 10.3% V106A (GTT→GCT)  PP_2760 → ribose ABC transporter permease
RA 3,144,912 T→A 6.9% V107D (GTC→GAC)  PP_2760 → ribose ABC transporter permease
RA 3,144,915 G→A 9.8% S108N (AGC→AAC)  PP_2760 → ribose ABC transporter permease
RA 3,165,136 T→G 7.3% V216G (GTT→GGT)  PP_2779 → putative Beta‑ketoacyl synthase
RA 3,183,329 A→C 6.0% E330A (GAG→GCG)  PP_2793 → acyl‑CoA dehydrogenase family protein
RA 3,188,086 A→T 6.3% intergenic (+43/+219) actP‑II → / ← PP_2798 acetate permease/oxidoreductase
RA 3,212,278 A→T 10.1% *189R (TGA→AGA)  PP_2816 ← transcriptional regulator NfxB
RA 3,228,100 C→G 6.0% R313R (CGC→CGG)  PP_2828 → hypothetical protein
RA 3,228,103 C→G 6.0% A314A (GCC→GCG)  PP_2828 → hypothetical protein
RA 3,243,222 G→A 5.9% P433P (CCG→CCA)  PP_2839 → hypothetical protein
RA 3,250,655 C→G 6.9% L14V (CTG→GTG)  ureJ → urease accessory protein UreJ
RA 3,254,420 C→A 9.9% G440C (GGC→TGC)  PP_2852 ← sulfatase domain‑containing protein
RA 3,268,052 C→A 5.9% H175N (CAC→AAC) ‡ azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,268,054 C→A 5.7% H175Q (CAC→CAA) ‡ azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,268,059 T→A 5.9% L177Q (CTG→CAG)  azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,268,064 T→G 5.9% Y179D (TAT→GAT) ‡ azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,268,065 A→T 5.5% Y179F (TAT→TTT) ‡ azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,268,066 T→G 5.5% Y179* (TAT→TAG) ‡ azoR1 → FMN‑dependent NADH‑azoreductase
RA 3,273,641 G→C 9.1% G106A (GGC→GCC)  PP_2871 → class II aldolase/adducin domain‑containing protein
RA 3,316,910 G→C 7.3% intergenic (‑113/+60) ribC ← / ← treSA riboflavin synthase/trehalose synthase A
RA 3,316,912 G→C 7.6% intergenic (‑115/+58) ribC ← / ← treSA riboflavin synthase/trehalose synthase A
RA 3,316,914 G→C 7.4% intergenic (‑117/+56) ribC ← / ← treSA riboflavin synthase/trehalose synthase A
RA 3,318,911 G→C 7.0% A42A (GCC→GCG)  treSA ← trehalose synthase A
RA 3,320,330 G→C 6.9% G22A (GGC→GCC)  ybgL → nitrogen‑containing compound degradation protein
RA 3,324,425 T→C 9.0% T237A (ACC→GCC)  PP_2924 ← hypothetical protein
RA 3,324,428 T→C 9.3% S236G (AGC→GGC)  PP_2924 ← hypothetical protein
RA 3,324,435 G→A 9.0% G233G (GGC→GGT)  PP_2924 ← hypothetical protein
RA 3,349,185 A→G 7.7% N498S (AAC→AGC) ‡ PP_2944 → sensor histidine kinase
RA 3,349,186 C→G 7.8% N498K (AAC→AAG) ‡ PP_2944 → sensor histidine kinase
RA 3,349,187 C→T 7.8% L499L (CTG→TTG)  PP_2944 → sensor histidine kinase
RA 3,376,435 Δ1 bp 9.5% intergenic (+10/‑138) PP_2975 → / → PP_2976 insertion element ISR1 protein A3/transposase
RA 3,376,439 G→C 9.5% intergenic (+14/‑134) PP_2975 → / → PP_2976 insertion element ISR1 protein A3/transposase
RA 3,376,442:1 +T 9.5% intergenic (+17/‑131) PP_2975 → / → PP_2976 insertion element ISR1 protein A3/transposase
RA 3,376,949 A→T 7.5% noncoding (111/117 nt)
Q23H (CAA→CAT) 
PP_mr38 →
tnpB →
ALIL regulatory region
transposase subunit B
RA 3,394,820 C→G 5.8% H107Q (CAC→CAG)  PP_2998 → 2‑dehydropantoate 2‑reductase
RA 3,394,823 G→T 5.3% E108D (GAG→GAT)  PP_2998 → 2‑dehydropantoate 2‑reductase
RA 3,394,825 A→T 5.2% D109V (GAC→GTC)  PP_2998 → 2‑dehydropantoate 2‑reductase
RA 3,394,827 A→C 5.3% I110L (ATC→CTC)  PP_2998 → 2‑dehydropantoate 2‑reductase
RA 3,409,918 G→T 7.7% intergenic (‑484/‑52) PP_3022 ← / → PP_3024 AraC family transcriptional regulator/hypothetical protein
RA 3,409,921 G→C 6.7% intergenic (‑487/‑49) PP_3022 ← / → PP_3024 AraC family transcriptional regulator/hypothetical protein
RA 3,409,923 C→G 6.7% intergenic (‑489/‑47) PP_3022 ← / → PP_3024 AraC family transcriptional regulator/hypothetical protein
RA 3,409,925 G→C 6.7% intergenic (‑491/‑45) PP_3022 ← / → PP_3024 AraC family transcriptional regulator/hypothetical protein
RA 3,409,928 A→C 7.6% intergenic (‑494/‑42) PP_3022 ← / → PP_3024 AraC family transcriptional regulator/hypothetical protein
RA 3,416,097 A→C 7.3% S382A (TCG→GCG)  PP_3029 ← DNA cytosine methyltransferase family protein
RA 3,422,165 C→T 6.8% A108V (GCG→GTG)  PP_3038 → TraC domain‑containing protein
RA 3,440,625 A→T 7.3% E123V (GAG→GTG)  PP_3060 → tail sheath protein
RA 3,440,629 G→T 6.4% L124L (CTG→CTT)  PP_3060 → tail sheath protein
RA 3,440,630 A→C 6.0% K125Q (AAG→CAG)  PP_3060 → tail sheath protein
RA 3,455,168 G→A 7.8% N241N (AAC→AAT)  aacs ← acetoacetyl‑CoA synthetase
RA 3,463,450 C→A 6.0% G303V (GGC→GTC)  PP_3078 ← ABC transporter substrate‑binding protein
RA 3,463,544 G→C 7.9% L272V (CTG→GTG)  PP_3078 ← ABC transporter substrate‑binding protein
RA 3,463,547 C→G 7.9% D271H (GAC→CAC)  PP_3078 ← ABC transporter substrate‑binding protein
RA 3,463,550 G→C 7.7% R270G (CGT→GGT)  PP_3078 ← ABC transporter substrate‑binding protein
RA 3,466,055 G→C 8.3% noncoding (105/119 nt) PP_mr39 ← P15 ncRNA
RA 3,466,056 A→T 8.0% noncoding (104/119 nt) PP_mr39 ← P15 ncRNA
RA 3,466,057 A→T 8.0% noncoding (103/119 nt) PP_mr39 ← P15 ncRNA
RA 3,466,058 G→C 8.1% noncoding (102/119 nt) PP_mr39 ← P15 ncRNA
RA 3,470,058 C→A 5.7% intergenic (+119/+14) PP_3083 → / ← PP_3084 membrane protein/ferric siderophore receptor
RA 3,470,060 C→G 5.9% intergenic (+121/+12) PP_3083 → / ← PP_3084 membrane protein/ferric siderophore receptor
RA 3,470,062 T→G 6.0% intergenic (+123/+10) PP_3083 → / ← PP_3084 membrane protein/ferric siderophore receptor
RA 3,483,010 A→C 5.5% S972A (TCG→GCG)  PP_3091 ← membrane protein
RA 3,483,011 G→T 6.0% R971R (CGC→CGA)  PP_3091 ← membrane protein
RA 3,483,015 T→A 5.8% Q970L (CAG→CTG)  PP_3091 ← membrane protein
RA 3,483,798 G→C 5.5% P709R (CCG→CGG)  PP_3091 ← membrane protein
RA 3,486,941 G→T 7.7% P357H (CCC→CAC)  PP_3093 ← hypothetical protein
RA 3,493,652 A→C 5.7% L184R (CTG→CGG)  PP_3097 ← hypothetical protein
RA 3,494,816 T→C 6.9% P466P (CCA→CCG)  puuD ← uricase/urate oxidase
RA 3,494,821 T→A 7.4% K465* (AAG→TAG)  puuD ← uricase/urate oxidase
RA 3,494,825 G→A 6.2% P463P (CCC→CCT)  puuD ← uricase/urate oxidase
RA 3,534,777 C→A 8.0% intergenic (+64/‑91) atoB → / → PP_3124 3‑oxoacid CoA‑transferase subunit B/short chain fatty acid transporter
RA 3,534,793 G→A 9.7% intergenic (+80/‑75) atoB → / → PP_3124 3‑oxoacid CoA‑transferase subunit B/short chain fatty acid transporter
RA 3,536,544 C→G 7.1% A61G (GCC→GGC)  PP_3125 → Cro/CI family transcriptional regulator
RA 3,553,793 C→T 7.8% R154C (CGC→TGC)  PP_3138 → VirK domain‑containing protein
RA 3,553,796 A→G 7.8% S155G (AGC→GGC)  PP_3138 → VirK domain‑containing protein
RA 3,553,797:1 +C 7.7% coding (464/1002 nt) PP_3138 → VirK domain‑containing protein
RA 3,554,063 A→T 9.2% I244F (ATC→TTC)  PP_3138 → VirK domain‑containing protein
RA 3,554,067 G→T 9.8% W245L (TGG→TTG)  PP_3138 → VirK domain‑containing protein
RA 3,554,070 A→C 9.6% Q246P (CAA→CCA)  PP_3138 → VirK domain‑containing protein
RA 3,564,987 A→T 8.9% intergenic (‑62/+19) potF‑II ← / ← PP_3148 putrescine‑binding protein/glutamine synthetase
RA 3,591,576 T→A 16.1% L258M (TTG→ATG) ‡ PP_3169 → membrane protein
RA 3,591,577 T→A 16.1% L258* (TTG→TAG) ‡ PP_3169 → membrane protein
RA 3,609,520 C→T 7.5% G238D (GGC→GAC)  PP_3183 ← SCO1/SenC family protein
RA 3,624,250 T→A 6.4% E413V (GAA→GTA)  PP_3195 ← hypothetical protein
RA 3,638,656 T→G 9.4% L218V (TTG→GTG)  PP_3205 → fumarylacetoacetate hydrolase family protein
RA 3,638,660 C→A 11.6% P219Q (CCG→CAG)  PP_3205 → fumarylacetoacetate hydrolase family protein
RA 3,638,663 T→G 9.3% L220R (CTG→CGG)  PP_3205 → fumarylacetoacetate hydrolase family protein
RA 3,638,667 C→A 9.3% H221Q (CAC→CAA)  PP_3205 → fumarylacetoacetate hydrolase family protein
RA 3,638,708 G→C 7.4% G235A (GGC→GCC)  PP_3205 → fumarylacetoacetate hydrolase family protein
RA 3,645,902 A→T 7.0% L32Q (CTG→CAG)  PP_3212 ← Rieske 2Fe‑2S family protein
RA 3,645,905 A→T 7.0% L31Q (CTG→CAG)  PP_3212 ← Rieske 2Fe‑2S family protein
RA 3,695,938 A→G 6.4% V77A (GTG→GCG)  ligD ← DNA ligase D
RA 3,695,944 A→T 6.0% L75Q (CTG→CAG)  ligD ← DNA ligase D
RA 3,695,950 C→T 6.2% R73H (CGC→CAC)  ligD ← DNA ligase D
RA 3,697,445 C→G 5.6% S15T (AGC→ACC)  PP_5595 ← hypothetical protein
RA 3,713,824 A→G 5.8% I230I (ATT→ATC)  paaK ← phenylacetate‑CoA ligase
RA 3,718,081 A→G 6.7% L171P (CTT→CCT)  paaG ← 2‑(1,2‑epoxy‑1,2‑dihydrophenyl)acetyl‑CoA isomerase
RA 3,722,804 T→A 8.6% Y21N (TAT→AAT) ‡ PP_3288 → universal stress protein family protein
RA 3,722,805 A→T 8.3% Y21F (TAT→TTT) ‡ PP_3288 → universal stress protein family protein
RA 3,722,806 T→A 8.5% Y21* (TAT→TAA) ‡ PP_3288 → universal stress protein family protein
RA 3,723,022 G→A 8.0% V93V (GTG→GTA)  PP_3288 → universal stress protein family protein
RA 3,735,139 Δ1 bp 10.8% coding (36/3093 nt) PP_3302 → RND family transporter
RA 3,735,143:1 +T 11.8% coding (40/3093 nt) PP_3302 → RND family transporter
RA 3,741,959 A→T 5.8% intergenic (‑27/+386) PP_3305 ← / ← PP_3306 TerC family membrane protein/hypothetical protein
RA 3,741,960 A→T 5.8% intergenic (‑28/+385) PP_3305 ← / ← PP_3306 TerC family membrane protein/hypothetical protein
RA 3,741,967 T→C 5.9% intergenic (‑35/+378) PP_3305 ← / ← PP_3306 TerC family membrane protein/hypothetical protein
RA 3,748,871 G→T 6.2% intergenic (‑111/+84) kefB‑II ← / ← PP_3312 glutathione‑regulated potassium/H+ antiporter/heat shock protein
RA 3,748,874 A→C 6.2% intergenic (‑114/+81) kefB‑II ← / ← PP_3312 glutathione‑regulated potassium/H+ antiporter/heat shock protein
RA 3,758,946 G→A 6.8% D71N (GAC→AAC)  PP_3323 → CobW/P47K family protein
RA 3,766,151 G→T 5.7% R161L (CGA→CTA) ‡ PP_5599 → LysR family transcriptional regulator
RA 3,766,152 A→C 5.8% R161R (CGA→CGC) ‡ PP_5599 → LysR family transcriptional regulator
RA 3,766,716 G→C 11.2% R50P (CGT→CCT) ‡ PP_3329 → membrane protein
RA 3,766,717 T→G 9.8% R50R (CGT→CGG) ‡ PP_3329 → membrane protein
RA 3,766,720 C→A 10.0% I51I (ATC→ATA)  PP_3329 → membrane protein
RA 3,766,721 G→C 10.0% G52R (GGT→CGT)  PP_3329 → membrane protein
RA 3,775,321 C→A 8.0% M52I (ATG→ATT) ‡ PP_3336 ← hypothetical protein
RA 3,775,322 A→T 7.9% M52K (ATG→AAG) ‡ PP_3336 ← hypothetical protein
RA 3,775,325 G→C 7.9% P51R (CCC→CGC) ‡ PP_3336 ← hypothetical protein
RA 3,775,326 G→C 7.9% P51A (CCC→GCC) ‡ PP_3336 ← hypothetical protein
RA 3,775,329 A→T 7.8% L50M (TTG→ATG)  PP_3336 ← hypothetical protein
RA 3,775,330 T→G 7.5% A49A (GCA→GCC)  PP_3336 ← hypothetical protein
RA 3,786,016 C→T 7.5% R398H (CGC→CAC)  mhpT ← 3‑(3‑hydroxy‑phenyl)propionate transporter MhpT
JC 3,787,938 (TCCACGACGCCGACAGCGGCAAGGTGCCGTA)1→2 83.4% coding (697/1392 nt) PP_3350 ← hypothetical protein
RA 3,812,883 T→G 6.5% intergenic (+22/‑41) PP_3368 → / → PP_3369 MFS transporter/LysR family transcriptional regulator
RA 3,812,994 A→T 7.4% K24M (AAG→ATG)  PP_3369 → LysR family transcriptional regulator
RA 3,816,188 G→A 6.5% G211G (GGC→GGT)  cpxR ← two‑component system regulator CpxR
RA 3,834,352 C→G 6.3% V339V (GTC→GTG)  vgrG‑II → type VI secretion system protein
RA 3,834,354 G→C 6.2% S340T (AGC→ACC)  vgrG‑II → type VI secretion system protein
RA 3,840,286 A→G 10.3% D411D (GAT→GAC) ‡ PP_3390 ← porin
RA 3,840,288 C→T 7.6% D411N (GAT→AAT) ‡ PP_3390 ← porin
RA 3,845,703:1 +G 100% intergenic (‑70/+28) PP_3394 ← / ← PP_3395 3‑hydroxy‑3‑methylglutaryl‑CoA lyase/LysR family transcriptional regulator
RA 3,845,927 C→T 6.8% G257D (GGC→GAC)  PP_3395 ← LysR family transcriptional regulator
RA 3,853,118 T→A 28.3% I169N (ATT→AAT)  alkB → alpha‑ketoglutarate‑ and Fe(II)‑dependent dioxygenase
RA 3,865,278 G→C 8.2% R123G (CGG→GGG)  PP_3414 ← methyl‑accepting chemotaxis transducer/sensory box protein
RA 3,865,284 C→G 8.4% E121Q (GAG→CAG)  PP_3414 ← methyl‑accepting chemotaxis transducer/sensory box protein
RA 3,865,286 T→A 8.3% D120V (GAC→GTC)  PP_3414 ← methyl‑accepting chemotaxis transducer/sensory box protein
RA 3,865,288 C→G 9.8% L119L (CTG→CTC)  PP_3414 ← methyl‑accepting chemotaxis transducer/sensory box protein
RA 3,880,375 C→G 6.7% A737G (GCC→GGC)  mexF → multidrug RND transporter MexF
RA 3,880,378 C→G 6.7% A738G (GCC→GGC)  mexF → multidrug RND transporter MexF
RA 3,892,916 C→A 7.3% L94M (CTG→ATG)  rarD → chloramphenicol‑sensitive protein
RA 3,892,921 T→G 7.4% H95Q (CAT→CAG)  rarD → chloramphenicol‑sensitive protein
RA 3,896,083 T→G 5.5% Q221P (CAG→CCG)  PP_3439 ← AraC family transcriptional regulator
RA 3,897,761 A→G 7.7% I50I (ATT→ATC)  PP_3440 ← hypothetical protein
RA 3,900,119 T→G 5.8% L176R (CTG→CGG)  PP_3443 → glyceraldehyde‑3‑phosphate dehydrogenase
RA 3,914,433 G→C 9.5% R118R (CGC→CGG)  PP_3454 ← transcriptional regulator
RA 3,935,077 T→A 6.1% E112D (GAA→GAT)  PP_3467 ← sigma‑54 dependent transcriptional regulator
RA 3,949,101:1 +A 6.9% coding (433/642 nt) PP_3485 ← hypothetical protein
RA 3,949,108 Δ1 bp 6.7% coding (426/642 nt) PP_3485 ← hypothetical protein
RA 3,949,113 T→C 6.6% S141G (AGC→GGC)  PP_3485 ← hypothetical protein
RA 3,949,602 G→C 7.2% P479A (CCC→GCC)  PP_3486 ← cytochrome c
RA 3,949,604 A→C 6.1% L478R (CTG→CGG)  PP_3486 ← cytochrome c
RA 3,951,159 T→C 100% intergenic (‑123/+72) PP_3486 ← / ← PP_3487 cytochrome c/hypothetical protein
RA 3,951,161 A→T 100% intergenic (‑125/+70) PP_3486 ← / ← PP_3487 cytochrome c/hypothetical protein
RA 3,953,931:1 +G 5.1% coding (592/1977 nt) PP_5606 ← YVTN beta‑propeller repeat‑containing protein
RA 3,982,835 G→T 6.8% G118G (GGG→GGT)  PP_3510 → hypothetical protein
RA 3,982,838 T→A 7.2% H119Q (CAT→CAA)  PP_3510 → hypothetical protein
RA 3,982,841 A→C 7.0% *120C (TGA→TGC)  PP_3510 → hypothetical protein
RA 3,984,040 G→T 7.8% intergenic (+34/+156) ilvE → / ← PP_3512 branched‑chain‑amino acid aminotransferase/membrane protein
RA 3,984,041 C→T 7.5% intergenic (+35/+155) ilvE → / ← PP_3512 branched‑chain‑amino acid aminotransferase/membrane protein
RA 3,984,042 A→G 7.7% intergenic (+36/+154) ilvE → / ← PP_3512 branched‑chain‑amino acid aminotransferase/membrane protein
RA 3,984,043 A→C 7.7% intergenic (+37/+153) ilvE → / ← PP_3512 branched‑chain‑amino acid aminotransferase/membrane protein
RA 3,996,897 G→T 5.1% P89H (CCT→CAT)  PP_3525 ← hypothetical protein
RA 3,996,900 A→C 5.3% M88R (ATG→AGG)  PP_3525 ← hypothetical protein
JC 4,022,908 +AGCGAG 42.2% intergenic (‑603/+65) PP_3547 ← / ← emrB NAD(P)‑binding oxidoreductase/multidrug transporter permease
RA 4,027,829 C→A 9.7% A201S (GCC→TCC)  PP_3552 ← two‑component system sensor histidine kinase
RA 4,042,321 C→A 7.4% L137I (CTC→ATC) ‡ PP_3563 → hypothetical protein
RA 4,042,322 T→G 6.8% L137R (CTC→CGC) ‡ PP_3563 → hypothetical protein
RA 4,045,934 C→A 7.7% Q262H (CAG→CAT) ‡ PP_3567 ← LysR family transcriptional regulator
RA 4,045,935 T→G 6.1% Q262P (CAG→CCG) ‡ PP_3567 ← LysR family transcriptional regulator
RA 4,049,907 A→G 26.6% intergenic (+40/‑61) quiA → / → oprB‑III quinate dehydrogenase/carbohydrate‑selective porin
RA 4,054,949 A→G 5.1% Q60Q (CAA→CAG)  PP_3574 → hypothetical protein
RA 4,057,759 C→T 7.1% V305V (GTG→GTA)  PP_3576 ← transmembrane sensor
RA 4,061,390 C→A 5.9% L107M (CTG→ATG) ‡ PP_3579 → membrane protein
RA 4,061,391 T→G 5.3% L107R (CTG→CGG) ‡ PP_3579 → membrane protein
RA 4,066,001 A→C 7.9% R1021R (CGT→CGG)  mdtC ← multidrug transporter membrane protein
RA 4,066,004 G→T 7.7% N1020K (AAC→AAA)  mdtC ← multidrug transporter membrane protein
RA 4,066,007 G→C 8.0% F1019L (TTC→TTG)  mdtC ← multidrug transporter membrane protein
RA 4,066,010 A→C 8.0% R1018R (CGT→CGG)  mdtC ← multidrug transporter membrane protein
RA 4,066,013 G→T 7.5% H1017Q (CAC→CAA)  mdtC ← multidrug transporter membrane protein
RA 4,080,866 G→T 5.9% intergenic (‑90/+73) amaC ← / ← dpkA D‑lysine aminotransferase/delta 1‑piperideine‑2‑carboxylate reductase
RA 4,083,051 G→C 6.2% G17A (GGT→GCT)  PP_3593 → amino acid ABC transporter substrate‑binding protein
RA 4,083,053 G→C 6.4% A18P (GCC→CCC)  PP_3593 → amino acid ABC transporter substrate‑binding protein
RA 4,113,568 C→T 6.4% T71I (ACC→ATC)  PP_3619 → hypothetical protein
RA 4,131,110 T→A 7.2% intergenic (+22/+90) PP_3634 → / ← PP_3635 GNAT family acetyltransferase/sulfonate ABC transporter permease
RA 4,131,111 T→A 8.0% intergenic (+23/+89) PP_3634 → / ← PP_3635 GNAT family acetyltransferase/sulfonate ABC transporter permease
RA 4,133,525 G→A 7.0% T148T (ACC→ACT) ‡ PP_3637 ← sulfonate ABC transporter ATP‑binding protein
RA 4,133,526 G→C 6.9% T148S (ACC→AGC) ‡ PP_3637 ← sulfonate ABC transporter ATP‑binding protein
RA 4,133,527 T→C 6.9% T148A (ACC→GCC) ‡ PP_3637 ← sulfonate ABC transporter ATP‑binding protein
RA 4,138,575 A→C 8.1% D25A (GAC→GCC)  PP_3643 → oxidoreductase
RA 4,138,583 G→C 11.3% G28R (GGC→CGC) ‡ PP_3643 → oxidoreductase
RA 4,138,585 C→A 12.3% G28G (GGC→GGA) ‡ PP_3643 → oxidoreductase
RA 4,138,586 T→G 12.9% S29A (TCG→GCG) ‡ PP_3643 → oxidoreductase
RA 4,138,588 G→C 13.1% S29S (TCG→TCC) ‡ PP_3643 → oxidoreductase
RA 4,138,596 G→T 11.5% G32V (GGC→GTC)  PP_3643 → oxidoreductase
RA 4,143,612 T→G 7.4% F84C (TTC→TGC)  PP_3647 → oxidoreductase
RA 4,143,615 C→A 7.1% A85E (GCA→GAA)  PP_3647 → oxidoreductase
RA 4,150,023 C→T 11.5% intergenic (+22/‑375) PP_3654 → / → PP_3655 leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
RA 4,163,502 T→G 8.5% intergenic (‑41/‑141) pssA ← / → PP_3665 CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA 4,163,505 C→A 9.0% intergenic (‑44/‑138) pssA ← / → PP_3665 CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA 4,163,509 G→A 7.6% intergenic (‑48/‑134) pssA ← / → PP_3665 CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA 4,166,192 G→T 8.6% intergenic (‑91/+72) PP_3666 ← / ← creA MHS family metabolite MFS transporter/creatinase
RA 4,166,193 A→C 8.5% intergenic (‑92/+71) PP_3666 ← / ← creA MHS family metabolite MFS transporter/creatinase
RA 4,196,284 C→A 7.9% intergenic (+126/+243) PP_5618 → / ← PP_5619 Cro/CI family transcriptional regulator/hypothetical protein
RA 4,196,292 G→A 8.4% intergenic (+134/+235) PP_5618 → / ← PP_5619 Cro/CI family transcriptional regulator/hypothetical protein
RA 4,196,293 G→C 8.5% intergenic (+135/+234) PP_5618 → / ← PP_5619 Cro/CI family transcriptional regulator/hypothetical protein
RA 4,196,294 T→C 8.4% intergenic (+136/+233) PP_5618 → / ← PP_5619 Cro/CI family transcriptional regulator/hypothetical protein
RA 4,196,302 T→G 8.7% intergenic (+144/+225) PP_5618 → / ← PP_5619 Cro/CI family transcriptional regulator/hypothetical protein
RA 4,207,035 G→T 8.2% C247* (TGC→TGA)  PP_3691 ← DNA helicase‑related protein
RA 4,210,754 T→G 6.4% intergenic (+31/+38) PP_3692 → / ← PP_5621 hypothetical protein/hypothetical protein
RA 4,210,755 C→T 6.3% intergenic (+32/+37) PP_3692 → / ← PP_5621 hypothetical protein/hypothetical protein
RA 4,210,756 A→T 6.3% intergenic (+33/+36) PP_3692 → / ← PP_5621 hypothetical protein/hypothetical protein
RA 4,210,758 C→A 6.1% intergenic (+35/+34) PP_3692 → / ← PP_5621 hypothetical protein/hypothetical protein
RA 4,224,495 G→A 7.8% intergenic (‑607/+214) PP_3703 ← / ← PP_3704 hypothetical protein/hypothetical protein
RA 4,236,545 A→T 7.3% A76A (GCT→GCA)  catA‑I ← catechol 1,2‑dioxygenase
RA 4,236,548 A→T 7.3% A75A (GCT→GCA) ‡ catA‑I ← catechol 1,2‑dioxygenase
RA 4,236,550 C→G 7.4% A75P (GCT→CCT) ‡ catA‑I ← catechol 1,2‑dioxygenase
RA 4,240,242 T→G 7.1% R16S (AGA→AGC)  PP_3717 ← LuxR family transcriptional regulator
RA 4,240,247 C→A 6.8% A15S (GCT→TCT)  PP_3717 ← LuxR family transcriptional regulator
RA 4,246,185 C→G 8.1% M30I (ATG→ATC)  alr ← alanine racemase
RA 4,246,188 C→G 6.5% S29S (TCG→TCC)  alr ← alanine racemase
RA 4,252,190 A→G 8.4% intergenic (‑158/+82) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,194 C→A 5.6% intergenic (‑162/+78) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,197 A→G 6.8% intergenic (‑165/+75) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,202 G→C 6.9% intergenic (‑170/+70) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,205 G→C 6.9% intergenic (‑173/+67) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,210 C→T 7.0% intergenic (‑178/+62) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,213 T→G 6.4% intergenic (‑181/+59) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,252,217 C→T 7.1% intergenic (‑185/+55) PP_3726 ← / ← rocE enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA 4,271,005 T→C 7.3% I382T (ATC→ACC)  mrdA‑I → transpeptidase
RA 4,278,028 G→C 7.0% A66P (GCA→CCA)  glcG → hypothetical protein
RA 4,282,382 A→G 5.7% V283A (GTG→GCG)  PP_3753 ← AraC family transcriptional regulator
RA 4,289,430 T→G 7.5% K1053Q (AAG→CAG)  PP_3761 ← two‑component system sensor histidine kinase/response regulator
RA 4,289,432 T→A 7.7% H1052L (CAC→CTC)  PP_3761 ← two‑component system sensor histidine kinase/response regulator
RA 4,289,435 T→A 7.7% E1051V (GAG→GTG)  PP_3761 ← two‑component system sensor histidine kinase/response regulator
RA 4,289,437 C→A 7.7% L1050L (CTG→CTT)  PP_3761 ← two‑component system sensor histidine kinase/response regulator
RA 4,327,519 T→C 5.9% S163P (TCG→CCG)  PP_3797 → membrane protein
RA 4,340,075 A→T 41.4% intergenic (+60/‑271) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,076 G→C 43.0% intergenic (+61/‑270) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,081 A→G 40.0% intergenic (+66/‑265) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,082 C→T 40.0% intergenic (+67/‑264) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,083 A→G 40.8% intergenic (+68/‑263) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,084 C→T 40.0% intergenic (+69/‑262) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,089 G→C 34.3% intergenic (+74/‑257) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,340,090 A→T 33.6% intergenic (+75/‑256) ribAB‑II → / → PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA 4,346,529 A→G 6.9% L188P (CTG→CCG)  gor ← glutathione reductase
RA 4,348,705 A→G 52.3% intergenic (‑70/+404) PP_3820 ← / ← galU group II intron‑encoding maturase/UTP‑glucose‑1‑phosphate uridylyltransferase
RA 4,357,746 T→C 12.1% intergenic (+92/‑162) PP_3831 → / → PP_3832 hypothetical protein/CsrA‑like carbon storage regulator
RA 4,357,747 G→A 8.8% intergenic (+93/‑161) PP_3831 → / → PP_3832 hypothetical protein/CsrA‑like carbon storage regulator
RA 4,377,197 C→T 7.5% R125R (CGG→CGA)  PP_3852 ← BNR domain‑containing protein
RA 4,385,286 G→T 6.3% P84T (CCA→ACA)  PP_3860 ← FluMu protein gp47
RA 4,385,288 A→C 7.4% V83G (GTT→GGT)  PP_3860 ← FluMu protein gp47
RA 4,395,520 T→C 6.3% D85G (GAC→GGC)  PP_3871 ← hypothetical protein
RA 4,399,270 Δ1 bp 8.2% coding (620/972 nt) PP_3878 ← minor capsid protein C
RA 4,405,314 C→T 10.0% G83R (GGG→AGG)  PP_3886 ← hypothetical protein
RA 4,405,320 T→C 9.8% M81V (ATG→GTG)  PP_3886 ← hypothetical protein
RA 4,405,321 G→A 10.0% H80H (CAC→CAT)  PP_3886 ← hypothetical protein
RA 4,405,327 A→G 7.8% P78P (CCT→CCC)  PP_3886 ← hypothetical protein
RA 4,425,139 G→C 6.3% intergenic (‑197/‑603) PP_5647 ← / → PP_3917 hypothetical protein/hypothetical protein
RA 4,425,141 G→C 6.7% intergenic (‑199/‑601) PP_5647 ← / → PP_3917 hypothetical protein/hypothetical protein
RA 4,425,143 G→C 6.9% intergenic (‑201/‑599) PP_5647 ← / → PP_3917 hypothetical protein/hypothetical protein
RA 4,425,312 T→A 6.4% intergenic (‑370/‑430) PP_5647 ← / → PP_3917 hypothetical protein/hypothetical protein
RA 4,439,785 T→G 8.6% L232R (CTC→CGC) ‡ PP_3934 → LysR family transcriptional regulator
RA 4,439,786 C→G 8.7% L232L (CTC→CTG) ‡ PP_3934 → LysR family transcriptional regulator
RA 4,439,787 C→A 8.4% R233S (CGC→AGC)  PP_3934 → LysR family transcriptional regulator
RA 4,442,628 C→G 9.2% intergenic (‑98/+40) nicP‑II ← / ← nicT porin‑like protein/metabolite transport protein NicT
RA 4,442,629 C→G 9.2% intergenic (‑99/+39) nicP‑II ← / ← nicT porin‑like protein/metabolite transport protein NicT
RA 4,447,843 C→G 7.4% intergenic (‑279/‑43) nicC ← / → nicX 6‑hydroxynicotinate 3‑monooxygenase/2,5‑dihydroxypyridine 5,6‑dioxygenase
RA 4,447,848 Δ1 bp 7.4% intergenic (‑284/‑38) nicC ← / → nicX 6‑hydroxynicotinate 3‑monooxygenase/2,5‑dihydroxypyridine 5,6‑dioxygenase
RA 4,477,813 T→G 8.5% Q60P (CAG→CCG) ‡ PP_3968 ← sensor histidine kinase
RA 4,477,814 G→C 8.3% Q60E (CAG→GAG) ‡ PP_3968 ← sensor histidine kinase
RA 4,477,817 G→C 8.4% H59D (CAT→GAT)  PP_3968 ← sensor histidine kinase
RA 4,477,818 C→A 8.9% A58A (GCG→GCT)  PP_3968 ← sensor histidine kinase
RA 4,478,868 G→C 9.0% V73V (GTG→GTC)  ybdR → Zn‑dependent oxidoreductase
RA 4,488,991 A→G 8.2% intergenic (+344/+227) PP_3981 → / ← PP_3982 transposase/hypothetical protein
RA 4,488,992 C→G 8.1% intergenic (+345/+226) PP_3981 → / ← PP_3982 transposase/hypothetical protein
RA 4,488,993 C→T 8.0% intergenic (+346/+225) PP_3981 → / ← PP_3982 transposase/hypothetical protein
RA 4,502,922 C→G 5.1% A184G (GCC→GGC)  xanP → xanthine permease
RA 4,502,924 A→C 5.1% N185H (AAT→CAT)  xanP → xanthine permease
RA 4,503,789 C→T 15.3% intergenic (+38/‑60) xanP → / → tusD xanthine permease/sulfur transfer protein complex subunit TusD
RA 4,503,790 A→G 15.9% intergenic (+39/‑59) xanP → / → tusD xanthine permease/sulfur transfer protein complex subunit TusD
RA 4,517,232 A→C 7.3% intergenic (+69/+17) infA → / ← clpA translation initiation factor IF‑1/ATP‑dependent serine protease
RA 4,517,233 A→T 7.2% intergenic (+70/+16) infA → / ← clpA translation initiation factor IF‑1/ATP‑dependent serine protease
RA 4,517,234 G→T 7.6% intergenic (+71/+15) infA → / ← clpA translation initiation factor IF‑1/ATP‑dependent serine protease
RA 4,520,454 A→T 6.7% intergenic (+45/+27) cspD → / ← icd DNA replication inhibitor/NADP(+)‑specific isocitrate dehydrogenase
RA 4,520,464 A→G 6.4% intergenic (+55/+17) cspD → / ← icd DNA replication inhibitor/NADP(+)‑specific isocitrate dehydrogenase
RA 4,522,239 T→G 6.1% F30V (TTC→GTC) ‡ idh → isocitrate dehydrogenase
RA 4,522,241 C→G 6.2% F30L (TTC→TTG) ‡ idh → isocitrate dehydrogenase
RA 4,522,243 C→A 6.2% T31N (ACC→AAC)  idh → isocitrate dehydrogenase
RA 4,526,642 G→T 8.4% G151V (GGC→GTC)  PP_4015 → HflD‑like high frequency lysogenization protein
RA 4,526,645 A→C 7.5% D152A (GAC→GCC)  PP_4015 → HflD‑like high frequency lysogenization protein
RA 4,530,025 T→A 29.4% intergenic (+31/‑137) PP_4018 → / → topB acetyltransferase/DNA topoisomerase III
RA 4,530,026 T→A 29.5% intergenic (+32/‑136) PP_4018 → / → topB acetyltransferase/DNA topoisomerase III
RA 4,547,594 T→C 8.2% intergenic (‑249/‑95) pydP ← / → pydB NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,547,601 G→T 12.2% intergenic (‑256/‑88) pydP ← / → pydB NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,547,602 A→C 10.4% intergenic (‑257/‑87) pydP ← / → pydB NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,547,609 G→A 11.0% intergenic (‑264/‑80) pydP ← / → pydB NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,549,025 A→C 5.8% E446A (GAG→GCG)  pydB → bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,549,029 G→C 6.1% P447P (CCG→CCC)  pydB → bifunctional D‑hydantoinase/dihydropyrimidinase
RA 4,555,988 T→G 6.1% E170A (GAG→GCG) ‡ zwfB ← glucose 6‑phosphate 1‑dehydrogenase
RA 4,555,989 C→A 5.3% E170* (GAG→TAG) ‡ zwfB ← glucose 6‑phosphate 1‑dehydrogenase
RA 4,563,124 T→G 8.3% Q246P (CAG→CCG)  vgrG‑III ← type VI secretion system protein
RA 4,563,782 C→T 12.1% D27N (GAT→AAT)  vgrG‑III ← type VI secretion system protein
RA 4,563,785 G→A 10.8% L26L (CTG→TTG)  vgrG‑III ← type VI secretion system protein
RA 4,563,786 C→G 10.9% K25N (AAG→AAC) ‡ vgrG‑III ← type VI secretion system protein
RA 4,563,787 T→C 10.6% K25R (AAG→AGG) ‡ vgrG‑III ← type VI secretion system protein
RA 4,563,790 A→G 10.8% F24S (TTC→TCC)  vgrG‑III ← type VI secretion system protein
RA 4,578,135 T→G 7.6% E659A (GAG→GCG) ‡ glgB ← 1,4‑alpha‑glucan branching enzyme
RA 4,578,136 C→A 8.4% E659* (GAG→TAG) ‡ glgB ← 1,4‑alpha‑glucan branching enzyme
RA 4,586,030 2 bp→TC 100% intergenic (+113/+101) PP_4061 → / ← PP_4063 hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA 4,586,033:1 +G 100% intergenic (+116/+99) PP_4061 → / ← PP_4063 hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA 4,586,056:1 +C 100% intergenic (+139/+76) PP_4061 → / ← PP_4063 hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA 4,597,389 A→G 6.0% V807A (GTC→GCC)  PP_4071 ← membrane protein
RA 4,631,564 A→T 7.8% intergenic (+1338/‑97) PP_4094 → / → PP_4096 hypothetical protein/hypothetical protein
RA 4,632,499 A→C 6.5% intergenic (+104/+55) PP_4096 → / ← PP_t59 hypothetical protein/tRNA‑Gly
RA 4,649,273 G→A 7.0% G547G (GGC→GGT)  PP_4113 ← hypothetical protein
RA 4,658,398 A→C 5.2% E345A (GAA→GCA) ‡ nuoC → NADH‑quinone oxidoreductase subunit C/D
RA 4,658,399 A→T 5.2% E345D (GAA→GAT) ‡ nuoC → NADH‑quinone oxidoreductase subunit C/D
RA 4,683,159 T→A 8.2% intergenic (+18/‑203) mltD → / → PP_4146 membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA 4,683,160 T→A 8.1% intergenic (+19/‑202) mltD → / → PP_4146 membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA 4,683,161 T→A 8.1% intergenic (+20/‑201) mltD → / → PP_4146 membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA 4,707,318 C→G 8.0% intergenic (‑20/+90) PP_4163 ← / ← PP_4164 hypothetical protein/alpha/beta hydrolase
RA 4,725,040 G→A 5.5% intergenic (+25/+43) PP_5661 → / ← PP_4183 putative lipoprotein/membrane protein
RA 4,733,482 C→A 88.9% R718L (CGC→CTC)  sucA ← 2‑oxoglutarate dehydrogenase subunit E1
RA 4,740,805 Δ1 bp 100% intergenic (+42/+711) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,816 T→G 100% intergenic (+53/+700) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,819 2 bp→CT 100% intergenic (+56/+696) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,839 C→G 27.8% intergenic (+76/+677) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,841 T→A 26.3% intergenic (+78/+675) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,842 T→A 26.3% intergenic (+79/+674) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,740,844 C→G 26.4% intergenic (+81/+672) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,229 A→C 100% intergenic (+466/+287) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,231 C→G 100% intergenic (+468/+285) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,234 C→T 100% intergenic (+471/+282) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,236 2 bp→TG 100% intergenic (+473/+279) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,239 A→G 100% intergenic (+476/+277) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,243 3 bp→TGC 100% intergenic (+480/+271) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,255 C→T 100% intergenic (+492/+261) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,257 A→C 100% intergenic (+494/+259) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,260 2 bp→GC 100% intergenic (+497/+255) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,263 A→C 100% intergenic (+500/+253) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,272 A→G 100% intergenic (+509/+244) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,274 A→C 100% intergenic (+511/+242) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,276 G→C 100% intergenic (+513/+240) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,278 C→T 100% intergenic (+515/+238) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,283:1 +T 100% intergenic (+520/+233) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,289 C→G 100% intergenic (+526/+227) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,292 C→T 100% intergenic (+529/+224) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,294 C→G 100% intergenic (+531/+222) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,296 A→C 100% intergenic (+533/+220) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,741,298 C→T 100% intergenic (+535/+218) gltA → / ← yeiW citrate synthase/putative oxidoreductase
RA 4,781,474 A→T 6.6% L1947Q (CTG→CAG)  pvdJ ← non‑ribosomal peptide synthetase
RA 4,782,869 T→C 6.6% E1482G (GAG→GGG)  pvdJ ← non‑ribosomal peptide synthetase
RA 4,796,612 C→T 27.7% intergenic (‑170/+48) pvdH ← / ← PP_4224 diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA 4,796,614 G→C 27.8% intergenic (‑172/+46) pvdH ← / ← PP_4224 diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA 4,796,617 G→C 26.4% intergenic (‑175/+43) pvdH ← / ← PP_4224 diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA 4,796,619 A→G 27.7% intergenic (‑177/+41) pvdH ← / ← PP_4224 diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA 4,796,627 C→T 25.7% intergenic (‑185/+33) pvdH ← / ← PP_4224 diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA 4,806,674 G→A 8.0% G406G (GGC→GGT)  PP_4234 ← bifunctional aldehyde oxidase/xanthine dehydrogenase
RA 4,807,254 G→A 6.9% S213F (TCC→TTC)  PP_4234 ← bifunctional aldehyde oxidase/xanthine dehydrogenase
RA 4,821,760 C→A 6.1% E3144* (GAG→TAG)  pvdL ← non‑ribosomal peptide synthetase
RA 4,837,280 C→T 5.3% A429A (GCC→GCT)  ccoN‑I → cbb3‑type cytochrome c oxidase subunit 1
RA 4,837,281 A→G 5.4% S430G (AGC→GGC)  ccoN‑I → cbb3‑type cytochrome c oxidase subunit 1
RA 4,837,288 C→A 6.6% P432Q (CCA→CAA)  ccoN‑I → cbb3‑type cytochrome c oxidase subunit 1
RA 4,852,458 G→T 24.9% intergenic (‑129/+168) recR ← / ← ybaB recombination protein RecR/nucleoid‑associated broad specificity regulator
RA 4,852,459 A→T 17.4% intergenic (‑130/+167) recR ← / ← ybaB recombination protein RecR/nucleoid‑associated broad specificity regulator
RA 4,852,460 A→C 26.3% intergenic (‑131/+166) recR ← / ← ybaB recombination protein RecR/nucleoid‑associated broad specificity regulator
RA 4,853,037 A→G 7.0% S688S (AGT→AGC)  dnaX ← DNA polymerase III subunit gamma
RA 4,853,042 C→T 6.9% A687T (GCT→ACT)  dnaX ← DNA polymerase III subunit gamma
RA 4,882,207:1 +A 5.1% coding (1290/1356 nt) uacT → uric acid permease
RA 4,882,212 Δ1 bp 5.1% coding (1295/1356 nt) uacT → uric acid permease
RA 4,891,874 T→C 5.1% Y346H (TAC→CAC)  ttuD → hydroxypyruvate reductase
RA 4,896,445 G→A 21.0% intergenic (+78/‑130) PP_4304 → / → sbp‑I VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
RA 4,899,879 G→T 5.6% C93F (TGC→TTC)  PP_4308 → AsnC family transcriptional regulator
RA 4,900,065 A→G 8.4% intergenic (+26/‑472) PP_4308 → / → PP_4309 AsnC family transcriptional regulator/NCS1 family transporter
RA 4,900,069 G→A 8.5% intergenic (+30/‑468) PP_4308 → / → PP_4309 AsnC family transcriptional regulator/NCS1 family transporter
RA 4,900,070 T→C 8.7% intergenic (+31/‑467) PP_4308 → / → PP_4309 AsnC family transcriptional regulator/NCS1 family transporter
RA 4,900,074 C→T 9.0% intergenic (+35/‑463) PP_4308 → / → PP_4309 AsnC family transcriptional regulator/NCS1 family transporter
RA 4,908,054 A→C 8.1% intergenic (‑30/‑252) PP_4317 ← / → PP_4318 hypothetical protein/transposase
RA 4,918,174 C→G 8.1% L191L (CTC→CTG)  PP_4328 → hypothetical protein
RA 4,936,626 G→C 6.1% intergenic (‑37/‑381) flhA ← / → PP_4345 flagellar export pore protein/GntR family transcriptional regulator
RA 4,936,628 G→C 5.4% intergenic (‑39/‑379) flhA ← / → PP_4345 flagellar export pore protein/GntR family transcriptional regulator
RA 4,936,630 G→C 5.2% intergenic (‑41/‑377) flhA ← / → PP_4345 flagellar export pore protein/GntR family transcriptional regulator
RA 4,937,119 A→T 5.9% E38V (GAA→GTA)  PP_4345 → GntR family transcriptional regulator
RA 4,945,616 C→G 5.1% R322P (CGG→CCG)  flhB ← flagellin export apparatus substrate specificity protein
RA 4,945,627 C→G 5.6% P318P (CCG→CCC)  flhB ← flagellin export apparatus substrate specificity protein
RA 4,950,972 T→G 15.7% intergenic (‑122/+35) fliL ← / ← fliK flagellar protein FliL/flagellar hook‑length control protein FliK
RA 4,961,913 A→G 6.0% R175R (CGT→CGC) ‡ atoC ← two‑component system DNA‑binding transcriptional activator AtoC
RA 4,961,914 C→T 5.9% R175H (CGT→CAT) ‡ atoC ← two‑component system DNA‑binding transcriptional activator AtoC
RA 4,967,639 A→G 7.5% V13A (GTC→GCC)  fliD ← flagellar filament capping protein
RA 4,967,641 G→T 7.4% G12G (GGC→GGA)  fliD ← flagellar filament capping protein
RA 4,967,646 A→C 7.2% S11A (TCC→GCC)  fliD ← flagellar filament capping protein
RA 4,967,648 C→T 7.2% G10D (GGC→GAC)  fliD ← flagellar filament capping protein
RA 4,970,597 G→C 5.2% intergenic (‑355/+39) fliC ← / ← PP_4379 flagellin/3‑oxoacyl‑ACP synthase
RA 4,970,603 T→C 5.5% intergenic (‑361/+33) fliC ← / ← PP_4379 flagellin/3‑oxoacyl‑ACP synthase
RA 4,970,604 G→C 5.6% intergenic (‑362/+32) fliC ← / ← PP_4379 flagellin/3‑oxoacyl‑ACP synthase
RA 4,970,611 G→C 6.0% intergenic (‑369/+25) fliC ← / ← PP_4379 flagellin/3‑oxoacyl‑ACP synthase
RA 4,972,881 A→T 5.0% F223I (TTT→ATT)  flgL ← flagellar hook‑associated protein FlgL
RA 4,975,249 T→A 6.9% T119S (ACT→TCT)  flgK ← flagellar hook‑associated protein FlgK
JC 4,980,585 +GGC 100% intergenic (‑24/+44) PP_4387 ← / ← flgE hypothetical protein/flagellar hook protein FlgE
RA 4,989,285 A→G 10.3% P158P (CCT→CCC) ‡ PP_4398 ← MFS transporter
RA 4,989,287 G→C 10.5% P158A (CCT→GCT) ‡ PP_4398 ← MFS transporter
RA 4,989,288 G→C 10.5% G157G (GGC→GGG) ‡ PP_4398 ← MFS transporter
RA 4,989,290 C→T 10.7% G157S (GGC→AGC) ‡ PP_4398 ← MFS transporter
RA 4,998,171 G→T 7.6% intergenic (‑71/‑145) PP_4405 ← / → PP_4406 sensory box protein/hypothetical protein
RA 4,998,172 A→C 7.8% intergenic (‑72/‑144) PP_4405 ← / → PP_4406 sensory box protein/hypothetical protein
RA 5,006,817 C→G 5.1% R1057G (CGA→GGA)  PP_4410 → hypothetical protein
RA 5,013,283 T→C 5.9% V35A (GTG→GCG)  PP_5678 → hypothetical protein
RA 5,013,287 G→C 5.6% L36L (CTG→CTC)  PP_5678 → hypothetical protein
RA 5,016,329 A→T 5.3% I345N (ATC→AAC)  PP_4421 ← aminotransferase
RA 5,026,750 A→T 5.9% T20T (ACA→ACT)  ocd → ornithine cyclodeaminase
RA 5,026,752 A→T 5.9% D21V (GAC→GTC)  ocd → ornithine cyclodeaminase
RA 5,026,754 A→T 5.9% S22C (AGT→TGT)  ocd → ornithine cyclodeaminase
RA 5,032,757 T→C 5.9% P92P (CCT→CCC)  PP_4435 → hypothetical protein
RA 5,032,761 C→G 6.3% R94G (CGA→GGA)  PP_4435 → hypothetical protein
RA 5,054,819 A→G 5.8% P190P (CCT→CCC)  PP_4454 ← opine ABC transporter permease
RA 5,079,126 T→A 9.0% intergenic (‑371/+26) mgtE ← / ← PP_t56 magnesium transporter/tRNA‑Arg
RA 5,079,129 T→A 9.8% intergenic (‑374/+23) mgtE ← / ← PP_t56 magnesium transporter/tRNA‑Arg
RA 5,079,596 A→T 10.9% intergenic (‑67/+5) PP_t54 ← / ← PP_t53 tRNA‑Arg/tRNA‑Arg
RA 5,090,047 A→G 10.3% L297P (CTG→CCG)  astA‑II ← arginine N‑succinyltransferase subunit alpha
RA 5,090,049 G→C 11.7% G296G (GGC→GGG) ‡ astA‑II ← arginine N‑succinyltransferase subunit alpha
RA 5,090,051 C→T 10.6% G296S (GGC→AGC) ‡ astA‑II ← arginine N‑succinyltransferase subunit alpha
RA 5,096,464 A→G 10.2% V101A (GTC→GCC) ‡ argT ← lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA 5,096,465 C→T 10.1% V101I (GTC→ATC) ‡ argT ← lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA 5,096,560 T→A 5.5% E69V (GAG→GTG)  argT ← lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA 5,103,088 A→T 8.0% intergenic (+20/‑170) phhB → / → PP_5694 pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA 5,103,089 G→C 8.6% intergenic (+21/‑169) phhB → / → PP_5694 pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA 5,103,090 A→T 8.4% intergenic (+22/‑168) phhB → / → PP_5694 pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA 5,124,166 Δ1 bp 8.5% intergenic (‑35/‑93) PP_4510 ← / → PP_4511 hypothetical protein/AraC family transcriptional regulator
RA 5,132,960 C→A 6.6% A14A (GCC→GCA)  tolC → agglutination protein
RA 5,132,963 G→C 7.7% L15L (CTG→CTC)  tolC → agglutination protein
RA 5,132,966 G→C 6.6% A16A (GCG→GCC)  tolC → agglutination protein
RA 5,132,969 T→G 6.8% S17R (AGT→AGG)  tolC → agglutination protein
RA 5,137,445 A→G 5.6% C53R (TGC→CGC)  PP_4522 ← LysR family transcriptional regulator
RA 5,137,665 A→G 6.6% intergenic (‑64/‑149) PP_4522 ← / → PP_4523 LysR family transcriptional regulator/agmatinase
RA 5,137,670 C→T 6.6% intergenic (‑69/‑144) PP_4522 ← / → PP_4523 LysR family transcriptional regulator/agmatinase
RA 5,153,310 C→A 8.9% intergenic (‑1387/+27) PP_5696 ← / ← PP_4537 hypothetical protein/membrane protein
RA 5,153,311 C→G 8.9% intergenic (‑1388/+26) PP_5696 ← / ← PP_4537 hypothetical protein/membrane protein
RA 5,153,312 T→G 8.3% intergenic (‑1389/+25) PP_5696 ← / ← PP_4537 hypothetical protein/membrane protein
RA 5,162,202 T→A 7.9% W324R (TGG→AGG) ‡ PP_4544 → hypothetical protein
RA 5,162,204 G→C 9.2% W324C (TGG→TGC) ‡ PP_4544 → hypothetical protein
RA 5,162,206 T→A 8.2% L325Q (CTG→CAG)  PP_4544 → hypothetical protein
RA 5,162,208 G→C 9.1% A326P (GCT→CCT) ‡ PP_4544 → hypothetical protein
RA 5,162,210 T→A 10.2% A326A (GCT→GCA) ‡ PP_4544 → hypothetical protein
RA 5,175,099 A→T 6.6% intergenic (‑120/‑99) fadD‑II ← / → PP_4551 long‑chain‑fatty acid‑‑CoA ligase/alpha/beta family hydrolase
RA 5,180,012 C→G 8.5% intergenic (‑240/‑43) PP_4557 ← / → PP_4558 hypothetical protein/GNAT family acetyltransferase
RA 5,182,854 G→T 6.4% G115V (GGC→GTC)  PP_4562 → hypothetical protein
RA 5,182,992 A→T 10.1% F248I (TTC→ATC)  PP_4563 ← hypothetical protein
RA 5,182,997 T→A 10.4% K246M (AAG→ATG) ‡ PP_4563 ← hypothetical protein
RA 5,182,998 T→A 10.4% K246* (AAG→TAG) ‡ PP_4563 ← hypothetical protein
RA 5,183,003 A→T 11.7% I244N (ATC→AAC)  PP_4563 ← hypothetical protein
RA 5,184,110 A→C 5.5% M83L (ATG→CTG)  PP_4564 → lipoprotein
RA 5,184,117 C→T 5.5% A85V (GCC→GTC)  PP_4564 → lipoprotein
RA 5,184,120 A→G 5.9% D86G (GAC→GGC)  PP_4564 → lipoprotein
RA 5,187,584 G→A 12.0% R30H (CGC→CAC) ‡ PP_4567 → hypothetical protein
RA 5,187,585 C→G 12.3% R30R (CGC→CGG) ‡ PP_4567 → hypothetical protein
RA 5,187,586 C→G 12.3% L31V (CTG→GTG) ‡ PP_4567 → hypothetical protein
RA 5,187,587 T→C 11.3% L31P (CTG→CCG) ‡ PP_4567 → hypothetical protein
RA 5,187,984 C→A 5.6% R163R (CGC→CGA)  PP_4567 → hypothetical protein
RA 5,208,043 A→C 5.1% N222K (AAT→AAG)  PP_4589 ← D‑isomer specific 2‑hydroxyacid dehydrogenase family protein
RA 5,212,488 C→A 5.1% intergenic (+52/+42) PP_4593 → / ← PP_4594 hypothetical protein/cystathionine gamma‑synthase
RA 5,212,491 T→G 5.1% intergenic (+55/+39) PP_4593 → / ← PP_4594 hypothetical protein/cystathionine gamma‑synthase
RA 5,229,179 G→A 5.7% intergenic (‑121/+55) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,229,191 Δ1 bp 10.3% intergenic (‑133/+43) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,229,195 C→G 11.6% intergenic (‑137/+39) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,229,198 C→G 10.9% intergenic (‑140/+36) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,229,201:1 +C 11.1% intergenic (‑143/+33) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,229,213 T→C 7.3% intergenic (‑155/+21) PP_4606 ← / ← PP_4607 ferric siderophore receptor/transmembrane sensor
RA 5,235,070 A→G 5.5% H135R (CAC→CGC)  fecA → outer membrane ferric citrate porin
RA 5,256,864 T→A 8.2% intergenic (+16/+29) PP_5703 → / ← PP_4634 type III effector protein HopJ/alpha/beta family hydrolase
RA 5,257,689 A→C 5.1% V38G (GTG→GGG)  PP_4634 ← alpha/beta family hydrolase
RA 5,257,696 G→C 5.1% P36A (CCG→GCG)  PP_4634 ← alpha/beta family hydrolase
RA 5,257,697 G→C 5.1% R35R (CGC→CGG)  PP_4634 ← alpha/beta family hydrolase
RA 5,257,704 G→T 5.2% P33H (CCC→CAC)  PP_4634 ← alpha/beta family hydrolase
RA 5,274,268 T→A 5.3% H330L (CAC→CTC)  cioB ← cyanide insensitive ubiquinol oxidase subunit II
RA 5,276,837 A→G 7.2% intergenic (‑141/‑203) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,276,838 A→T 6.5% intergenic (‑142/‑202) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,276,840 G→A 7.4% intergenic (‑144/‑200) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,276,843 T→C 7.4% intergenic (‑147/‑197) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,276,845 A→T 7.2% intergenic (‑149/‑195) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,276,846 C→T 7.8% intergenic (‑150/‑194) cioA ← / → PP_4652 cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA 5,285,376 A→T 5.5% E594V (GAG→GTG)  PP_4658 → methyl‑accepting chemotaxis protein
RA 5,302,647 G→C 6.1% L376V (CTG→GTG)  recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,302,657 G→A 8.3% A372A (GCC→GCT)  recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,302,660 C→G 8.3% E371D (GAG→GAC) ‡ recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,302,661 T→A 8.6% E371V (GAG→GTG) ‡ recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,302,662 C→G 8.2% E371Q (GAG→CAG) ‡ recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,302,665 T→C 8.4% S370G (AGC→GGC)  recB ← Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA 5,313,276 C→G 12.2% intergenic (‑595/+119) PP_16SG ← / ← msrQ 16S ribosomal RNA/methionine sulfoxide reductase heme‑binding subunit
RA 5,313,279 C→G 12.0% intergenic (‑598/+116) PP_16SG ← / ← msrQ 16S ribosomal RNA/methionine sulfoxide reductase heme‑binding subunit
RA 5,322,154 C→T 6.1% S366S (TCG→TCA)  mrcB ← transglycosylase/transpeptidase
RA 5,322,735 T→G 5.4% I173L (ATC→CTC)  mrcB ← transglycosylase/transpeptidase
RA 5,322,736 C→A 6.2% K172N (AAG→AAT)  mrcB ← transglycosylase/transpeptidase
RA 5,323,120 A→T 5.8% D44E (GAT→GAA)  mrcB ← transglycosylase/transpeptidase
RA 5,323,124 A→C 5.3% L43R (CTC→CGC)  mrcB ← transglycosylase/transpeptidase
RA 5,324,153 T→C 6.6% C263R (TGC→CGC)  PP_4684 → kinase‑like domain‑containing protein
RA 5,325,511 T→A 5.9% noncoding (133/149 nt) PP_mr52 → PrrF ncRNA
RA 5,331,397 T→G 5.7% Q55P (CAG→CCG)  PP_4692 ← aspartate/tyrosine/aromatic aminotransferase
RA 5,331,399 G→C 7.2% G54G (GGC→GGG) ‡ PP_4692 ← aspartate/tyrosine/aromatic aminotransferase
RA 5,331,401 C→A 6.2% G54C (GGC→TGC) ‡ PP_4692 ← aspartate/tyrosine/aromatic aminotransferase
RA 5,333,664 C→A 7.1% L32M (CTG→ATG) ‡ PP_4695 → two‑component system sensor histidine kinase
RA 5,333,666 G→C 8.2% L32L (CTG→CTC) ‡ PP_4695 → two‑component system sensor histidine kinase
RA 5,333,668 T→G 7.2% I33S (ATC→AGC)  PP_4695 → two‑component system sensor histidine kinase
RA 5,339,889 C→T 6.1% L373L (CTG→TTG)  pcnB → poly(A) polymerase
RA 5,339,896 G→T 6.8% R375L (CGC→CTC) ‡ pcnB → poly(A) polymerase
RA 5,339,897 C→G 7.4% R375R (CGC→CGG) ‡ pcnB → poly(A) polymerase
RA 5,339,900 C→G 7.4% R376R (CGC→CGG)  pcnB → poly(A) polymerase
RA 5,339,901 A→C 7.0% S377R (AGC→CGC)  pcnB → poly(A) polymerase
RA 5,339,908 A→G 5.8% K379R (AAG→AGG)  pcnB → poly(A) polymerase
RA 5,341,584 G→T 7.5% V231L (GTG→TTG) ‡ panB → 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA 5,341,586 G→C 8.3% V231V (GTG→GTC) ‡ panB → 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA 5,341,588 A→C 7.0% K232T (AAG→ACG)  panB → 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA 5,343,615 C→G 9.5% I285M (ATC→ATG)  pgi‑II → glucose 6‑phosphate isomerase
RA 5,343,619 C→A 8.2% L287M (CTG→ATG)  pgi‑II → glucose 6‑phosphate isomerase
RA 5,343,624 C→G 7.7% A288A (GCC→GCG)  pgi‑II → glucose 6‑phosphate isomerase
RA 5,344,246 A→C 5.6% K496Q (AAG→CAG) ‡ pgi‑II → glucose 6‑phosphate isomerase
RA 5,344,247 A→T 5.5% K496M (AAG→ATG) ‡ pgi‑II → glucose 6‑phosphate isomerase
RA 5,344,248 G→T 6.8% K496N (AAG→AAT) ‡ pgi‑II → glucose 6‑phosphate isomerase
RA 5,344,252 T→C 5.5% F498L (TTC→CTC)  pgi‑II → glucose 6‑phosphate isomerase
RA 5,344,467 C→G 13.8% intergenic (+42/‑136) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,344,471 C→T 15.0% intergenic (+46/‑132) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,344,480 A→G 13.8% intergenic (+55/‑123) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,344,484 C→G 12.9% intergenic (+59/‑119) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,344,489 Δ1 bp 14.3% intergenic (+64/‑114) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,344,490 Δ1 bp 14.3% intergenic (+65/‑113) pgi‑II → / → acsA‑II glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA 5,350,476 G→C 5.6% intergenic (+13/+69) PP_4704 → / ← PP_4705 hypothetical protein/glyoxalase
RA 5,359,353 G→C 5.3% A306G (GCC→GGC)  nusA ← transcription termination/antitermination factor L
RA 5,360,629 T→G 5.5% E70D (GAA→GAC) ‡ rimP ← ribosome maturation factor
RA 5,360,630 T→A 5.5% E70V (GAA→GTA) ‡ rimP ← ribosome maturation factor
RA 5,360,631 C→A 5.3% E70* (GAA→TAA) ‡ rimP ← ribosome maturation factor
RA 5,361,071 A→T 6.5% intergenic (‑78/+23) PP_t49 ← / ← PP_t48 tRNA‑Met/tRNA‑Leu
RA 5,361,072 A→T 6.9% intergenic (‑79/+22) PP_t49 ← / ← PP_t48 tRNA‑Met/tRNA‑Leu
RA 5,362,215 C→G 5.3% V49L (GTG→CTG)  tpiA ← triose phosphate isomerase
RA 5,362,216 C→G 5.3% Q48H (CAG→CAC)  tpiA ← triose phosphate isomerase
RA 5,378,020 C→G 8.9% K68N (AAG→AAC)  grpE ← heat shock protein GrpE
RA 5,378,260 A→T 6.7% intergenic (‑37/‑156) grpE ← / → recN heat shock protein GrpE/DNA repair/recombination protein
RA 5,381,267 T→C 10.2% intergenic (+32/+33) bamE → / ← PP_4732 outer membrane protein assembly factor BamE/hypothetical protein
RA 5,381,268 T→A 10.2% intergenic (+33/+32) bamE → / ← PP_4732 outer membrane protein assembly factor BamE/hypothetical protein
RA 5,381,269 G→A 10.4% intergenic (+34/+31) bamE → / ← PP_4732 outer membrane protein assembly factor BamE/hypothetical protein
RA 5,382,269 A→T 8.2% E124D (GAA→GAT)  smpB → SsrA‑binding protein
RA 5,382,270 A→T 9.2% I125F (ATC→TTC)  smpB → SsrA‑binding protein
RA 5,383,303 G→T 12.0% intergenic (‑23/‑234) pdhR ← / → lldP DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA 5,383,305 C→A 12.0% intergenic (‑25/‑232) pdhR ← / → lldP DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA 5,383,308 A→T 15.9% intergenic (‑28/‑229) pdhR ← / → lldP DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA 5,383,311 T→G 12.0% intergenic (‑31/‑226) pdhR ← / → lldP DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA 5,383,313 A→C 12.0% intergenic (‑33/‑224) pdhR ← / → lldP DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA 5,385,617 Δ1 bp 5.9% coding (348/1146 nt) lldD → L‑lactate dehydrogenase
RA 5,391,329 A→G 8.4% E82E (GAA→GAG)  PP_5707 → hypothetical protein
RA 5,391,330 C→T 8.2% L83F (CTC→TTC)  PP_5707 → hypothetical protein
RA 5,420,010 G→T 5.4% P232P (CCG→CCT)  PP_4759 → transcriptional regulator, GntR family
RA 5,420,014 T→A 5.5% *234R (TGA→AGA) ‡ PP_4759 → transcriptional regulator, GntR family
RA 5,420,016 A→T 6.1% *234C (TGA→TGT) ‡ PP_4759 → transcriptional regulator, GntR family
RA 5,420,018 T→A 5.5% intergenic (+2/+70) PP_4759 → / ← PP_4760 transcriptional regulator, GntR family/alcohol dehydrogenase
RA 5,420,022 A→C 5.7% intergenic (+6/+66) PP_4759 → / ← PP_4760 transcriptional regulator, GntR family/alcohol dehydrogenase
RA 5,420,450 A→G 6.1% W217R (TGG→CGG)  PP_4760 ← alcohol dehydrogenase
RA 5,420,452 G→C 6.1% A216G (GCC→GGC)  PP_4760 ← alcohol dehydrogenase
RA 5,420,454 C→T 6.1% P215P (CCG→CCA)  PP_4760 ← alcohol dehydrogenase
RA 5,440,363 T→C 8.2% T155A (ACC→GCC)  amn ← AMP nucleosidase
RA 5,440,368 G→A 8.6% A153V (GCG→GTG)  amn ← AMP nucleosidase
RA 5,449,171 C→G 6.3% P14A (CCC→GCC) ‡ ybeZ → nucleoside triphosphate hydrolase domain‑containing protein
RA 5,449,172 C→G 6.2% P14R (CCC→CGC) ‡ ybeZ → nucleoside triphosphate hydrolase domain‑containing protein
RA 5,449,173 C→G 6.4% P14P (CCC→CCG) ‡ ybeZ → nucleoside triphosphate hydrolase domain‑containing protein
RA 5,459,560 T→G 7.8% intergenic (+18/‑22) PP_4795 → / → holA lipoprotein/DNA polymerase III subunit delta
RA 5,462,261 G→A 7.2% D401N (GAT→AAT) ‡ PP_4798 → membrane‑bound lytic murein transglycosylase
RA 5,462,262 A→T 7.2% D401V (GAT→GTT) ‡ PP_4798 → membrane‑bound lytic murein transglycosylase
RA 5,462,263 T→C 7.3% D401D (GAT→GAC) ‡ PP_4798 → membrane‑bound lytic murein transglycosylase
RA 5,462,393 T→G 5.8% intergenic (+16/+18) PP_4798 → / ← PP_4799 membrane‑bound lytic murein transglycosylase/muramoyltetrapeptide carboxypeptidase
RA 5,462,394 G→C 7.4% intergenic (+17/+17) PP_4798 → / ← PP_4799 membrane‑bound lytic murein transglycosylase/muramoyltetrapeptide carboxypeptidase
RA 5,485,150 A→G 20.0% intergenic (+56/‑91) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,153 A→G 24.2% intergenic (+59/‑88) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,154 T→C 28.5% intergenic (+60/‑87) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,159 G→A 28.6% intergenic (+65/‑82) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,162 T→C 27.6% intergenic (+68/‑79) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,167 G→A 20.0% intergenic (+73/‑74) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,168 C→T 20.0% intergenic (+74/‑73) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,485,171 C→T 20.0% intergenic (+77/‑70) purH → / → purD bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA 5,489,782 G→T 7.3% M88I (ATG→ATT)  PP_4825 → MarC family membrane protein
RA 5,503,135 C→A 6.9% L29M (CTG→ATG) ‡ oprC → copper receptor OprC
RA 5,503,136 T→G 6.9% L29R (CTG→CGG) ‡ oprC → copper receptor OprC
RA 5,503,142 C→G 7.1% A31G (GCC→GGC)  oprC → copper receptor OprC
RA 5,503,148 C→A 7.1% P33H (CCT→CAT) ‡ oprC → copper receptor OprC
RA 5,503,149 T→G 6.9% P33P (CCT→CCG) ‡ oprC → copper receptor OprC
RA 5,513,985 T→G 5.8% Y204D (TAC→GAC) ‡ urtE → ABC transporter ATP‑binding protein
RA 5,513,986 A→T 5.8% Y204F (TAC→TTC) ‡ urtE → ABC transporter ATP‑binding protein
RA 5,513,987 C→A 5.7% Y204* (TAC→TAA) ‡ urtE → ABC transporter ATP‑binding protein
RA 5,515,926 G→C 5.7% P34A (CCC→GCC)  cbpA ← curved DNA‑binding protein
RA 5,521,817 C→T 8.9% intergenic (‑32/‑35) lip ← / → PP_4855 lipase/osmotically‑inducible lipoprotein OsmE
RA 5,521,818 A→T 8.8% intergenic (‑33/‑34) lip ← / → PP_4855 lipase/osmotically‑inducible lipoprotein OsmE
RA 5,521,819 A→G 8.8% intergenic (‑34/‑33) lip ← / → PP_4855 lipase/osmotically‑inducible lipoprotein OsmE
RA 5,522,791 T→A 10.0% intergenic (+25/+15) PP_4856 → / ← yhjG Dps family ferritin/protein YhjG
RA 5,522,792 T→A 10.0% intergenic (+26/+14) PP_4856 → / ← yhjG Dps family ferritin/protein YhjG
RA 5,522,793 T→A 10.0% intergenic (+27/+13) PP_4856 → / ← yhjG Dps family ferritin/protein YhjG
RA 5,522,794 T→A 10.0% intergenic (+28/+12) PP_4856 → / ← yhjG Dps family ferritin/protein YhjG
RA 5,531,010 A→C 9.1% R421R (CGT→CGG)  braE ← high‑affinity branched‑chain amino acid ABC transporter permease BraE
RA 5,531,013 G→T 10.1% I420I (ATC→ATA)  braE ← high‑affinity branched‑chain amino acid ABC transporter permease BraE
JC 5,555,608 +GCC 100% intergenic (‑84/+87) PP_4887 ← / ← PP_4888 hypothetical protein/methyl‑accepting chemotaxis transducer
RA 5,565,760 T→C 6.2% M576V (ATG→GTG)  mutL ← DNA mismatch repair protein MutL
RA 5,566,961 C→G 6.1% L175F (TTG→TTC)  mutL ← DNA mismatch repair protein MutL
RA 5,567,178 A→T 6.2% L103* (TTG→TAG) ‡ mutL ← DNA mismatch repair protein MutL
RA 5,567,179 A→T 6.2% L103M (TTG→ATG) ‡ mutL ← DNA mismatch repair protein MutL
RA 5,570,177 T→G 7.7% A24A (GCA→GCC) ‡ nnrD ← ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA 5,570,178 G→C 6.4% A24G (GCA→GGA) ‡ nnrD ← ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA 5,574,789 C→T 9.6% D169N (GAC→AAC)  motB ← flagellar motor rotation protein
RA 5,574,790 G→C 10.0% F168L (TTC→TTG) ‡ motB ← flagellar motor rotation protein
RA 5,574,791 A→G 10.0% F168S (TTC→TCC) ‡ motB ← flagellar motor rotation protein
RA 5,582,813 T→A 6.5% H178L (CAC→CTC)  PP_4911 ← hypothetical protein
RA 5,582,816 T→A 6.7% Q177L (CAG→CTG)  PP_4911 ← hypothetical protein
RA 5,582,819 T→A 6.8% Q176L (CAG→CTG)  PP_4911 ← hypothetical protein
RA 5,582,822 T→A 6.8% E175V (GAG→GTG)  PP_4911 ← hypothetical protein
RA 5,610,648 G→C 5.7% M21I (ATG→ATC)  emrE → small multidrug resistance protein
RA 5,610,649 A→G 6.4% K22E (AAG→GAG)  emrE → small multidrug resistance protein
RA 5,613,523 T→A 8.6% A158A (GCT→GCA)  PP_4933 → hypothetical protein
RA 5,613,529 G→C 8.0% E160D (GAG→GAC)  PP_4933 → hypothetical protein
RA 5,613,535 T→A 7.8% G162G (GGT→GGA)  PP_4933 → hypothetical protein
RA 5,623,395 G→T 7.3% R115R (CGG→AGG)  PP_4941 ← hypothetical protein
RA 5,623,396 A→C 7.4% P114P (CCT→CCG)  PP_4941 ← hypothetical protein
RA 5,623,970 T→C 9.0% I221V (ATC→GTC)  PP_4942 ← hypothetical protein
RA 5,623,973 C→T 8.7% A220T (GCC→ACC)  PP_4942 ← hypothetical protein
RA 5,623,976 T→G 8.9% I219L (ATT→CTT)  PP_4942 ← hypothetical protein
RA 5,623,978 G→C 10.0% P218R (CCG→CGG)  PP_4942 ← hypothetical protein
RA 5,623,980 C→A 8.3% K217N (AAG→AAT)  PP_4942 ← hypothetical protein
RA 5,623,983 A→G 8.9% G216G (GGT→GGC)  PP_4942 ← hypothetical protein
RA 5,623,986 G→A 9.1% D215D (GAC→GAT)  PP_4942 ← hypothetical protein
RA 5,631,113 G→A 8.3% G215S (GGC→AGC)  putA → proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA 5,631,116 A→T 8.2% K216* (AAG→TAG) ‡ putA → proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA 5,631,117 A→T 8.1% K216M (AAG→ATG) ‡ putA → proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA 5,631,120 T→C 7.9% L217P (CTG→CCG)  putA → proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA 5,640,095 T→G 6.2% L396W (TTG→TGG)  PP_4950 → hypothetical protein
RA 5,640,100 G→C 6.8% G398R (GGC→CGC) ‡ PP_4950 → hypothetical protein
RA 5,640,101 G→C 5.5% G398A (GGC→GCC) ‡ PP_4950 → hypothetical protein
RA 5,640,106 C→A 5.4% Q400K (CAG→AAG)  PP_4950 → hypothetical protein
RA 5,651,374 T→G 5.1% intergenic (‑182/+31) PP_4959 ← / ← fba diguanylate cyclase/fructose‑bisphosphate aldolase
RA 5,651,377 C→A 5.2% intergenic (‑185/+28) PP_4959 ← / ← fba diguanylate cyclase/fructose‑bisphosphate aldolase
RA 5,655,626:1 +A 29.0% intergenic (‑81/+71) epd ← / ← tktA D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA 5,655,631 T→G 33.2% intergenic (‑86/+66) epd ← / ← tktA D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA 5,655,636 C→A 27.2% intergenic (‑91/+61) epd ← / ← tktA D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA 5,655,641 Δ1 bp 29.0% intergenic (‑96/+56) epd ← / ← tktA D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA 5,658,116 T→G 5.6% H57Q (CAT→CAG)  sahR → methionine metabolism transcriptional regulator
RA 5,660,182 G→T 11.1% intergenic (+35/‑194) metK → / → ligB methionine adenosyltransferase/DNA ligase B
RA 5,660,185 A→C 9.6% intergenic (+38/‑191) metK → / → ligB methionine adenosyltransferase/DNA ligase B
RA 5,669,964 C→G 8.9% H147Q (CAC→CAG)  metF → 5,10‑methylenetetrahydrofolate reductase
RA 5,669,965 C→G 9.2% L148V (CTG→GTG)  metF → 5,10‑methylenetetrahydrofolate reductase
RA 5,674,750:1 +G 100% intergenic (+112/+28) rhlE‑II → / ← yceI ATP‑dependent RNA helicase/polyisoprene‑binding acidic stress response factor
RA 5,674,753 G→C 100% intergenic (+115/+25) rhlE‑II → / ← yceI ATP‑dependent RNA helicase/polyisoprene‑binding acidic stress response factor
JC 5,681,415 +CGGG 89.2% intergenic (‑133/+71) PP_4986 ← / ← PP_4987 hemolysin III family channel protein/putative Chemotaxis protein
RA 5,682,324 A→C 6.6% R1523R (CGT→CGG)  PP_4988 ← signal transduction histidine kinase CheA/CheY‑like receiver
RA 5,682,338 G→T 6.2% P1519T (CCG→ACG)  PP_4988 ← signal transduction histidine kinase CheA/CheY‑like receiver
RA 5,689,863 G→A 5.3% P11S (CCG→TCG)  pilH ← twitching motility protein PilH
RA 5,689,867 G→C 5.4% D9E (GAC→GAG)  pilH ← twitching motility protein PilH
RA 5,689,871 T→C 5.6% D8G (GAC→GGC)  pilH ← twitching motility protein PilH
RA 5,698,154 A→C 7.3% K263T (AAG→ACG)  hslU → protease HslVU ATPase subunit
RA 5,698,157 G→T 6.9% R264L (CGT→CTT)  hslU → protease HslVU ATPase subunit
RA 5,707,113 G→C 5.5% L377L (CTG→CTC)  PP_5009 → hypothetical protein
RA 5,715,410 C→A 5.3% P26Q (CCG→CAG)  tatB → Sec‑independent protein translocase protein TatB
RA 5,734,772 G→C 7.1% R298G (CGT→GGT)  hutH ← histidine ammonia‑lyase
RA 5,734,779 G→C 8.0% T295T (ACC→ACG)  hutH ← histidine ammonia‑lyase
RA 5,736,533 C→T 6.7% V305M (GTG→ATG)  hutU ← urocanate hydratase
RA 5,740,467 T→G 28.0% intergenic (+32/+39) hutF → / ← PP_5037 formiminoglutamate deiminase/lipocalin family lipoprotein
RA 5,740,470 A→T 23.0% intergenic (+35/+36) hutF → / ← PP_5037 formiminoglutamate deiminase/lipocalin family lipoprotein
RA 5,740,471 A→T 24.6% intergenic (+36/+35) hutF → / ← PP_5037 formiminoglutamate deiminase/lipocalin family lipoprotein
RA 5,740,474 C→A 23.3% intergenic (+39/+32) hutF → / ← PP_5037 formiminoglutamate deiminase/lipocalin family lipoprotein
RA 5,740,484 T→C 12.0% intergenic (+49/+22) hutF → / ← PP_5037 formiminoglutamate deiminase/lipocalin family lipoprotein
RA 5,741,508 A→T 6.4% intergenic (‑179/+49) PP_5038 ← / ← PP_5039 lipoprotein/hypothetical protein
RA 5,746,485 G→C 13.4% intergenic (+32/+67) PP_5042 → / ← PP_5043 hypothetical protein/PhoPQ‑activated pathogenicity‑like protein
RA 5,746,488 G→C 13.3% intergenic (+35/+64) PP_5042 → / ← PP_5043 hypothetical protein/PhoPQ‑activated pathogenicity‑like protein
RA 5,748,696 G→T 5.9% N428K (AAC→AAA)  typA ← ribosome associated GTPase
RA 5,751,719 G→T 7.5% intergenic (‑157/‑314) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,725 A→G 11.1% intergenic (‑163/‑308) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,729 G→T 11.9% intergenic (‑167/‑304) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,730 G→T 11.7% intergenic (‑168/‑303) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,735 A→C 10.0% intergenic (‑173/‑298) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,736 A→C 10.0% intergenic (‑174/‑297) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,740 C→T 10.6% intergenic (‑178/‑293) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,751,746 A→C 10.6% intergenic (‑184/‑287) thiI ← / → glnA tRNA sulfurtransferase/glutamine synthetase
RA 5,753,485 T→G 10.7% intergenic (+46/‑320) glnA → / → glnL glutamine synthetase/two‑component system sensor histidine kinase/phosphatase GlnL/GlnG
RA 5,753,486 C→A 10.5% intergenic (+47/‑319) glnA → / → glnL glutamine synthetase/two‑component system sensor histidine kinase/phosphatase GlnL/GlnG
RA 5,763,847 T→C 6.1% V408A (GTT→GCT)  PP_5057 → M23/M37 family peptidase
RA 5,763,850 G→T 6.2% G409V (GGC→GTC)  PP_5057 → M23/M37 family peptidase
RA 5,763,853 A→C 6.1% D410A (GAC→GCC)  PP_5057 → M23/M37 family peptidase
RA 5,763,856 G→A 6.0% S411N (AGC→AAC)  PP_5057 → M23/M37 family peptidase
RA 5,776,247 G→A 7.2% P188P (CCG→CCA)  betA‑II → choline dehydrogenase
RA 5,776,248 A→T 8.1% M189L (ATG→TTG) ‡ betA‑II → choline dehydrogenase
RA 5,776,249 T→C 7.2% M189T (ATG→ACG) ‡ betA‑II → choline dehydrogenase
RA 5,776,696 G→A 7.2% G338D (GGT→GAT)  betA‑II → choline dehydrogenase
RA 5,776,699 T→C 7.2% I339T (ATC→ACC)  betA‑II → choline dehydrogenase
RA 5,776,703 C→T 7.2% G340G (GGC→GGT)  betA‑II → choline dehydrogenase
RA 5,807,984 A→G 14.7% intergenic (+119/+36) mrcA → / ← maeB penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA 5,807,985 T→C 15.7% intergenic (+120/+35) mrcA → / ← maeB penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA 5,807,986 G→A 15.1% intergenic (+121/+34) mrcA → / ← maeB penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA 5,807,987 C→T 15.0% intergenic (+122/+33) mrcA → / ← maeB penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA 5,815,531 C→T 7.9% intergenic (+15/+76) PP_5090 → / ← PP_5091 cell division protein/membrane protein
RA 5,815,536 G→T 10.2% intergenic (+20/+71) PP_5090 → / ← PP_5091 cell division protein/membrane protein
RA 5,815,539 A→C 12.7% intergenic (+23/+68) PP_5090 → / ← PP_5091 cell division protein/membrane protein
RA 5,815,544 A→G 10.9% intergenic (+28/+63) PP_5090 → / ← PP_5091 cell division protein/membrane protein
RA 5,824,712 T→G 6.2% intergenic (+136/+38) PP_5102 → / ← trmB hypothetical protein/tRNA (guanosine(46)‑N7)‑methyltransferase TrmB
RA 5,856,513 A→T 6.1% E147V (GAA→GTA) ‡ PP_5133 → membrane protein
RA 5,856,514 A→T 6.1% E147D (GAA→GAT) ‡ PP_5133 → membrane protein
RA 5,856,520 T→A 6.3% F149L (TTT→TTA)  PP_5133 → membrane protein
RA 5,860,125 G→C 5.6% A535G (GCC→GGC)  PP_5136 ← ABC transporter permease
RA 5,860,127 A→G 5.6% G534G (GGT→GGC)  PP_5136 ← ABC transporter permease
RA 5,866,696 G→T 10.9% intergenic (+19/+38) PP_5140 → / ← thyA MerR family transcriptional regulator/thymidylate synthase
RA 5,866,697 A→C 10.0% intergenic (+20/+37) PP_5140 → / ← thyA MerR family transcriptional regulator/thymidylate synthase
RA 5,867,733:1 +C 5.8% intergenic (‑28/+24) thyA ← / ← lgt thymidylate synthase/prolipoprotein diacylglyceryl transferase
RA 5,867,738 Δ1 bp 5.6% intergenic (‑33/+19) thyA ← / ← lgt thymidylate synthase/prolipoprotein diacylglyceryl transferase
RA 5,887,056 T→G 6.5% intergenic (‑41/‑89) PP_5161 ← / → PP_5162 lysophospholipase/hypothetical protein
RA 5,887,059 C→T 6.5% intergenic (‑44/‑86) PP_5161 ← / → PP_5162 lysophospholipase/hypothetical protein
RA 5,887,060 G→C 6.5% intergenic (‑45/‑85) PP_5161 ← / → PP_5162 lysophospholipase/hypothetical protein
RA 5,887,061 A→G 6.5% intergenic (‑46/‑84) PP_5161 ← / → PP_5162 lysophospholipase/hypothetical protein
RA 5,887,064 C→A 7.2% intergenic (‑49/‑81) PP_5161 ← / → PP_5162 lysophospholipase/hypothetical protein
RA 5,897,770 A→G 11.9% intergenic (‑170/+64) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,773 G→A 12.8% intergenic (‑173/+61) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,778 C→G 14.9% intergenic (‑178/+56) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,779 G→C 12.5% intergenic (‑179/+55) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,782 G→C 13.6% intergenic (‑182/+52) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,783 C→G 14.0% intergenic (‑183/+51) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,788 T→C 14.3% intergenic (‑188/+46) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,897,791 C→T 13.9% intergenic (‑191/+43) PP_5172 ← / ← PP_5173 hypothetical protein/RND family transporter
RA 5,903,165 A→C 12.1% intergenic (‑129/‑139) PP_5175 ← / → PP_5176 HlyD family secretion protein/hypothetical protein
RA 5,906,148 G→A 6.7% T218I (ACC→ATC) ‡ spuF ← spermidine/putrescine ABC transporter ATP binding protein
RA 5,906,149 T→C 6.7% T218A (ACC→GCC) ‡ spuF ← spermidine/putrescine ABC transporter ATP binding protein
RA 5,907,906:1 +G 9.5% coding (61/1095 nt) spuE ← spermidine/putrescine ABC transporter substrate‑binding protein
RA 5,907,912 Δ1 bp 9.2% coding (55/1095 nt) spuE ← spermidine/putrescine ABC transporter substrate‑binding protein
RA 5,925,579:1 +C 9.6% coding (566/1083 nt) gcvT‑II ← aminomethyltransferase
RA 5,925,584 Δ1 bp 9.3% coding (561/1083 nt) gcvT‑II ← aminomethyltransferase
RA 5,925,591 C→A 5.8% R185L (CGC→CTC)  gcvT‑II ← aminomethyltransferase
RA 5,941,332 T→G 7.5% intergenic (+58/+123) yhhJ → / ← PP_5722 translation‑like protein/hypothetical protein
RA 5,941,333 T→A 7.4% intergenic (+59/+122) yhhJ → / ← PP_5722 translation‑like protein/hypothetical protein
RA 5,941,334 T→A 7.5% intergenic (+60/+121) yhhJ → / ← PP_5722 translation‑like protein/hypothetical protein
RA 5,941,335 C→A 7.1% intergenic (+61/+120) yhhJ → / ← PP_5722 translation‑like protein/hypothetical protein
RA 5,948,682 T→A 6.5% intergenic (‑63/+19) PP_mr62 ← / ← trxA Pseudomon‑Rho regulatory region/thioredoxin I
RA 5,948,683 T→A 5.8% intergenic (‑64/+18) PP_mr62 ← / ← trxA Pseudomon‑Rho regulatory region/thioredoxin I
RA 5,959,995 A→T 7.2% noncoding (74/103 nt) PP_mr63 ← rnk_pseudo ncRNA
RA 5,959,996 A→T 7.7% noncoding (73/103 nt) PP_mr63 ← rnk_pseudo ncRNA
RA 5,965,571 A→C 5.6% intergenic (+69/+31) had → / ← PP_5232 (S)‑2‑haloacid dehalogenase/hypothetical protein
RA 5,988,809 G→A 20.2% intergenic (+103/‑443) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,819 T→C 19.5% intergenic (+113/‑433) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,824 C→T 19.6% intergenic (+118/‑428) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,825 G→T 19.3% intergenic (+119/‑427) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,826 C→T 19.3% intergenic (+120/‑426) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,829 A→G 20.3% intergenic (+123/‑423) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,835 G→C 19.0% intergenic (+129/‑417) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,837 C→G 20.0% intergenic (+131/‑415) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,840 C→T 20.0% intergenic (+134/‑412) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,844 C→G 19.3% intergenic (+138/‑408) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,848 C→T 20.2% intergenic (+142/‑404) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,850 C→T 20.2% intergenic (+144/‑402) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,889 C→A 26.7% intergenic (+183/‑363) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,894 C→T 28.6% intergenic (+188/‑358) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,895 A→G 28.5% intergenic (+189/‑357) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,905 T→C 33.3% intergenic (+199/‑347) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,988,911 Δ1 bp 32.9% intergenic (+205/‑341) kefB‑III → / → PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA 5,995,016 G→A 6.4% intergenic (+144/+33) PP_5251 → / ← PP_5252 transporter/hypothetical protein
RA 5,995,018 T→A 6.3% intergenic (+146/+31) PP_5251 → / ← PP_5252 transporter/hypothetical protein
RA 5,995,020 T→C 6.3% intergenic (+148/+29) PP_5251 → / ← PP_5252 transporter/hypothetical protein
RA 6,002,326 G→T 5.3% intergenic (‑26/+120) amaA ← / ← amaB L‑pipecolate oxidase/L‑piperidine‑6‑carboxylate dehydrogenase
RA 6,011,493 G→C 6.1% K115N (AAG→AAC)  rep → single‑stranded DNA dependent ATPase
RA 6,011,500 C→A 5.2% L118M (CTG→ATG)  rep → single‑stranded DNA dependent ATPase
RA 6,013,836 G→A 13.1% intergenic (+41/+69) xpt → / ← PP_5266 xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA 6,013,838 A→G 13.1% intergenic (+43/+67) xpt → / ← PP_5266 xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA 6,013,846 T→G 14.4% intergenic (+51/+59) xpt → / ← PP_5266 xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA 6,013,885 T→C 100% intergenic (+90/+20) xpt → / ← PP_5266 xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA 6,023,159 G→A 6.6% intergenic (+74/+70) PP_5273 → / ← PP_5274 oxidoreductase/hypothetical protein
RA 6,023,160 T→C 7.8% intergenic (+75/+69) PP_5273 → / ← PP_5274 oxidoreductase/hypothetical protein
RA 6,027,222 A→T 5.2% F212Y (TTC→TAC)  PP_5277 ← MFS transporter
RA 6,035,933 A→G 5.7% I155V (ATC→GTC)  algC → phosphomannomutase/phosphoglucomutase
RA 6,045,721 A→C 6.8% R130R (CGT→CGG) ‡ PP_5298 ← glutamine amidotransferase
RA 6,045,722 C→A 6.9% R130L (CGT→CTT) ‡ PP_5298 ← glutamine amidotransferase
RA 6,045,725 T→G 7.9% Q129P (CAG→CCG)  PP_5298 ← glutamine amidotransferase
RA 6,061,252 T→C 8.0% D39G (GAC→GGC)  hupA ← DNA‑binding protein HU‑alpha
RA 6,061,256 T→G 8.1% K38Q (AAG→CAG)  hupA ← DNA‑binding protein HU‑alpha
RA 6,061,258 T→A 8.0% D37V (GAC→GTC)  hupA ← DNA‑binding protein HU‑alpha
RA 6,061,260 C→A 8.0% L36L (CTG→CTT)  hupA ← DNA‑binding protein HU‑alpha
RA 6,061,264 G→A 6.8% A35V (GCC→GTC)  hupA ← DNA‑binding protein HU‑alpha
RA 6,080,988 T→A 16.4% intergenic (+35/+27) PP_5332 → / ← PP_5333 hypothetical protein/hypothetical protein
RA 6,080,989 T→A 17.6% intergenic (+36/+26) PP_5332 → / ← PP_5333 hypothetical protein/hypothetical protein
RA 6,103,201 T→A 5.5% C12S (TGC→AGC)  PP_5353 → hypothetical protein
RA 6,103,207 G→A 6.6% G14S (GGC→AGC) ‡ PP_5353 → hypothetical protein
RA 6,103,209 C→G 7.0% G14G (GGC→GGG) ‡ PP_5353 → hypothetical protein
RA 6,103,211 T→C 8.9% L15P (CTG→CCG)  PP_5353 → hypothetical protein
RA 6,103,217 T→A 6.4% L17Q (CTG→CAG)  PP_5353 → hypothetical protein
RA 6,104,053 T→A 8.1% intergenic (+31/‑83) PP_5353 → / → PP_5354 hypothetical protein/hypothetical protein
RA 6,104,054 T→A 8.8% intergenic (+32/‑82) PP_5353 → / → PP_5354 hypothetical protein/hypothetical protein
RA 6,129,160 A→C 8.1% intergenic (+22/+45) PP_5376 → / ← PP_5377 hypothetical protein/hypothetical protein
RA 6,129,170 C→T 9.7% intergenic (+32/+35) PP_5376 → / ← PP_5377 hypothetical protein/hypothetical protein
RA 6,129,173 A→T 9.7% intergenic (+35/+32) PP_5376 → / ← PP_5377 hypothetical protein/hypothetical protein
RA 6,129,176 A→G 9.9% intergenic (+38/+29) PP_5376 → / ← PP_5377 hypothetical protein/hypothetical protein
RA 6,157,486 G→T 5.8% G309V (GGA→GTA)  PP_5400 → hypothetical protein
RA 6,167,902 C→G 8.8% P328A (CCA→GCA) ‡ PP_5407 → TnsD‑like transposition protein
RA 6,167,904 A→T 8.0% P328P (CCA→CCT) ‡ PP_5407 → TnsD‑like transposition protein
RA 6,167,906 C→G 8.2% A329G (GCG→GGG)  PP_5407 → TnsD‑like transposition protein
RA 6,174,708 G→T 7.1% intergenic (‑70/+49) glmU ← / ← atpC bifunctional N‑acetyl glucosamine‑1‑phosphate uridyltransferase/glucosamine‑1‑phosphate acetyl transferase/ATP synthase subunit epsilon

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_002947 171361–176317 176317 1–4957 25 [24] [24] 25 PP_16SA–[PP_5SA] PP_16SA,PP_23SA,[PP_5SA]
* * ÷ NC_002947 176625–181702 181702 1–5078 25 [24] [24] 26 PP_16SB–[PP_r01] PP_16SB,PP_23SB,[PP_r01]
* * ÷ NC_002947 2038174 2038379 206 25 [24] [24] 25 [rffE] [rffE]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_002947 = 1451458 (0.890)3 (0.050) 3/250 NT 5.2% coding (1185/2421 nt) gyrB DNA gyrase subunit B
?NC_002947 = 14535 55 (0.890)coding (1206/2421 nt) gyrB DNA gyrase subunit B
* ? NC_002947 21747 =71 (1.090)4 (0.070) 4/246 NT 5.7% coding (1550/1917 nt) PP_0016 hypothetical protein
?NC_002947 21788 = 66 (1.090)coding (1591/1917 nt) PP_0016 hypothetical protein
* ? NC_002947 38445 =55 (0.850)5 (0.080) 4/252 NT 8.7% coding (185/984 nt) PP_0034 bactoprenol glycosyl‑transferase
?NC_002947 38482 = 52 (0.840)coding (148/984 nt) PP_0034 bactoprenol glycosyl‑transferase
* ? NC_002947 = 6947665 (1.000)5 (0.080) 5/250 NT 6.6% coding (371/528 nt) gmhB D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
?NC_002947 = 69511 80 (1.300)coding (336/528 nt) gmhB D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
* ? NC_002947 = 6975273 (1.120)4 (0.060) 4/250 NT 6.1% coding (95/528 nt) gmhB D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
?NC_002947 = 69823 55 (0.890)coding (24/528 nt) gmhB D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
* ? NC_002947 = 7724089 (1.370)5 (0.080) 5/256 NT 5.4% coding (304/1311 nt) rsmB ribosomal RNA small subunit methyltransferase B
?NC_002947 = 77271 88 (1.390)coding (273/1311 nt) rsmB ribosomal RNA small subunit methyltransferase B
* ? NC_002947 87921 =65 (1.000)4 (0.060) 4/258 NT 5.6% coding (1397/1518 nt) betC choline‑sulfatase
?NC_002947 88027 = 71 (1.120)coding (1291/1518 nt) betC choline‑sulfatase
* ? NC_002947 102940 =59 (0.910)4 (0.070) 4/248 NT 6.5% coding (1760/2052 nt) prlC oligopeptidase A
?NC_002947 103008 = 60 (0.980)coding (1828/2052 nt) prlC oligopeptidase A
* ? NC_002947 = 11615179 (1.210)4 (0.060) 4/252 NT 5.1% coding (454/894 nt) PP_0110 CyoE‑like protoheme IX farnesyltransferase
?NC_002947 = 116188 72 (1.160)coding (491/894 nt) PP_0110 CyoE‑like protoheme IX farnesyltransferase
* ? NC_002947 = 14939754 (0.830)3 (0.050) 3/250 NT 5.5% coding (423/792 nt) PP_0141 ABC transporter ATP‑binding protein
?NC_002947 = 149444 52 (0.840)coding (376/792 nt) PP_0141 ABC transporter ATP‑binding protein
* ? NC_002947 = 176399NA (NA)12 (0.190)
+CGAAA
9/254 NT 16.1% intergenic (+43/‑420) PP_5SA/PP_16SB 5S ribosomal RNA/16S ribosomal RNA
?NC_002947 = 182013 65 (1.000)intergenic (+2/+63) PP_5SB/PP_0160 5S ribosomal RNA/ferrioxamine receptor
* ? NC_002947 = 18970578 (1.200)4 (0.060) 4/254 NT 5.3% coding (1814/1947 nt) PP_0165 GGDEF domain‑containing protein
?NC_002947 = 189728 68 (1.090)coding (1837/1947 nt) PP_0165 GGDEF domain‑containing protein
* ? NC_002947 = 19848640 (0.610)6 (0.100) 5/256 NT 15.0% coding (3992/26049 nt) PP_0168 putative surface adhesion protein
?NC_002947 = 199110 29 (0.460)coding (4616/26049 nt) PP_0168 putative surface adhesion protein
* ? NC_002947 = 19946570 (1.080)5 (0.080) 3/252 NT 7.1% coding (4971/26049 nt) PP_0168 putative surface adhesion protein
?NC_002947 = 201400 64 (1.030)coding (6906/26049 nt) PP_0168 putative surface adhesion protein
* ? NC_002947 205646 =54 (0.830)5 (0.080) 5/258 NT 8.7% coding (11152/26049 nt) PP_0168 putative surface adhesion protein
?NC_002947 209593 = NA (NA)coding (15099/26049 nt) PP_0168 putative surface adhesion protein
* ? NC_002947 = 23079073 (1.120)4 (0.070) 4/248 NT 5.3% coding (451/1419 nt) PP_0179 putative efflux transporter
?NC_002947 = 230851 75 (1.230)coding (512/1419 nt) PP_0179 putative efflux transporter
* ? NC_002947 237212 =73 (1.120)5 (0.080) 4/248 NT 7.1% coding (93/744 nt) algR alginate biosynthesis regulatory protein
?NC_002947 237246 = 63 (1.030)coding (127/744 nt) algR alginate biosynthesis regulatory protein
* ? NC_002947 = 24406076 (1.170)4 (0.070) 4/248 NT 5.2% coding (111/663 nt) fkl FKBP‑type peptidyl‑prolyl cis‑trans isomerase
?NC_002947 = 244104 74 (1.210)coding (67/663 nt) fkl FKBP‑type peptidyl‑prolyl cis‑trans isomerase
* ? NC_002947 249203 =60 (0.920)5 (0.080) 5/252 NT 7.5% coding (645/747 nt) qmcA membrane protease family protein
?NC_002947 249245 = 66 (1.060)coding (603/747 nt) qmcA membrane protease family protein
* ? NC_002947 = 26245751 (0.780)3 (0.050) 3/254 NT 5.6% coding (939/966 nt) PP_0210 phycobiliprotein
?NC_002947 = 262523 52 (0.830)coding (40/282 nt) PP_0211 hypothetical protein
* ? NC_002947 = 27625956 (0.860)3 (0.050) 3/246 NT 5.2% coding (909/1221 nt) PP_0223 DszC family monooxygenase
?NC_002947 = 276281 57 (0.940)coding (887/1221 nt) PP_0223 DszC family monooxygenase
* ? NC_002947 277706 =61 (0.940)4 (0.070) 4/246 NT 6.4% coding (800/1242 nt) PP_0224 DszC family monooxygenase
?NC_002947 277759 = 60 (0.990)coding (747/1242 nt) PP_0224 DszC family monooxygenase
* ? NC_002947 = 31695460 (0.920)4 (0.060) 3/252 NT 6.5% coding (977/1407 nt) dctD‑I C4‑dicarboxylate transport transcriptional regulator
?NC_002947 = 316978 57 (0.920)coding (953/1407 nt) dctD‑I C4‑dicarboxylate transport transcriptional regulator
* ? NC_002947 317963 =59 (0.910)5 (0.080) 5/258 NT 7.1% coding (1779/1815 nt) PP_0264 sensor histidine kinase
?NC_002947 318058 = 73 (1.150)coding (1684/1815 nt) PP_0264 sensor histidine kinase
* ? NC_002947 325042 =73 (1.120)4 (0.060) 4/250 NT 5.2% coding (328/1320 nt) oprQ outer‑membrane porin D
?NC_002947 325096 = 77 (1.250)coding (382/1320 nt) oprQ outer‑membrane porin D
* ? NC_002947 = 38085515 (0.230)3 (0.060) 3/218 NT 13.2% intergenic (+45/+64) gbcB/PP_0317 glycine‑betaine dioxygenase subunit/methyl‑accepting chemotaxis transducer
?NC_002947 = 380889 27 (0.500)intergenic (+79/+30) gbcB/PP_0317 glycine‑betaine dioxygenase subunit/methyl‑accepting chemotaxis transducer
* ? NC_002947 400299 =NA (NA)4 (0.060) 4/256 NT 12.8% intergenic (+34/‑116) PP_0333/PP_0334 hypothetical protein/transposase
?NC_002947 400368 = 28 (0.430)intergenic (+103/‑47) PP_0333/PP_0334 hypothetical protein/transposase
* ? NC_002947 431740 =64 (0.980)4 (0.060) 4/254 NT 6.2% coding (574/1938 nt) PP_0354 CBS domain‑containing protein
?NC_002947 431794 = 60 (0.960)coding (520/1938 nt) PP_0354 CBS domain‑containing protein
* ? NC_002947 437647 =57 (0.880)3 (0.050) 3/248 NT 6.3% coding (713/1008 nt) rdoA serine/threonine protein kinase
?NC_002947 437711 = 36 (0.590)coding (649/1008 nt) rdoA serine/threonine protein kinase
* ? NC_002947 478261 =31 (0.480)7 (0.140) 5/204 NT 31.9% intergenic (+9/+101) PP_0393/cca 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase/multifunctional tRNA nucleotidyltransferase/2',3'‑cyclic phosphodiesterase/2' nucleotidase/phosphatase
?NC_002947 478356 = 6 (0.120)intergenic (+104/+6) PP_0393/cca 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase/multifunctional tRNA nucleotidyltransferase/2',3'‑cyclic phosphodiesterase/2' nucleotidase/phosphatase
* ? NC_002947 = 49282957 (0.880)3 (0.050) 3/252 NT 5.3% coding (279/1020 nt) PP_0405 hypothetical protein
?NC_002947 = 492862 52 (0.840)coding (312/1020 nt) PP_0405 hypothetical protein
* ? NC_002947 = 49702390 (1.380)5 (0.080) 5/248 NT 5.3% coding (895/2388 nt) PP_0409 two‑component system sensor histidine kinase
?NC_002947 = 497096 93 (1.520)coding (968/2388 nt) PP_0409 two‑component system sensor histidine kinase
* ? NC_002947 503484 =89 (1.370)4 (0.060) 4/252 NT 5.0% coding (515/828 nt) PP_0414 polyamine ABC transporter permease
?NC_002947 503527 = 67 (1.080)coding (558/828 nt) PP_0414 polyamine ABC transporter permease
* ? NC_002947 505695 =80 (1.230)4 (0.060) 4/250 NT 5.1% coding (189/1482 nt) trpE anthranilate synthase component 1
?NC_002947 505753 = 73 (1.190)coding (247/1482 nt) trpE anthranilate synthase component 1
* ? NC_002947 = 50690958 (0.890)5 (0.080) 5/248 NT 8.0% coding (1403/1482 nt) trpE anthranilate synthase component 1
?NC_002947 = 506932 60 (0.980)coding (1426/1482 nt) trpE anthranilate synthase component 1
* ? NC_002947 = 54833882 (1.260)4 (0.070) 4/248 NT 5.2% coding (1188/2148 nt) fusA elongation factor G 1
?NC_002947 = 548382 70 (1.150)coding (1232/2148 nt) fusA elongation factor G 1
* ? NC_002947 565405 =60 (0.920)4 (0.060) 4/256 NT 6.3% coding (885/1440 nt) katA catalase
?NC_002947 565446 = 60 (0.950)coding (926/1440 nt) katA catalase
* ? NC_002947 = 56837877 (1.180)4 (0.060) 4/258 NT 5.2% coding (1118/2835 nt) uvrA uvrABC excinuclease protein A
?NC_002947 = 568410 71 (1.120)coding (1086/2835 nt) uvrA uvrABC excinuclease protein A
* ? NC_002947 = 58218365 (1.000)4 (0.060) 3/258 NT 5.5% coding (49/1923 nt) selB selenocysteyl‑tRNA‑specific translation elongation factor
?NC_002947 = 582217 75 (1.180)coding (83/1923 nt) selB selenocysteyl‑tRNA‑specific translation elongation factor
* ? NC_002947 594771 =31 (0.480)4 (0.070) 3/242 NT 7.2% intergenic (‑10/+117) PP_0505/PP_0506 hypothetical protein/ABC transporter permease
?NC_002947 594856 = 74 (1.240)intergenic (‑95/+32) PP_0505/PP_0506 hypothetical protein/ABC transporter permease
* ? NC_002947 611927 =NA (NA)9 (0.150) 7/246 NT NA coding (824/966 nt) PP_0526 transposase
?NC_002947 611970 = NA (NA)coding (867/966 nt) PP_0526 transposase
* ? NC_002947 615051 =70 (1.080)4 (0.060) 4/252 NT 5.8% coding (196/888 nt) ispA farnesyl diphosphate synthase
?NC_002947 615099 = 64 (1.030)coding (148/888 nt) ispA farnesyl diphosphate synthase
* ? NC_002947 = 68515976 (1.170)4 (0.070) 3/248 NT 5.4% coding (1088/2400 nt) cadA‑II cadmium translocating P‑type ATPase
?NC_002947 = 685252 70 (1.150)coding (995/2400 nt) cadA‑II cadmium translocating P‑type ATPase
* ? NC_002947 726896 =36 (0.550)4 (0.070) 4/236 NT 8.4% intergenic (‑143/+124) PP_0620/PP_0621 GntR family transcriptional regulator/hypothetical protein
?NC_002947 726983 = 55 (0.950)intergenic (‑230/+37) PP_0620/PP_0621 GntR family transcriptional regulator/hypothetical protein
* ? NC_002947 = 741869NA (NA)8 (0.130) 5/252 NT NA intergenic (+469/‑31) PP_t12/PP_0635 tRNA‑Thr/group II intron‑encoding maturase
?NC_002947 = 741902 NA (NA)coding (3/1422 nt) PP_0635 group II intron‑encoding maturase
* ? NC_002947 742597 =NA (NA)5 (0.080) 4/258 NT NA coding (698/1422 nt) PP_0635 group II intron‑encoding maturase
?NC_002947 742657 = NA (NA)coding (758/1422 nt) PP_0635 group II intron‑encoding maturase
* ? NC_002947 755172 =67 (1.030)3 (0.050) 3/244 NT 5.0% intergenic (‑18/‑233) PP_0645/PP_0646 hypothetical protein/hypothetical protein
?NC_002947 755232 = 51 (0.850)intergenic (‑78/‑173) PP_0645/PP_0646 hypothetical protein/hypothetical protein
* ? NC_002947 783402 =54 (0.830)3 (0.050) 3/250 NT 5.5% coding (2524/3831 nt) PP_0672 sensory box protein
?NC_002947 783435 = 52 (0.840)coding (2491/3831 nt) PP_0672 sensory box protein
* ? NC_002947 = 79684081 (1.240)4 (0.070) 4/232 NT 5.4% intergenic (+42/‑148) PP_0681/PP_0682 hypothetical protein/inner membrane protein
?NC_002947 = 796878 68 (1.190)intergenic (+80/‑110) PP_0681/PP_0682 hypothetical protein/inner membrane protein
* ? NC_002947 877021 =71 (1.090)4 (0.070) 3/240 NT 5.9% coding (138/999 nt) rsmC 16S rRNA methyltransferase
?NC_002947 877102 = 63 (1.070)coding (57/999 nt) rsmC 16S rRNA methyltransferase
* ? NC_002947 883223 =61 (0.940)5 (0.080) 5/252 NT 7.9% coding (826/1365 nt) PP_0766 hypothetical protein
?NC_002947 883266 = 58 (0.930)coding (869/1365 nt) PP_0766 hypothetical protein
* ? NC_002947 = 89615150 (0.770)6 (0.100) 6/240 NT 10.0% coding (264/1191 nt) PP_0778 group 1 family glycosyl transferase
?NC_002947 = 896209 62 (1.050)coding (206/1191 nt) PP_0778 group 1 family glycosyl transferase
* ? NC_002947 967850 =77 (1.180)4 (0.070) 4/234 NT 5.4% intergenic (‑29/+139) PP_0830/PP_0831 acetyltransferase/hypothetical protein
?NC_002947 967941 = 72 (1.250)intergenic (‑120/+48) PP_0830/PP_0831 acetyltransferase/hypothetical protein
* ? NC_002947 977784 =51 (0.780)3 (0.050) 3/248 NT 5.3% coding (736/786 nt) cysE serine acetyltransferase
?NC_002947 977853 = 60 (0.980)intergenic (+19/‑161) cysE/iscR serine acetyltransferase/DNA‑binding transcriptional regulator IscR
* ? NC_002947 982038 =81 (1.240)5 (0.080) 5/250 NT 7.1% coding (915/1863 nt) hscA DnaK‑like molecular chaperone
?NC_002947 982093 = 55 (0.890)coding (970/1863 nt) hscA DnaK‑like molecular chaperone
* ? NC_002947 1021094 =50 (0.770)3 (0.050) 3/252 NT 5.7% coding (893/1011 nt) dppB dipeptide ABC transporter permease
?NC_002947 1021134 = 52 (0.840)coding (853/1011 nt) dppB dipeptide ABC transporter permease
* ? NC_002947 1028604 =74 (1.140)5 (0.080) 5/252 NT 6.9% coding (136/1626 nt) dppA‑III dipeptide ABC transporter substrate‑binding protein
?NC_002947 1028658 = 65 (1.050)coding (82/1626 nt) dppA‑III dipeptide ABC transporter substrate‑binding protein
* ? NC_002947 1055572 =78 (1.200)4 (0.060) 4/256 NT 5.3% coding (260/1332 nt) PP_0913 hypothetical protein
?NC_002947 1055610 = 67 (1.060)coding (222/1332 nt) PP_0913 hypothetical protein
* ? NC_002947 1083135 =47 (0.720)3 (0.050) 3/248 NT 6.2% coding (2790/3822 nt) PP_0938 hypothetical protein
?NC_002947 1083175 = 46 (0.750)coding (2830/3822 nt) PP_0938 hypothetical protein
* ? NC_002947 1114870 =22 (0.340)4 (0.080) 4/214 NT 19.6% intergenic (‑64/+115) rlmF/valS ribosomal RNA large subunit methyltransferase F/valine‑‑tRNA ligase
?NC_002947 1114946 = 15 (0.280)intergenic (‑140/+39) rlmF/valS ribosomal RNA large subunit methyltransferase F/valine‑‑tRNA ligase
* ? NC_002947 1118321 =77 (1.180)5 (0.080) 4/254 NT 6.3% coding (394/429 nt) holC DNA polymerase III subunit chi
?NC_002947 1118359 = 74 (1.180)coding (356/429 nt) holC DNA polymerase III subunit chi
* ? NC_002947 = 112533077 (1.180)4 (0.060) 3/254 NT 5.2% coding (1217/1377 nt) tdcG‑II L‑serine dehydratase
?NC_002947 = 1125398 72 (1.150)coding (1149/1377 nt) tdcG‑II L‑serine dehydratase
* ? NC_002947 1130825 =82 (1.260)5 (0.080) 5/250 NT 6.6% coding (658/774 nt) PP_0991 hypothetical protein
?NC_002947 1130861 = 63 (1.020)coding (622/774 nt) PP_0991 hypothetical protein
* ? NC_002947 1141102 =62 (0.950)3 (0.050) 3/254 NT 5.1% coding (1327/1428 nt) arcD‑I arginine/ornithine antiporter
?NC_002947 1141161 = 51 (0.810)coding (1268/1428 nt) arcD‑I arginine/ornithine antiporter
* ? NC_002947 = 117619974 (1.140)6 (0.100) 5/252 NT 8.7% coding (630/1470 nt) guaB IMP dehydrogenase and single strand DNA binding factor
?NC_002947 = 1176283 56 (0.900)coding (714/1470 nt) guaB IMP dehydrogenase and single strand DNA binding factor
* ? NC_002947 1189969 =63 (0.970)4 (0.060) 3/256 NT 5.7% coding (132/291 nt) tatB‑I Sec‑independent protein translocase TatB
?NC_002947 1190047 = 72 (1.140)coding (54/291 nt) tatB‑I Sec‑independent protein translocase TatB
* ? NC_002947 = 121628254 (0.830)5 (0.080) 5/244 NT 8.4% coding (677/4305 nt) PP_1061 ATP‑dependent DNA helicase
?NC_002947 = 1216314 59 (0.980)coding (645/4305 nt) PP_1061 ATP‑dependent DNA helicase
* ? NC_002947 = 123405473 (1.120)4 (0.060) 3/252 NT 5.2% coding (1232/1500 nt) glpK glycerol kinase
?NC_002947 = 1234089 75 (1.210)coding (1197/1500 nt) glpK glycerol kinase
* ? NC_002947 = 125736761 (0.940)5 (0.080) 5/248 NT 8.0% intergenic (‑53/‑91) PP_mr14/dcd cspA regulatory region/deoxycytidine triphosphate deaminase
?NC_002947 = 1257394 57 (0.930)intergenic (‑80/‑64) PP_mr14/dcd cspA regulatory region/deoxycytidine triphosphate deaminase
* ? NC_002947 = 125782977 (1.180)6 (0.100) 4/244 NT 7.4% coding (372/567 nt) dcd deoxycytidine triphosphate deaminase
?NC_002947 = 1257855 78 (1.300)coding (398/567 nt) dcd deoxycytidine triphosphate deaminase
* ? NC_002947 1270104 =72 (1.110)4 (0.060) 4/252 NT 5.9% coding (492/705 nt) PP_1110 serine acetyltransferase
?NC_002947 1270147 = 58 (0.930)coding (535/705 nt) PP_1110 serine acetyltransferase
* ? NC_002947 1288899 =63 (0.970)4 (0.060) 4/250 NT 6.1% coding (172/2349 nt) PP_1126 hydrolase
?NC_002947 1288937 = 63 (1.020)coding (210/2349 nt) PP_1126 hydrolase
* ? NC_002947 1294685 =98 (1.510)8 (0.130) 8/250 NT 8.2% coding (166/465 nt) slyB outer membrane lipoprotein
?NC_002947 1294721 = 87 (1.410)coding (202/465 nt) slyB outer membrane lipoprotein
* ? NC_002947 1296784 =NA (NA)8 (0.130) 5/250 NT NA intergenic (‑537/‑29) nhaA‑I/PP_1133 Na(+)/H(+) antiporter NhaA/transposase
?NC_002947 1296822 = NA (NA)coding (10/1329 nt) PP_1133 transposase
* ? NC_002947 = 1296790NA (NA)4 (0.060) 3/250 NT NA intergenic (‑543/‑23) nhaA‑I/PP_1133 Na(+)/H(+) antiporter NhaA/transposase
?NC_002947 = 1296814 NA (NA)coding (2/1329 nt) PP_1133 transposase
* ? NC_002947 = 1298264NA (NA)6 (0.090) 5/258 NT NA intergenic (+123/+306) PP_1133/PP_1134 transposase/hypothetical protein
?NC_002947 = 1298312 NA (NA)intergenic (+171/+258) PP_1133/PP_1134 transposase/hypothetical protein
* ? NC_002947 1298266 =NA (NA)7 (0.110) 5/256 NT NA intergenic (+125/+304) PP_1133/PP_1134 transposase/hypothetical protein
?NC_002947 1298312 = NA (NA)intergenic (+171/+258) PP_1133/PP_1134 transposase/hypothetical protein
* ? NC_002947 = 131177652 (0.800)4 (0.070) 3/246 NT 9.6% intergenic (‑244/+34) PP_1144/rapA membrane protein/RNA polymerase‑associated protein RapA
?NC_002947 5594166 = 27 (0.450)intergenic (‑113/+32) PP_4921/thiC NCS1 family transporter/phosphomethylpyrimidine synthase
* ? NC_002947 1324755 =48 (0.740)4 (0.060) 3/252 NT 7.2% coding (276/897 nt) yfdC inner membrane protein
?NC_002947 1324815 = 57 (0.920)coding (216/897 nt) yfdC inner membrane protein
* ? NC_002947 = 1331705NA (NA)3 (0.050) 3/254 NT NA coding (930/1644 nt) PP_1157 acetolactate synthase
?NC_002947 = 1331731 NA (NA)coding (956/1644 nt) PP_1157 acetolactate synthase
* ? NC_002947 = 134612173 (1.120)5 (0.080) 4/250 NT 6.8% coding (772/807 nt) udh uronate dehydrogenase
?NC_002947 = 1346145 69 (1.120)coding (748/807 nt) udh uronate dehydrogenase
* ? NC_002947 1393111 =71 (1.090)4 (0.060) 4/254 NT 5.5% coding (96/525 nt) ruvC crossover junction endodeoxyribonuclease RuvC
?NC_002947 1393154 = 70 (1.120)coding (139/525 nt) ruvC crossover junction endodeoxyribonuclease RuvC
* ? NC_002947 = 140814543 (0.660)4 (0.060) 4/254 NT 7.4% coding (598/1509 nt) PP_1230 hypothetical protein
?NC_002947 = 1408184 59 (0.940)coding (637/1509 nt) PP_1230 hypothetical protein
* ? NC_002947 1411391 =71 (1.090)4 (0.060) 3/250 NT 6.2% coding (544/1437 nt) PP_1232 hypothetical protein
?NC_002947 1411454 = 53 (0.860)coding (481/1437 nt) PP_1232 hypothetical protein
* ? NC_002947 1419549 =41 (0.630)7 (0.140) 6/206 NT 27.5% intergenic (‑38/+98) PP_1242/PP_1244 hypothetical protein/hypothetical protein
?NC_002947 1419637 = 5 (0.100)intergenic (‑126/+10) PP_1242/PP_1244 hypothetical protein/hypothetical protein
* ? NC_002947 = 142031958 (0.890)4 (0.060) 3/250 NT 6.4% intergenic (‑279/‑202) PP_mr17/PP_1245 C4 ncRNA/hypothetical protein
?NC_002947 = 1420345 62 (1.010)intergenic (‑305/‑176) PP_mr17/PP_1245 C4 ncRNA/hypothetical protein
* ? NC_002947 = 142152660 (0.920)8 (0.130) 8/250 NT 11.4% coding (107/1860 nt) PP_1246 hypothetical protein
?NC_002947 = 1421564 67 (1.090)coding (145/1860 nt) PP_1246 hypothetical protein
* ? NC_002947 = 1427107NA (NA)12 (0.190) 6/252 NT NA coding (1005/1422 nt) PP_1250 group II intron‑encoding maturase
?NC_002947 = 1427157 NA (NA)coding (1055/1422 nt) PP_1250 group II intron‑encoding maturase
* ? NC_002947 = 143324355 (0.850)5 (0.080) 5/250 NT 7.9% coding (1141/1248 nt) PP_1255 cis‑4‑hydroxy‑D‑proline oxidase
?NC_002947 = 1433258 65 (1.060)coding (1126/1248 nt) PP_1255 cis‑4‑hydroxy‑D‑proline oxidase
* ? NC_002947 1445018 =74 (1.140)4 (0.060) 4/252 NT 5.2% coding (642/1530 nt) PP_1263 fusaric acid resistance protein
?NC_002947 1445074 = 76 (1.220)coding (698/1530 nt) PP_1263 fusaric acid resistance protein
* ? NC_002947 1448517 =80 (1.230)5 (0.080) 4/256 NT 6.2% coding (237/861 nt) PP_1266 fusaric acid resistance protein
?NC_002947 1448572 = 74 (1.170)coding (292/861 nt) PP_1266 fusaric acid resistance protein
* ? NC_002947 = 145316872 (1.110)4 (0.070) 3/248 NT 6.2% coding (1330/1542 nt) PP_1271 putative Multidrug efflux MFS transporter
?NC_002947 = 1453262 53 (0.870)coding (1424/1542 nt) PP_1271 putative Multidrug efflux MFS transporter
* ? NC_002947 1487006 =26 (0.400)8 (0.160) 7/204 NT 36.3% intergenic (+22/+108) yhdZ/degS amino acid ABC transporter ATP‑binding protein/serine endoprotease DegS
?NC_002947 1487096 = 8 (0.160)intergenic (+112/+18) yhdZ/degS amino acid ABC transporter ATP‑binding protein/serine endoprotease DegS
* ? NC_002947 = 15317696 (0.090)3 (0.060) 3/216 NT 22.3% coding (107/630 nt) PP_1344 hypothetical protein
?NC_002947 = 1531817 16 (0.300)coding (59/630 nt) PP_1344 hypothetical protein
* ? NC_002947 = 158749275 (1.150)5 (0.080) 4/256 NT 6.3% intergenic (‑87/‑97) PP_1391/PP_1392 LysR family transcriptional regulator/NAD‑binding protein
?NC_002947 = 1587553 76 (1.200)intergenic (‑148/‑36) PP_1391/PP_1392 LysR family transcriptional regulator/NAD‑binding protein
* ? NC_002947 1587794 =55 (0.850)6 (0.100) 6/256 NT 9.5% coding (206/615 nt) PP_1392 NAD‑binding protein
?NC_002947 1587826 = 61 (0.970)coding (238/615 nt) PP_1392 NAD‑binding protein
* ? NC_002947 = 160342762 (0.950)4 (0.060) 4/250 NT 5.7% coding (985/1011 nt) PP_1406 hypothetical protein
?NC_002947 = 1603463 73 (1.190)coding (949/1011 nt) PP_1406 hypothetical protein
* ? NC_002947 1607679 =58 (0.890)4 (0.060) 4/250 NT 7.0% intergenic (‑146/+198) PP_1408/rsuA (R)‑3‑hydroxydecanoyl‑ACP:CoA transacylase/16S rRNA pseudouridine(516) synthase
?NC_002947 1607722 = 51 (0.830)intergenic (‑189/+155) PP_1408/rsuA (R)‑3‑hydroxydecanoyl‑ACP:CoA transacylase/16S rRNA pseudouridine(516) synthase
* ? NC_002947 = 163592068 (1.040)4 (0.060) 3/250 NT 5.5% coding (97/684 nt) recO DNA repair protein RecO
?NC_002947 = 1635965 73 (1.190)coding (142/684 nt) recO DNA repair protein RecO
* ? NC_002947 = 164173760 (0.920)4 (0.060) 3/252 NT 6.7% intergenic (‑47/+43) cmoA/PP_1442 tRNA 5‑methoxyuridine(34)/uridine‑5‑oxyacetic acid(34) metyltransferase CmoA/hypothetical protein
?NC_002947 = 1641757 54 (0.870)intergenic (‑67/+23) cmoA/PP_1442 tRNA 5‑methoxyuridine(34)/uridine‑5‑oxyacetic acid(34) metyltransferase CmoA/hypothetical protein
* ? NC_002947 1657908 =63 (0.970)3 (0.050) 3/248 NT 5.3% coding (586/1698 nt) PP_1450 TPS family activation/secretion protein
?NC_002947 1657960 = 47 (0.770)coding (534/1698 nt) PP_1450 TPS family activation/secretion protein
* ? NC_002947 1659485 =71 (1.090)5 (0.080) 5/254 NT 6.6% coding (283/552 nt) PP_1452 MutT/nudix family protein
?NC_002947 1659535 = 74 (1.180)coding (233/552 nt) PP_1452 MutT/nudix family protein
* ? NC_002947 1661709 =82 (1.260)5 (0.080) 4/250 NT 6.4% coding (381/468 nt) PP_1456 membrane protein
?NC_002947 1661749 = 69 (1.120)coding (421/468 nt) PP_1456 membrane protein
* ? NC_002947 1693906 =63 (0.970)4 (0.070) 4/248 NT 6.8% coding (375/507 nt) PP_1489 CheW domain‑containing protein
?NC_002947 1693965 = 51 (0.830)coding (434/507 nt) PP_1489 CheW domain‑containing protein
* ? NC_002947 1725387 =50 (0.770)5 (0.080) 5/256 NT 9.9% coding (214/399 nt) PP_1519 lipoprotein
?NC_002947 1725428 = 43 (0.680)coding (173/399 nt) PP_1519 lipoprotein
* ? NC_002947 1727918 =67 (1.030)4 (0.060) 4/252 NT 6.4% coding (246/2487 nt) plsB glycerol‑3‑phosphate acyltransferase
?NC_002947 1727976 = 53 (0.850)coding (188/2487 nt) plsB glycerol‑3‑phosphate acyltransferase
* ? NC_002947 1731163 =22 (0.340)5 (0.100) 5/208 NT 21.1% intergenic (‑76/+115) dapE/PP_1526 succinyl‑diaminopimelate desuccinylase/beta‑(1‑3)‑glucosyl transferase
?NC_002947 1731255 = 20 (0.390)intergenic (‑168/+23) dapE/PP_1526 succinyl‑diaminopimelate desuccinylase/beta‑(1‑3)‑glucosyl transferase
* ? NC_002947 = 173209660 (0.920)3 (0.050) 3/248 NT 5.1% coding (1774/2592 nt) PP_1526 beta‑(1‑3)‑glucosyl transferase
?NC_002947 = 1732123 56 (0.920)coding (1747/2592 nt) PP_1526 beta‑(1‑3)‑glucosyl transferase
* ? NC_002947 = 174869452 (0.800)4 (0.060) 3/252 NT 7.3% intergenic (‑27/‑305) PP_1548/PP_5744 hypothetical protein/hypothetical protein
?NC_002947 = 1748725 52 (0.840)intergenic (‑58/‑274) PP_1548/PP_5744 hypothetical protein/hypothetical protein
* ? NC_002947 = 176255092 (1.410)6 (0.100) 3/254 NT 6.6% coding (184/477 nt) PP_1569 hypothetical protein
?NC_002947 = 1762579 82 (1.310)coding (213/477 nt) PP_1569 hypothetical protein
* ? NC_002947 = 177672557 (0.880)6 (0.100) 5/248 NT 9.2% coding (328/501 nt) PP_1584 hypothetical protein
?NC_002947 = 1776759 65 (1.060)coding (362/501 nt) PP_1584 hypothetical protein
* ? NC_002947 1780555 =77 (1.180)6 (0.100) 4/252 NT 7.5% coding (789/1197 nt) dapC N‑succinyl‑L,L‑diaminopimelate aminotransferase
?NC_002947 1780593 = 74 (1.190)coding (751/1197 nt) dapC N‑succinyl‑L,L‑diaminopimelate aminotransferase
* ? NC_002947 1785193 =57 (0.880)4 (0.070) 4/248 NT 6.6% noncoding (72/100 nt) PP_mr21 t44 ncRNA
?NC_002947 1785229 = 59 (0.970)intergenic (+8/‑18) PP_mr21/rpsB t44 ncRNA/30S ribosomal protein S2
* ? NC_002947 1799851 =29 (0.450)6 (0.110) 5/218 NT 25.6% intergenic (+21/‑166) rnhB/dnaEA ribonuclease HII/DNA polymerase III subunit alpha
?NC_002947 1799939 = 11 (0.210)intergenic (+109/‑78) rnhB/dnaEA ribonuclease HII/DNA polymerase III subunit alpha
* ? NC_002947 1812849 =57 (0.880)6 (0.090) 6/258 NT 9.7% coding (328/1116 nt) frmA glutathione‑dependent formaldehyde dehydrogenase
?NC_002947 1812891 = 56 (0.880)coding (370/1116 nt) frmA glutathione‑dependent formaldehyde dehydrogenase
* ? NC_002947 1824128 =74 (1.140)5 (0.080) 4/252 NT 6.8% coding (1126/2574 nt) mutS DNA mismatch repair protein MutS
?NC_002947 1824165 = 67 (1.080)coding (1089/2574 nt) mutS DNA mismatch repair protein MutS
* ? NC_002947 = 183777560 (0.920)4 (0.070) 4/248 NT 6.2% coding (394/672 nt) PP_1642 hypothetical protein
?NC_002947 = 1837804 65 (1.060)coding (423/672 nt) PP_1642 hypothetical protein
* ? NC_002947 = 186819448 (0.740)4 (0.060) 4/254 NT 7.2% coding (308/1296 nt) cobB cobyrinate a,c‑diamide synthase
?NC_002947 = 1868243 57 (0.910)coding (357/1296 nt) cobB cobyrinate a,c‑diamide synthase
* ? NC_002947 1868402 =60 (0.920)3 (0.050) 3/248 NT 5.2% coding (516/1296 nt) cobB cobyrinate a,c‑diamide synthase
?NC_002947 1868447 = 54 (0.880)coding (561/1296 nt) cobB cobyrinate a,c‑diamide synthase
* ? NC_002947 = 193203369 (1.060)4 (0.060) 4/254 NT 5.5% coding (501/636 nt) rluA bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA
?NC_002947 = 1932067 72 (1.150)coding (467/636 nt) rluA bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA
* ? NC_002947 = 194049573 (1.120)4 (0.070) 4/248 NT 5.1% coding (782/1578 nt) PP_1740 beta (1‑6) glucans synthase
?NC_002947 = 1940529 81 (1.330)coding (748/1578 nt) PP_1740 beta (1‑6) glucans synthase
* ? NC_002947 1974528 =52 (0.800)4 (0.060) 4/252 NT 8.0% coding (538/1086 nt) serC 3‑phosphoserine/phosphohydroxythreonine aminotransferase
?NC_002947 1974623 = 43 (0.690)coding (633/1086 nt) serC 3‑phosphoserine/phosphohydroxythreonine aminotransferase
* ? NC_002947 = 197550450 (0.770)3 (0.050) 3/250 NT 6.0% coding (436/1104 nt) pheA bifunctional chorismate mutase/prephenate dehydratase
?NC_002947 = 1975538 46 (0.750)coding (470/1104 nt) pheA bifunctional chorismate mutase/prephenate dehydratase
* ? NC_002947 2012318 =50 (0.770)6 (0.100) 4/254 NT 10.6% coding (1704/2589 nt) PP_1793 group 2 family glycosyl transferase
?NC_002947 2012373 = 53 (0.850)coding (1649/2589 nt) PP_1793 group 2 family glycosyl transferase
* ? NC_002947 2020198 =46 (0.710)4 (0.060) 4/252 NT 8.7% coding (151/1416 nt) PP_1798 outer membrane efflux protein
?NC_002947 2020246 = 40 (0.640)coding (199/1416 nt) PP_1798 outer membrane efflux protein
* ? NC_002947 2046394 =63 (0.970)4 (0.070) 4/248 NT 6.6% coding (1608/1941 nt) PP_1819 methyl‑accepting chemotaxis transducer
?NC_002947 2046467 = 54 (0.880)coding (1681/1941 nt) PP_1819 methyl‑accepting chemotaxis transducer
* ? NC_002947 2048794 =55 (0.850)4 (0.070) 4/230 NT 8.7% intergenic (+33/+106) PP_1821/PP_1822 glutathione S‑transferase family protein/hypothetical protein
?NC_002947 2048885 = 36 (0.640)intergenic (+124/+15) PP_1821/PP_1822 glutathione S‑transferase family protein/hypothetical protein
* ? NC_002947 = 208327637 (0.570)7 (0.120) 7/242 NT 15.4% intergenic (‑43/‑71) PP_1861/PP_1862 LysR family transcriptional regulator/membrane protein
?NC_002947 = 2083292 43 (0.720)intergenic (‑59/‑55) PP_1861/PP_1862 LysR family transcriptional regulator/membrane protein
* ? NC_002947 = 208430153 (0.810)3 (0.050) 3/250 NT 5.8% coding (676/852 nt) PP_1863 LysR family transcriptional regulator
?NC_002947 = 2084335 47 (0.760)coding (642/852 nt) PP_1863 LysR family transcriptional regulator
* ? NC_002947 2090572 =78 (1.200)4 (0.060) 4/252 NT 5.7% intergenic (+249/‑103) PP_1867/deaD hypothetical protein/ATP‑dependent DEAD‑box RNA helicase DeaD
?NC_002947 2090654 = 59 (0.950)intergenic (+331/‑21) PP_1867/deaD hypothetical protein/ATP‑dependent DEAD‑box RNA helicase DeaD
* ? NC_002947 = 209995720 (0.310)8 (0.130) 4/244 NT 26.0% intergenic (‑68/‑137) PP_1875/PP_1876 two‑component system sensor histidine kinase/response regulator/AAA family ATP/GTP‑binding protein
?NC_002947 = 2100056 27 (0.450)intergenic (‑167/‑38) PP_1875/PP_1876 two‑component system sensor histidine kinase/response regulator/AAA family ATP/GTP‑binding protein
* ? NC_002947 2134148 =68 (1.040)4 (0.060) 4/250 NT 5.8% coding (87/411 nt) PP_1892 hypothetical protein
?NC_002947 2134211 = 66 (1.070)coding (24/411 nt) PP_1892 hypothetical protein
* ? NC_002947 2158339 =78 (1.200)6 (0.100) 6/254 NT 8.1% coding (689/741 nt) fabG 3‑oxoacyl‑ACP reductase subunit
?NC_002947 2158379 = 62 (0.990)coding (729/741 nt) fabG 3‑oxoacyl‑ACP reductase subunit
* ? NC_002947 = 222900863 (0.970)4 (0.070) 4/246 NT 6.7% coding (144/783 nt) ycfH tRNA D‑aminoacylase
?NC_002947 = 2229057 53 (0.870)coding (193/783 nt) ycfH tRNA D‑aminoacylase
* ? NC_002947 = 223555155 (0.850)5 (0.080) 5/258 NT 7.7% coding (662/2016 nt) uvrB uvrABC excinuclease protein B
?NC_002947 = 2235589 66 (1.040)coding (700/2016 nt) uvrB uvrABC excinuclease protein B
* ? NC_002947 = 223693431 (0.480)9 (0.160) 9/232 NT 26.0% intergenic (+29/+99) uvrB/PP_1975 uvrABC excinuclease protein B/EmrB/QacA family drug resistance transporter
?NC_002947 = 2236993 24 (0.420)intergenic (+88/+40) uvrB/PP_1975 uvrABC excinuclease protein B/EmrB/QacA family drug resistance transporter
* ? NC_002947 2248955 =57 (0.880)4 (0.060) 3/250 NT 6.1% coding (644/3297 nt) PP_1983 PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
?NC_002947 2249028 = 70 (1.140)coding (571/3297 nt) PP_1983 PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
* ? NC_002947 = 224942779 (1.210)4 (0.070) 4/244 NT 5.3% coding (172/3297 nt) PP_1983 PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
?NC_002947 = 2249469 69 (1.150)coding (130/3297 nt) PP_1983 PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
* ? NC_002947 = 2258059NA (NA)9 (0.150) 7/248 NT 24.8% intergenic (+114/‑278) PP_1990/asd transposase/aspartate‑semialdehyde dehydrogenase
?NC_002947 = 2258152 29 (0.450)intergenic (+207/‑185) PP_1990/asd transposase/aspartate‑semialdehyde dehydrogenase
* ? NC_002947 2260519 =47 (0.720)3 (0.050) 3/246 NT 5.7% coding (1107/2736 nt) fimV motility protein FimV
?NC_002947 2260618 = 56 (0.920)coding (1206/2736 nt) fimV motility protein FimV
* ? NC_002947 = 226571460 (0.920)5 (0.080) 5/254 NT 7.3% coding (774/1311 nt) folC bifunctional folypolyglutamate synthase/dihydrofolate synthase
?NC_002947 = 2265748 69 (1.100)coding (808/1311 nt) folC bifunctional folypolyglutamate synthase/dihydrofolate synthase
* ? NC_002947 = 226999236 (0.550)3 (0.050) 3/248 NT 7.4% coding (795/1212 nt) metZ O‑succinylhomoserine sulfhydrylase
?NC_002947 = 2270034 41 (0.670)coding (837/1212 nt) metZ O‑succinylhomoserine sulfhydrylase
* ? NC_002947 2290876 =65 (1.000)6 (0.100) 5/254 NT 8.8% coding (227/960 nt) PP_2018 BNR domain‑containing protein
?NC_002947 2290934 = 62 (0.990)coding (285/960 nt) PP_2018 BNR domain‑containing protein
* ? NC_002947 = 229551058 (0.890)4 (0.060) 4/254 NT 6.3% intergenic (+55/‑68) ppgL/PP_5496 L‑alpha‑hydroxyglutaric acid gamma‑lactonase/hypothetical protein
?NC_002947 = 2295563 64 (1.020)intergenic (+108/‑15) ppgL/PP_5496 L‑alpha‑hydroxyglutaric acid gamma‑lactonase/hypothetical protein
* ? NC_002947 2295836 =52 (0.800)6 (0.100) 5/248 NT 10.4% intergenic (+82/+51) PP_5496/PP_2023 hypothetical protein/glutathione S‑transferase family protein
?NC_002947 4282152 = 55 (0.900)coding (1078/1089 nt) PP_3753 AraC family transcriptional regulator
* ? NC_002947 2301453 =0 (0.000)64 (1.010) 52/258 NT 100% intergenic (‑97/‑234) sbcD/PP_5497 exonuclease subunit SbcD/rhs repeat‑associated core domain‑containing protein
?NC_002947 2925429 = NA (NA)intergenic (‑177/+388) PP_2563/PP_2564 antibiotic biosynthesis protein/quercetin 2,3‑dioxygenase
* ? NC_002947 = 23014540 (0.000)51 (0.800) 38/260 NT 100% intergenic (‑98/‑233) sbcD/PP_5497 exonuclease subunit SbcD/rhs repeat‑associated core domain‑containing protein
?NC_002947 5545321 = NA (NA)intergenic (‑461/+416) rpsF/rlmB 30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
* ? NC_002947 = 233160864 (0.980)4 (0.060) 4/254 NT 6.0% coding (152/1164 nt) PP_2049 alcohol dehydrogenase
?NC_002947 = 2331631 63 (1.010)coding (175/1164 nt) PP_2049 alcohol dehydrogenase
* ? NC_002947 2335275 =65 (1.000)4 (0.070) 4/248 NT 6.5% coding (1182/2124 nt) PP_2052 bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
?NC_002947 2335366 = 54 (0.880)coding (1091/2124 nt) PP_2052 bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
* ? NC_002947 2354027 =47 (0.720)4 (0.060) 4/250 NT 8.2% coding (505/1278 nt) PP_2068 multidrug MFS transporter membrane fusion protein
?NC_002947 2354077 = 45 (0.730)coding (455/1278 nt) PP_2068 multidrug MFS transporter membrane fusion protein
* ? NC_002947 = 235779349 (0.750)5 (0.080) 5/250 NT 8.9% coding (518/825 nt) PP_2072 AraC family transcriptional regulator
?NC_002947 = 2357821 56 (0.910)coding (490/825 nt) PP_2072 AraC family transcriptional regulator
* ? NC_002947 2363970 =61 (0.940)5 (0.080) 4/248 NT 8.5% intergenic (‑94/+239) PP_2076/lysA‑I hypothetical protein/diaminopimelate decarboxylase
?NC_002947 2364009 = 50 (0.820)intergenic (‑133/+200) PP_2076/lysA‑I hypothetical protein/diaminopimelate decarboxylase
* ? NC_002947 2369957 =74 (1.140)4 (0.070) 4/246 NT 6.0% coding (2775/4866 nt) gdhB NAD‑specific glutamate dehydrogenase
?NC_002947 2370004 = 56 (0.920)coding (2822/4866 nt) gdhB NAD‑specific glutamate dehydrogenase
* ? NC_002947 = 237029780 (1.230)4 (0.060) 4/254 NT 5.3% coding (3115/4866 nt) gdhB NAD‑specific glutamate dehydrogenase
?NC_002947 = 2370339 67 (1.070)coding (3157/4866 nt) gdhB NAD‑specific glutamate dehydrogenase
* ? NC_002947 = 239666544 (0.680)3 (0.050) 3/252 NT 6.3% coding (2992/3636 nt) PP_2100 two‑component system sensor protein
?NC_002947 = 2396687 48 (0.770)coding (2970/3636 nt) PP_2100 two‑component system sensor protein
* ? NC_002947 2403799 =44 (0.680)4 (0.070) 4/244 NT 8.3% coding (426/1209 nt) PP_2106 ammonium transporter
?NC_002947 2403860 = 48 (0.800)coding (487/1209 nt) PP_2106 ammonium transporter
* ? NC_002947 = 241207047 (0.720)4 (0.070) 3/246 NT 7.3% coding (399/1065 nt) rlmM 23S rRNA (cytidine(2498)‑2'‑O)‑methyltransferase RlmM
?NC_002947 = 2412116 58 (0.960)coding (445/1065 nt) rlmM 23S rRNA (cytidine(2498)‑2'‑O)‑methyltransferase RlmM
* ? NC_002947 2417879 =60 (0.920)4 (0.060) 4/254 NT 6.9% coding (914/1764 nt) PP_2119 ABC transporter permease/ATP‑binding protein
?NC_002947 2417925 = 51 (0.810)coding (960/1764 nt) PP_2119 ABC transporter permease/ATP‑binding protein
* ? NC_002947 = 244940457 (0.880)3 (0.050) 3/248 NT 5.6% coding (1679/3318 nt) PP_2146 SNF2/RAD54 family helicase
?NC_002947 = 2449438 48 (0.790)coding (1645/3318 nt) PP_2146 SNF2/RAD54 family helicase
* ? NC_002947 = 247214021 (0.320)7 (0.150) 5/186 NT 25.1% intergenic (+44/+105) PP_2166/PP_2167 anti‑anti‑sigma factor/PhoD‑like phosphatase
?NC_002947 = 2472186 27 (0.590)intergenic (+90/+59) PP_2166/PP_2167 anti‑anti‑sigma factor/PhoD‑like phosphatase
* ? NC_002947 2492920 =56 (0.860)3 (0.050) 3/254 NT 5.9% coding (2343/2883 nt) PP_2185 formate dehydrogenase subunit alpha
?NC_002947 2492955 = 42 (0.670)coding (2378/2883 nt) PP_2185 formate dehydrogenase subunit alpha
* ? NC_002947 2510081 =71 (1.090)4 (0.060) 4/256 NT 5.9% coding (1650/1725 nt) copA‑I copper resistance protein A
?NC_002947 2510127 = 58 (0.920)coding (1604/1725 nt) copA‑I copper resistance protein A
* ? NC_002947 = 252119162 (0.950)4 (0.070) 4/246 NT 6.4% coding (2442/4446 nt) PP_2212 leucine‑rich repeat‑containing protein
?NC_002947 = 2521226 59 (0.970)coding (2477/4446 nt) PP_2212 leucine‑rich repeat‑containing protein
* ? NC_002947 = 253439158 (0.890)4 (0.060) 4/250 NT 6.0% coding (1392/1680 nt) mrpD K(+)/H(+) antiporter subunit D
?NC_002947 = 2534468 70 (1.140)coding (1315/1680 nt) mrpD K(+)/H(+) antiporter subunit D
* ? NC_002947 = 255847564 (0.980)4 (0.060) 3/252 NT 6.3% coding (735/2235 nt) fepA ferric enterobactin transport system outer membrane subunit
?NC_002947 = 2558511 57 (0.920)coding (771/2235 nt) fepA ferric enterobactin transport system outer membrane subunit
* ? NC_002947 = 256080256 (0.860)3 (0.050) 3/250 NT 5.5% coding (629/786 nt) PP_2244 TauE‑like transmembrane protein
?NC_002947 = 2560846 50 (0.810)coding (585/786 nt) PP_2244 TauE‑like transmembrane protein
* ? NC_002947 2562661 =72 (1.110)4 (0.060) 4/252 NT 5.5% coding (399/1137 nt) dauA FAD‑dependent catabolic D‑arginine dehydrogenase
?NC_002947 2562688 = 68 (1.100)coding (426/1137 nt) dauA FAD‑dependent catabolic D‑arginine dehydrogenase
* ? NC_002947 = 263412243 (0.660)4 (0.060) 4/254 NT 8.4% coding (584/1872 nt) PP_2304 peptidyl‑prolyl cis‑trans isomerase D
?NC_002947 = 2634150 46 (0.730)coding (612/1872 nt) PP_2304 peptidyl‑prolyl cis‑trans isomerase D
* ? NC_002947 2646103 =56 (0.860)5 (0.080) 3/248 NT 8.8% coding (1211/2499 nt) PP_2316 ABC transporter permease
?NC_002947 2646141 = 51 (0.830)coding (1173/2499 nt) PP_2316 ABC transporter permease
* ? NC_002947 2665181 =53 (0.810)3 (0.050) 3/250 NT 6.2% coding (1044/2589 nt) acnA‑II aconitate hydratase
?NC_002947 2665218 = 41 (0.670)coding (1081/2589 nt) acnA‑II aconitate hydratase
* ? NC_002947 = 269265663 (0.970)4 (0.060) 4/252 NT 6.1% coding (280/504 nt) PP_2360 type I pili subunit CsuA/B
?NC_002947 = 2692684 62 (1.000)coding (308/504 nt) PP_2360 type I pili subunit CsuA/B
* ? NC_002947 2707496 =73 (1.120)4 (0.060) 4/250 NT 5.8% coding (77/495 nt) PP_2370 hypothetical protein
?NC_002947 2707545 = 62 (1.010)coding (28/495 nt) PP_2370 hypothetical protein
* ? NC_002947 2751160 =65 (1.000)5 (0.080) 4/250 NT 7.7% intergenic (‑225/‑14) aroQ‑II/czcC‑II type II 3‑dehydroquinate dehydratase/cobalt‑zinc‑cadmium resistance protein
?NC_002947 2751195 = 58 (0.940)coding (22/1278 nt) czcC‑II cobalt‑zinc‑cadmium resistance protein
* ? NC_002947 2786671 =43 (0.660)3 (0.050) 3/250 NT 6.5% intergenic (‑3/‑319) alx/ahpC alkaline‑induced transporter/peroxiredoxin/alkylhydroperoxide reductase small subunit
?NC_002947 2786743 = 45 (0.730)intergenic (‑75/‑247) alx/ahpC alkaline‑induced transporter/peroxiredoxin/alkylhydroperoxide reductase small subunit
* ? NC_002947 = 279285469 (1.060)4 (0.060) 3/252 NT 5.6% coding (184/240 nt) PP_5524 hypothetical protein
?NC_002947 = 2792876 68 (1.100)coding (206/240 nt) PP_5524 hypothetical protein
* ? NC_002947 = 282382747 (0.720)4 (0.060) 4/250 NT 8.4% intergenic (+2/‑98) PP_5528/iorA‑I hypothetical protein/isoquinoline 1‑oxidoreductase subunit alpha
?NC_002947 = 2823848 43 (0.700)intergenic (+23/‑77) PP_5528/iorA‑I hypothetical protein/isoquinoline 1‑oxidoreductase subunit alpha
* ? NC_002947 2852056 =62 (0.950)5 (0.080) 4/250 NT 7.5% coding (486/519 nt) PP_5531 hypothetical protein
?NC_002947 2852100 = 65 (1.060)intergenic (+11/+194) PP_5531/PP_2505 hypothetical protein/GAF domain/GGDEF domain‑containing protein
* ? NC_002947 2863930 =62 (0.950)5 (0.080) 4/246 NT 8.1% coding (990/1194 nt) gllR HTH‑type transcriptional regulator GalR
?NC_002947 2863974 = 56 (0.920)coding (1034/1194 nt) gllR HTH‑type transcriptional regulator GalR
* ? NC_002947 2881022 =46 (0.710)4 (0.070) 4/248 NT 8.7% coding (864/1176 nt) PP_2535 transport protein
?NC_002947 2881070 = 41 (0.670)coding (912/1176 nt) PP_2535 transport protein
* ? NC_002947 2915278 =45 (0.690)4 (0.070) 4/248 NT 9.1% coding (4298/10827 nt) PP_2561 hemolysin‑type calcium‑binding bacteriocin
?NC_002947 2915368 = 38 (0.620)coding (4388/10827 nt) PP_2561 hemolysin‑type calcium‑binding bacteriocin
* ? NC_002947 = 292166239 (0.600)3 (0.050) 3/256 NT 7.7% coding (10682/10827 nt) PP_2561 hemolysin‑type calcium‑binding bacteriocin
?NC_002947 = 2921684 34 (0.540)coding (10704/10827 nt) PP_2561 hemolysin‑type calcium‑binding bacteriocin
* ? NC_002947 2923286 =66 (1.010)3 (0.050) 3/248 NT 5.2% coding (1967/2772 nt) PP_2563 antibiotic biosynthesis protein
?NC_002947 2923338 = 48 (0.790)coding (1915/2772 nt) PP_2563 antibiotic biosynthesis protein
* ? NC_002947 2939916 =58 (0.890)3 (0.050) 3/254 NT 5.8% coding (226/648 nt) PP_2572 hypothetical protein
?NC_002947 2939957 = 41 (0.660)coding (185/648 nt) PP_2572 hypothetical protein
* ? NC_002947 = 294880850 (0.770)3 (0.050) 3/250 NT 5.8% coding (274/591 nt) PP_2582 heme oxygenase
?NC_002947 = 2948834 51 (0.830)coding (248/591 nt) PP_2582 heme oxygenase
* ? NC_002947 = 295175749 (0.750)4 (0.060) 4/252 NT 7.2% coding (1206/1581 nt) PP_2585 alpha‑ketoglutaric semialdehyde dehydrogenase
?NC_002947 = 2951779 56 (0.900)coding (1184/1581 nt) PP_2585 alpha‑ketoglutaric semialdehyde dehydrogenase
* ? NC_002947 2954524 =41 (0.630)4 (0.060) 4/254 NT 9.8% intergenic (‑27/‑254) PP_2586/PP_2587 putative amino acid transporter/LuxR family transcriptional regulator
?NC_002947 2954563 = 34 (0.540)intergenic (‑66/‑215) PP_2586/PP_2587 putative amino acid transporter/LuxR family transcriptional regulator
* ? NC_002947 2954950 =42 (0.650)3 (0.050) 3/246 NT 6.8% coding (173/843 nt) PP_2587 LuxR family transcriptional regulator
?NC_002947 2955026 = 43 (0.710)coding (249/843 nt) PP_2587 LuxR family transcriptional regulator
* ? NC_002947 2973290 =50 (0.770)3 (0.050) 3/250 NT 6.6% coding (584/1713 nt) PP_2600 hypothetical protein
?NC_002947 2973324 = 37 (0.600)coding (550/1713 nt) PP_2600 hypothetical protein
* ? NC_002947 = 299626843 (0.660)3 (0.050) 3/254 NT 7.2% coding (576/1017 nt) PP_2620 hypothetical protein
?NC_002947 = 2996321 36 (0.580)coding (523/1017 nt) PP_2620 hypothetical protein
* ? NC_002947 = 303960546 (0.710)4 (0.060) 3/254 NT 9.3% coding (690/1344 nt) PP_2651 MFS transporter
?NC_002947 = 3039659 34 (0.540)coding (744/1344 nt) PP_2651 MFS transporter
* ? NC_002947 3041377 =49 (0.750)5 (0.080) 5/252 NT 9.9% coding (615/819 nt) PP_2653 Cro/CI family transcriptional regulator
?NC_002947 3041425 = 44 (0.710)coding (567/819 nt) PP_2653 Cro/CI family transcriptional regulator
* ? NC_002947 = 306986944 (0.680)4 (0.060) 4/256 NT 8.5% coding (958/1521 nt) aldB‑II aldehyde dehydrogenase
?NC_002947 = 3069900 43 (0.680)coding (989/1521 nt) aldB‑II aldehyde dehydrogenase
* ? NC_002947 = 311554947 (0.720)5 (0.080) 4/248 NT 10.0% coding (287/1527 nt) PP_2732 hypothetical protein
?NC_002947 = 3115576 46 (0.750)coding (314/1527 nt) PP_2732 hypothetical protein
* ? NC_002947 3162747 =48 (0.740)3 (0.050) 3/254 NT 5.6% coding (115/570 nt) PP_2777 acyl carrier protein
?NC_002947 3162782 = 55 (0.880)coding (150/570 nt) PP_2777 acyl carrier protein
* ? NC_002947 = 318549147 (0.720)3 (0.050) 3/256 NT 6.1% coding (1128/1647 nt) PP_2795 AMP‑binding domain‑containing protein
?NC_002947 = 3185532 47 (0.740)coding (1169/1647 nt) PP_2795 AMP‑binding domain‑containing protein
* ? NC_002947 3190461 =48 (0.740)3 (0.050) 3/252 NT 6.4% coding (189/1380 nt) PP_2799 class III aminotransferase
?NC_002947 3190500 = 42 (0.680)coding (150/1380 nt) PP_2799 class III aminotransferase
* ? NC_002947 3204236 =56 (0.860)3 (0.050) 3/254 NT 5.9% coding (987/1422 nt) PP_2810 hypothetical protein
?NC_002947 3204339 = 42 (0.670)coding (1090/1422 nt) PP_2810 hypothetical protein
* ? NC_002947 3238303 =59 (0.910)3 (0.050) 3/252 NT 5.1% coding (742/1218 nt) PP_2836 2‑keto‑3‑deoxyxylonate dehydratase
?NC_002947 3238338 = 56 (0.900)coding (777/1218 nt) PP_2836 2‑keto‑3‑deoxyxylonate dehydratase
* ? NC_002947 3253299 =33 (0.510)3 (0.050) 3/248 NT 7.4% coding (143/729 nt) PP_2851 hypothetical protein
?NC_002947 3253355 = 44 (0.720)coding (87/729 nt) PP_2851 hypothetical protein
* ? NC_002947 = 327987267 (1.030)4 (0.060) 4/256 NT 6.3% coding (208/594 nt) PP_2879 hypothetical protein
?NC_002947 = 3279915 55 (0.870)coding (165/594 nt) PP_2879 hypothetical protein
* ? NC_002947 = 336559152 (0.800)3 (0.050) 3/250 NT 5.1% coding (259/1002 nt) PP_2962 alcohol dehydrogenase
?NC_002947 = 3365634 63 (1.020)coding (302/1002 nt) PP_2962 alcohol dehydrogenase
* ? NC_002947 = 339432049 (0.750)4 (0.070) 4/244 NT 8.9% coding (87/900 nt) PP_2997 protein CnmA
?NC_002947 = 3394357 37 (0.620)coding (50/900 nt) PP_2997 protein CnmA
* ? NC_002947 = 342526062 (0.950)4 (0.060) 4/250 NT 6.7% coding (337/348 nt) PP_3040 holin
?NC_002947 = 3425359 53 (0.860)intergenic (+88/‑77) PP_3040/PP_3041 holin/hypothetical protein
* ? NC_002947 = 343657252 (0.800)4 (0.060) 4/256 NT 6.8% coding (507/813 nt) gpI tail formation protein
?NC_002947 = 3436604 59 (0.940)coding (539/813 nt) gpI tail formation protein
* ? NC_002947 = 343690138 (0.580)3 (0.050) 3/252 NT 6.5% coding (27/879 nt) PP_3056 tail fiber protein
?NC_002947 = 3436957 50 (0.810)coding (83/879 nt) PP_3056 tail fiber protein
* ? NC_002947 = 343761249 (0.750)3 (0.050) 3/250 NT 5.6% coding (738/879 nt) PP_3056 tail fiber protein
?NC_002947 = 3437669 54 (0.880)coding (795/879 nt) PP_3056 tail fiber protein
* ? NC_002947 3483872 =79 (1.210)5 (0.080) 5/256 NT 6.9% coding (2052/3804 nt) PP_3091 membrane protein
?NC_002947 3483909 = 59 (0.940)coding (2015/3804 nt) PP_3091 membrane protein
* ? NC_002947 = 349053164 (0.980)4 (0.060) 4/254 NT 6.4% coding (860/2637 nt) clpV protein ClpV1
?NC_002947 = 3490575 55 (0.880)coding (816/2637 nt) clpV protein ClpV1
* ? NC_002947 = 350748638 (0.580)4 (0.070) 4/244 NT 10.1% coding (804/969 nt) PP_3104 hypothetical protein
?NC_002947 = 3507509 36 (0.600)coding (827/969 nt) PP_3104 hypothetical protein
* ? NC_002947 = 354791040 (0.610)4 (0.060) 3/252 NT 8.8% coding (855/1377 nt) PP_3132 polysaccharide transporter
?NC_002947 = 3547946 45 (0.720)coding (891/1377 nt) PP_3132 polysaccharide transporter
* ? NC_002947 = 356827257 (0.880)3 (0.050) 3/250 NT 5.3% coding (829/1998 nt) PP_3150 hypothetical protein
?NC_002947 = 3568302 54 (0.880)coding (859/1998 nt) PP_3150 hypothetical protein
* ? NC_002947 = 359033055 (0.850)4 (0.070) 4/246 NT 7.4% coding (851/1251 nt) nicP‑I porin‑like protein
?NC_002947 = 3590342 49 (0.810)coding (863/1251 nt) nicP‑I porin‑like protein
* ? NC_002947 = 359650644 (0.680)3 (0.050) 3/254 NT 6.0% coding (500/1098 nt) nemA FMN‑linked N‑ethylmaleimide reductase
?NC_002947 = 3596535 51 (0.810)coding (471/1098 nt) nemA FMN‑linked N‑ethylmaleimide reductase
* ? NC_002947 3612481 =61 (0.940)4 (0.060) 4/254 NT 6.6% coding (1203/3396 nt) mcoA Mn(II) copper oxidase A
?NC_002947 3612513 = 54 (0.860)coding (1171/3396 nt) mcoA Mn(II) copper oxidase A
* ? NC_002947 3617158 =47 (0.720)5 (0.080) 5/254 NT 9.9% coding (183/1170 nt) PP_3188 hypothetical protein
?NC_002947 3617187 = 46 (0.730)coding (212/1170 nt) PP_3188 hypothetical protein
* ? NC_002947 = 368592851 (0.780)3 (0.050) 3/256 NT 5.2% coding (336/1332 nt) PP_3251 hypothetical protein
?NC_002947 = 3685965 59 (0.940)coding (373/1332 nt) PP_3251 hypothetical protein
* ? NC_002947 = 369076161 (0.940)4 (0.070) 4/244 NT 6.4% coding (462/660 nt) PP_3256 group 2 family glycosyl transferase
?NC_002947 = 3690788 60 (1.000)coding (435/660 nt) PP_3256 group 2 family glycosyl transferase
* ? NC_002947 = 369333460 (0.920)3 (0.050) 3/252 NT 5.1% coding (292/1044 nt) PP_3259 acyl‑CoA dehydrogenase‑related protein
?NC_002947 = 3693379 55 (0.890)coding (247/1044 nt) PP_3259 acyl‑CoA dehydrogenase‑related protein
* ? NC_002947 = 375310354 (0.830)3 (0.050) 3/250 NT 5.3% coding (780/2823 nt) PP_3316 chaperone‑associated ATPase
?NC_002947 = 3753144 57 (0.930)coding (739/2823 nt) PP_3316 chaperone‑associated ATPase
* ? NC_002947 = 375811442 (0.650)4 (0.070) 4/248 NT 8.5% coding (427/1002 nt) hemBB porphobilinogen synthase
?NC_002947 = 3758136 47 (0.770)coding (449/1002 nt) hemBB porphobilinogen synthase
* ? NC_002947 = 381572662 (0.950)4 (0.060) 4/252 NT 6.3% coding (394/1260 nt) PP_3371 sensor histidine kinase
?NC_002947 = 3815758 60 (0.970)coding (362/1260 nt) PP_3371 sensor histidine kinase
* ? NC_002947 = 383713946 (0.710)3 (0.050) 3/252 NT 5.9% coding (734/2673 nt) PP_3388 hypothetical protein
?NC_002947 = 3837164 51 (0.820)coding (759/2673 nt) PP_3388 hypothetical protein
* ? NC_002947 3857801 =44 (0.680)3 (0.050) 3/254 NT 7.2% intergenic (+35/‑259) PP_mr41/cbtA Cobalamin regulatory region/cobalt transporter subunit A
?NC_002947 3857832 = 35 (0.560)intergenic (+66/‑228) PP_mr41/cbtA Cobalamin regulatory region/cobalt transporter subunit A
* ? NC_002947 3881637 =67 (1.030)5 (0.080) 4/248 NT 7.8% coding (296/1416 nt) oprN multidrug RND transporter outer membrane protein OprN
?NC_002947 3881700 = 55 (0.900)coding (359/1416 nt) oprN multidrug RND transporter outer membrane protein OprN
* ? NC_002947 = 389566760 (0.920)4 (0.060) 4/250 NT 6.6% coding (318/582 nt) PP_3438 membrane protein
?NC_002947 = 3895689 57 (0.930)coding (340/582 nt) PP_3438 membrane protein
* ? NC_002947 3912823 =66 (1.010)5 (0.080) 4/256 NT 7.6% coding (1256/1302 nt) PP_3453 sensor protein RstB
?NC_002947 3912875 = 58 (0.920)coding (1204/1302 nt) PP_3453 sensor protein RstB
* ? NC_002947 3919020 =52 (0.800)4 (0.070) 4/248 NT 6.9% coding (2802/3129 nt) mexB multidrug resistance protein MexB
?NC_002947 3919144 = 59 (0.970)coding (2926/3129 nt) mexB multidrug resistance protein MexB
* ? NC_002947 = 3971392NA (NA)4 (0.060) 4/256 NT NA coding (1311/1536 nt) PP_3501 transposase
?NC_002947 = 3971433 NA (NA)coding (1352/1536 nt) PP_3501 transposase
* ? NC_002947 = 397364451 (0.780)3 (0.050) 3/248 NT 5.2% coding (829/1326 nt) PP_3503 sigma‑54 dependent transcriptional regulator
?NC_002947 = 3973680 62 (1.010)coding (793/1326 nt) PP_3503 sigma‑54 dependent transcriptional regulator
* ? NC_002947 3991309 =78 (1.200)5 (0.080) 5/248 NT 7.6% coding (318/894 nt) PP_3517 hypothetical protein
?NC_002947 3991355 = 48 (0.790)coding (272/894 nt) PP_3517 hypothetical protein
* ? NC_002947 4027966 =53 (0.810)4 (0.060) 4/256 NT 8.0% coding (464/1407 nt) PP_3552 two‑component system sensor histidine kinase
?NC_002947 4028017 = 41 (0.650)coding (413/1407 nt) PP_3552 two‑component system sensor histidine kinase
* ? NC_002947 = 403144670 (1.080)6 (0.100) 5/250 NT 8.4% coding (1109/1770 nt) PP_3554 acyl‑CoA dehydrogenase family protein
?NC_002947 = 4031526 64 (1.040)coding (1189/1770 nt) PP_3554 acyl‑CoA dehydrogenase family protein
* ? NC_002947 = 403701270 (1.080)4 (0.070) 4/246 NT 5.4% coding (2063/2145 nt) PP_3557 methyl‑accepting chemotaxis transducer
?NC_002947 = 4037047 74 (1.220)coding (2098/2145 nt) PP_3557 methyl‑accepting chemotaxis transducer
* ? NC_002947 4040473 =49 (0.750)3 (0.050) 3/252 NT 5.7% coding (361/948 nt) PP_3561 membrane protein
?NC_002947 4040529 = 52 (0.840)coding (417/948 nt) PP_3561 membrane protein
* ? NC_002947 4063840 =81 (1.240)4 (0.060) 4/256 NT 5.1% coding (499/2088 nt) PP_3581 membrane protein
?NC_002947 4063870 = 69 (1.090)coding (469/2088 nt) PP_3581 membrane protein
* ? NC_002947 4094105 =55 (0.850)3 (0.050) 3/252 NT 5.3% coding (1102/1581 nt) PP_3602 2,5‑dioxovalerate dehydrogenase
?NC_002947 4094144 = 55 (0.890)coding (1141/1581 nt) PP_3602 2,5‑dioxovalerate dehydrogenase
* ? NC_002947 4098066 =60 (0.920)5 (0.080) 5/246 NT 9.3% coding (624/975 nt) qor‑II quinone oxidoreductase
?NC_002947 4098108 = 42 (0.690)coding (582/975 nt) qor‑II quinone oxidoreductase
* ? NC_002947 4111640 =46 (0.710)4 (0.060) 4/250 NT 9.5% coding (469/897 nt) PP_3617 membrane protein
?NC_002947 4111713 = 33 (0.540)coding (542/897 nt) PP_3617 membrane protein
* ? NC_002947 4114305 =38 (0.580)3 (0.050) 3/238 NT 8.9% intergenic (+52/+94) PP_3619/ycaO hypothetical protein/ribosomal protein S12 methylthiotransferase accessory factor
?NC_002947 4114376 = 27 (0.460)intergenic (+123/+23) PP_3619/ycaO hypothetical protein/ribosomal protein S12 methylthiotransferase accessory factor
* ? NC_002947 4136298 =43 (0.660)4 (0.060) 4/256 NT 8.8% coding (507/921 nt) PP_3640 AraC family transcriptional regulator
?NC_002947 4136336 = 41 (0.650)coding (545/921 nt) PP_3640 AraC family transcriptional regulator
* ? NC_002947 = 415004120 (0.310)11 (0.200) 9/228 NT 35.9% intergenic (+40/‑357) PP_3654/PP_3655 leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
?NC_002947 = 4150072 22 (0.390)intergenic (+71/‑326) PP_3654/PP_3655 leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
* ? NC_002947 = 416837955 (0.850)3 (0.050) 3/250 NT 5.6% coding (1514/2256 nt) katG catalase‑peroxidase
?NC_002947 = 4168417 50 (0.810)coding (1476/2256 nt) katG catalase‑peroxidase
* ? NC_002947 = 417203346 (0.710)3 (0.050) 3/250 NT 6.2% coding (90/879 nt) PP_3670 DMT superfamily permease
?NC_002947 = 4172070 48 (0.780)coding (53/879 nt) PP_3670 DMT superfamily permease
* ? NC_002947 = 417238959 (0.910)5 (0.080) 5/254 NT 7.6% coding (23/825 nt) PP_3671 aldo/keto reductase family oxidoreductase
?NC_002947 = 4172456 64 (1.020)coding (90/825 nt) PP_3671 aldo/keto reductase family oxidoreductase
* ? NC_002947 4191542 =53 (0.810)4 (0.060) 4/250 NT 7.8% intergenic (‑874/‑283) PP_5612/PP_5613 hypothetical protein/hypothetical protein
?NC_002947 4191584 = 44 (0.710)intergenic (‑916/‑241) PP_5612/PP_5613 hypothetical protein/hypothetical protein
* ? NC_002947 = 426799846 (0.710)3 (0.050) 3/252 NT 6.8% coding (1303/1341 nt) PP_3740 MFS transporter
?NC_002947 = 4268029 38 (0.610)coding (1272/1341 nt) PP_3740 MFS transporter
* ? NC_002947 4317676 =55 (0.850)4 (0.070) 4/246 NT 6.8% coding (209/273 nt) PP_5628 hypothetical protein
?NC_002947 4317723 = 58 (0.960)coding (256/273 nt) PP_5628 hypothetical protein
* ? NC_002947 = 431923539 (0.600)4 (0.070) 4/246 NT 9.8% coding (206/807 nt) PP_3790 diaminopimelate epimerase
?NC_002947 = 4319255 37 (0.610)coding (226/807 nt) PP_3790 diaminopimelate epimerase
* ? NC_002947 4323361 =57 (0.880)6 (0.100) 5/250 NT 10.0% intergenic (‑1371/‑52) PP_3792/PP_5631 hypothetical protein/hypothetical protein
?NC_002947 4323398 = 54 (0.880)intergenic (‑1408/‑15) PP_3792/PP_5631 hypothetical protein/hypothetical protein
* ? NC_002947 4340292 =85 (1.310)5 (0.080) 5/252 NT 6.0% intergenic (+277/‑54) ribAB‑II/PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
?NC_002947 4340316 = 75 (1.210)intergenic (+301/‑30) ribAB‑II/PP_3814 3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
* ? NC_002947 = 434110255 (0.850)3 (0.050) 3/246 NT 5.3% coding (757/1026 nt) PP_3814 polyamine ABC transportersubstrate‑binding protein
?NC_002947 = 4341141 57 (0.940)coding (796/1026 nt) PP_3814 polyamine ABC transportersubstrate‑binding protein
* ? NC_002947 4348206 =NA (NA)3 (0.050) 3/250 NT NA coding (430/1422 nt) PP_3820 group II intron‑encoding maturase
?NC_002947 4392679 = NA (NA)coding (336/1422 nt) PP_3868 group II intron‑encoding maturase
* ? NC_002947 = 435364044 (0.680)3 (0.050) 3/248 NT 5.9% coding (766/1086 nt) yrpB 2‑nitropropane dioxygenase
?NC_002947 = 4353676 55 (0.900)coding (802/1086 nt) yrpB 2‑nitropropane dioxygenase
* ? NC_002947 4363393 =52 (0.800)4 (0.060) 4/256 NT 7.3% coding (479/1011 nt) adhP alcohol dehydrogenase
?NC_002947 4363437 = 51 (0.810)coding (523/1011 nt) adhP alcohol dehydrogenase
* ? NC_002947 4374410 =55 (0.850)5 (0.080) 5/254 NT 8.9% coding (1424/1971 nt) PP_3849 hemolysin‑type calcium‑binding protein
?NC_002947 4374445 = 49 (0.780)coding (1459/1971 nt) PP_3849 hemolysin‑type calcium‑binding protein
* ? NC_002947 4378615 =62 (0.950)3 (0.050) 3/250 NT 5.1% coding (98/540 nt) PP_3854 lysozyme
?NC_002947 4378653 = 53 (0.860)coding (60/540 nt) PP_3854 lysozyme
* ? NC_002947 4389226 =76 (1.170)4 (0.070) 4/244 NT 5.6% coding (1515/1956 nt) PP_3865 tail protein
?NC_002947 4389271 = 65 (1.080)coding (1470/1956 nt) PP_3865 tail protein
* ? NC_002947 4390817 =46 (0.710)4 (0.060) 3/252 NT 8.1% coding (108/192 nt) PP_5640 hypothetical protein
?NC_002947 4390856 = 47 (0.760)coding (69/192 nt) PP_5640 hypothetical protein
* ? NC_002947 = 442437342 (0.650)6 (0.100) 5/250 NT 11.7% coding (286/393 nt) PP_3916 hypothetical protein
?NC_002947 = 4424397 51 (0.830)coding (310/393 nt) PP_3916 hypothetical protein
* ? NC_002947 = 442581566 (1.010)4 (0.060) 4/250 NT 5.6% coding (74/339 nt) PP_3917 hypothetical protein
?NC_002947 = 4425843 72 (1.170)coding (102/339 nt) PP_3917 hypothetical protein
* ? NC_002947 4433225 =94 (1.440)5 (0.080) 5/252 NT 5.6% coding (220/351 nt) PP_5648 hypothetical protein
?NC_002947 4433278 = 78 (1.260)coding (167/351 nt) PP_5648 hypothetical protein
* ? NC_002947 4457381 =50 (0.770)4 (0.060) 3/258 NT 8.0% coding (19/696 nt) pcaI 3‑oxoadipate CoA‑transferase subunit A
?NC_002947 4457483 = 43 (0.680)coding (121/696 nt) pcaI 3‑oxoadipate CoA‑transferase subunit A
* ? NC_002947 = 446158052 (0.800)3 (0.050) 3/248 NT 6.2% coding (68/2028 nt) PP_3955 permease
?NC_002947 = 4461605 42 (0.690)coding (93/2028 nt) PP_3955 permease
* ? NC_002947 4475646 =64 (0.980)5 (0.080) 4/254 NT 7.2% coding (289/336 nt) PP_3965 transposase
?NC_002947 4475715 = 68 (1.090)coding (220/336 nt) PP_3965 transposase
* ? NC_002947 = 451171171 (1.090)4 (0.070) 4/248 NT 5.5% coding (78/1326 nt) rarA DNA‑dependent ATPase
?NC_002947 = 4511745 70 (1.150)coding (44/1326 nt) rarA DNA‑dependent ATPase
* ? NC_002947 4515693 =67 (1.030)6 (0.100) 4/256 NT 8.6% coding (295/681 nt) aat leucyl/phenylalanyl‑tRNA‑‑protein transferase
?NC_002947 4515729 = 62 (0.980)coding (331/681 nt) aat leucyl/phenylalanyl‑tRNA‑‑protein transferase
* ? NC_002947 = 452515786 (1.320)4 (0.070) 4/246 NT 5.1% coding (88/1125 nt) mnmA tRNA 2‑thiouridine(34) synthase MnmA
?NC_002947 = 4525183 68 (1.120)coding (114/1125 nt) mnmA tRNA 2‑thiouridine(34) synthase MnmA
* ? NC_002947 = 453357951 (0.780)6 (0.100) 5/240 NT 10.5% intergenic (+21/‑153) PP_4020/cpo oxidoreductase/non‑heme chloroperoxidase
?NC_002947 = 4533644 56 (0.950)intergenic (+86/‑88) PP_4020/cpo oxidoreductase/non‑heme chloroperoxidase
* ? NC_002947 4566566 =50 (0.770)3 (0.050) 3/252 NT 6.0% coding (235/1743 nt) treZ malto‑oligosyltrehalose trehalohydrolase
?NC_002947 4566611 = 47 (0.760)coding (280/1743 nt) treZ malto‑oligosyltrehalose trehalohydrolase
* ? NC_002947 = 457553143 (0.660)8 (0.130) 8/244 NT 17.3% intergenic (+49/‑73) glgX/ybhP‑II glycogen debranching enzyme/phosphohydrolase
?NC_002947 = 4575558 37 (0.620)intergenic (+76/‑46) glgX/ybhP‑II glycogen debranching enzyme/phosphohydrolase
* ? NC_002947 = 460028556 (0.860)4 (0.070) 3/248 NT 6.9% coding (987/1467 nt) PP_4072 hypothetical protein
?NC_002947 = 4600338 55 (0.900)coding (934/1467 nt) PP_4072 hypothetical protein
* ? NC_002947 4601389 =53 (0.810)4 (0.060) 4/250 NT 8.1% coding (503/633 nt) PP_4073 hypothetical protein
?NC_002947 4601426 = 41 (0.670)coding (466/633 nt) PP_4073 hypothetical protein
* ? NC_002947 4603515 =54 (0.830)4 (0.060) 4/250 NT 7.5% intergenic (+846/‑656) PP_4074/PP_4076 hypothetical protein/hypothetical protein
?NC_002947 4603585 = 47 (0.760)intergenic (+916/‑586) PP_4074/PP_4076 hypothetical protein/hypothetical protein
* ? NC_002947 = 460985756 (0.860)4 (0.070) 4/244 NT 7.2% coding (344/876 nt) PP_4081 type IV/VI secretion system protein
?NC_002947 = 4609877 52 (0.870)coding (364/876 nt) PP_4081 type IV/VI secretion system protein
* ? NC_002947 = 461168173 (1.120)4 (0.060) 4/250 NT 5.7% intergenic (+643/‑1464) hcpC‑II/PP_4084 hemolysin‑coregulated protein/hypothetical protein
?NC_002947 = 4611701 63 (1.020)intergenic (+663/‑1444) hcpC‑II/PP_4084 hemolysin‑coregulated protein/hypothetical protein
* ? NC_002947 4626524 =NA (NA)10 (0.150) 4/264 NT NA coding (980/1533 nt) PP_4091 transposase
?NC_002947 4626581 = NA (NA)coding (923/1533 nt) PP_4091 transposase
* ? NC_002947 4670169 =74 (1.140)5 (0.080) 5/258 NT 6.4% coding (501/1470 nt) nuoN NADH‑quinone oxidoreductase subunit N
?NC_002947 4670231 = 75 (1.180)coding (563/1470 nt) nuoN NADH‑quinone oxidoreductase subunit N
* ? NC_002947 = 468902571 (1.090)4 (0.060) 4/256 NT 5.6% coding (926/1020 nt) PP_4149 ABC transporter permease
?NC_002947 = 4689062 65 (1.030)coding (963/1020 nt) PP_4149 ABC transporter permease
* ? NC_002947 = 469683280 (1.230)4 (0.060) 4/250 NT 5.5% coding (459/906 nt) PP_4156 LysR family transcriptional regulator
?NC_002947 = 4696904 61 (0.990)coding (531/906 nt) PP_4156 LysR family transcriptional regulator
* ? NC_002947 = 470013661 (0.940)4 (0.070) 3/244 NT 6.2% coding (552/2655 nt) kdpD sensor protein
?NC_002947 = 4700167 64 (1.060)coding (521/2655 nt) kdpD sensor protein
* ? NC_002947 = 470264564 (0.980)4 (0.060) 4/252 NT 5.8% coding (815/2055 nt) kdpB K+ transporting ATPase subunit KdpB
?NC_002947 = 4702677 69 (1.110)coding (783/2055 nt) kdpB K+ transporting ATPase subunit KdpB
* ? NC_002947 4732101 =55 (0.850)4 (0.060) 4/256 NT 7.2% coding (660/1224 nt) sucB 2‑oxoglutarate dehydrogenase dihydrolipoyltranssuccinylase subunit
?NC_002947 4732147 = 50 (0.790)coding (614/1224 nt) sucB 2‑oxoglutarate dehydrogenase dihydrolipoyltranssuccinylase subunit
* ? NC_002947 = 477308772 (1.110)4 (0.070) 4/246 NT 6.0% coding (6180/10413 nt) pvdD non‑ribosomal peptide synthetase
?NC_002947 = 4773150 58 (0.960)coding (6117/10413 nt) pvdD non‑ribosomal peptide synthetase
* ? NC_002947 4808174 =1 (0.020)28 (0.590) 20/194 NT 59.7% intergenic (‑283/‑272) PP_4234/dsbD‑II bifunctional aldehyde oxidase/xanthine dehydrogenase/thiol/disulfide interchange protein 2
?NC_002947 = 5988935 37 (0.780)intergenic (+229/‑317) kefB‑III/PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
* ? NC_002947 = 48081791 (0.020)17 (0.290) 14/240 NT 35.1% intergenic (‑288/‑267) PP_4234/dsbD‑II bifunctional aldehyde oxidase/xanthine dehydrogenase/thiol/disulfide interchange protein 2
?NC_002947 5988765 = 62 (1.050)intergenic (+59/‑487) kefB‑III/PP_mr64 glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
* ? NC_002947 = 483774254 (0.830)3 (0.050) 3/252 NT 5.4% coding (311/609 nt) ccoO‑I cbb3‑type cytochrome c oxidase subunit
?NC_002947 = 4837792 54 (0.870)coding (361/609 nt) ccoO‑I cbb3‑type cytochrome c oxidase subunit
* ? NC_002947 4839026 =72 (1.110)4 (0.060) 4/250 NT 6.1% coding (790/942 nt) ccoP‑I cbb3‑type cytochrome c oxidase subunit
?NC_002947 4839072 = 55 (0.890)coding (836/942 nt) ccoP‑I cbb3‑type cytochrome c oxidase subunit
* ? NC_002947 = 484507662 (0.950)3 (0.050) 3/254 NT 5.5% coding (493/531 nt) PP_4260 hypothetical protein
?NC_002947 = 4845104 44 (0.700)coding (521/531 nt) PP_4260 hypothetical protein
* ? NC_002947 = 487083861 (0.940)5 (0.080) 5/252 NT 7.9% coding (69/846 nt) xdhC xanthine dehydrogenase accessory factor
?NC_002947 = 4870879 59 (0.950)coding (110/846 nt) xdhC xanthine dehydrogenase accessory factor
* ? NC_002947 4889569 =15 (0.230)8 (0.150) 7/210 NT 40.1% intergenic (+15/‑138) hyi/glxR hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
?NC_002947 4889660 = 12 (0.230)intergenic (+106/‑47) hyi/glxR hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
* ? NC_002947 = 488959514 (0.220)6 (0.120) 5/210 NT 34.2% intergenic (+41/‑112) hyi/glxR hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
?NC_002947 = 4889632 12 (0.230)intergenic (+78/‑75) hyi/glxR hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
* ? NC_002947 = 489639834 (0.520)7 (0.130) 7/222 NT 22.0% intergenic (+31/‑177) PP_4304/sbp‑I VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
?NC_002947 = 4896445 21 (0.380)intergenic (+78/‑130) PP_4304/sbp‑I VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
* ? NC_002947 4896901 =66 (1.010)4 (0.060) 4/254 NT 5.8% coding (327/999 nt) sbp‑I sulfate ABC transporter substrate‑binding protein
?NC_002947 4896938 = 66 (1.050)coding (364/999 nt) sbp‑I sulfate ABC transporter substrate‑binding protein
* ? NC_002947 4897592 =68 (1.040)4 (0.070) 3/248 NT 6.1% coding (952/957 nt) PP_4306 hypothetical protein
?NC_002947 4897630 = 59 (0.970)coding (914/957 nt) PP_4306 hypothetical protein
* ? NC_002947 4905667 =79 (1.210)4 (0.060) 4/252 NT 5.5% coding (356/489 nt) PP_4314 hypothetical protein
?NC_002947 4905704 = 62 (1.000)coding (319/489 nt) PP_4314 hypothetical protein
* ? NC_002947 = 495543368 (1.040)4 (0.070) 3/246 NT 5.6% coding (1322/1374 nt) fliI flagellum‑specific ATP synthase
?NC_002947 = 4955456 72 (1.190)coding (1299/1374 nt) fliI flagellum‑specific ATP synthase
* ? NC_002947 4979191 =57 (0.880)3 (0.050) 3/248 NT 5.2% coding (231/786 nt) flgG flagellar basal‑body rod protein FlgG
?NC_002947 4979266 = 56 (0.920)coding (156/786 nt) flgG flagellar basal‑body rod protein FlgG
* ? NC_002947 = 501798554 (0.830)4 (0.060) 3/252 NT 6.8% coding (872/1473 nt) gabD‑II succinate‑semialdehyde dehydrogenase
?NC_002947 = 5018018 58 (0.930)coding (839/1473 nt) gabD‑II succinate‑semialdehyde dehydrogenase
* ? NC_002947 = 508300864 (0.980)4 (0.060) 4/252 NT 6.6% coding (1258/2625 nt) alaS alanine‑‑tRNA ligase
?NC_002947 = 5083059 53 (0.850)coding (1207/2625 nt) alaS alanine‑‑tRNA ligase
* ? NC_002947 5084615 =54 (0.830)3 (0.050) 3/252 NT 5.6% intergenic (‑350/+35) alaS/astE alanine‑‑tRNA ligase/succinylglutamate desuccinylase
?NC_002947 5084650 = 50 (0.810)coding (1008/1008 nt) astE succinylglutamate desuccinylase
* ? NC_002947 = 509474961 (0.940)4 (0.060) 4/258 NT 6.3% coding (457/699 nt) hisM histidine/lysine/arginine/ornithine ABC transporter permease
?NC_002947 = 5094777 59 (0.930)coding (429/699 nt) hisM histidine/lysine/arginine/ornithine ABC transporter permease
* ? NC_002947 = 511463550 (0.770)4 (0.060) 4/250 NT 7.8% coding (313/666 nt) yciO maturation protein
?NC_002947 = 5114657 47 (0.760)coding (291/666 nt) yciO maturation protein
* ? NC_002947 = 514571964 (0.980)4 (0.070) 3/244 NT 6.0% coding (1035/1323 nt) srmB ATP‑dependent DEAD‑box RNA helicase
?NC_002947 = 5145802 66 (1.100)coding (952/1323 nt) srmB ATP‑dependent DEAD‑box RNA helicase
* ? NC_002947 = 51528550 (0.000)3 (0.050) 3/248 NT 100% intergenic (‑932/+482) PP_5696/PP_4537 hypothetical protein/membrane protein
?NC_002947 = 5152920 NA (NA)intergenic (‑997/+417) PP_5696/PP_4537 hypothetical protein/membrane protein
* ? NC_002947 5160379 =67 (1.030)4 (0.070) 3/248 NT 5.6% coding (676/1212 nt) PP_4543 hypothetical protein
?NC_002947 5160418 = 72 (1.180)coding (637/1212 nt) PP_4543 hypothetical protein
* ? NC_002947 5167753 =67 (1.030)7 (0.110) 7/250 NT 10.3% coding (127/3906 nt) hrpA ATP‑dependent helicase HrpA
?NC_002947 5167791 = 58 (0.940)coding (89/3906 nt) hrpA ATP‑dependent helicase HrpA
* ? NC_002947 5175549 =58 (0.890)4 (0.060) 4/250 NT 6.8% coding (352/945 nt) PP_4551 alpha/beta family hydrolase
?NC_002947 5175599 = 54 (0.880)coding (402/945 nt) PP_4551 alpha/beta family hydrolase
* ? NC_002947 5180685 =63 (0.970)4 (0.060) 4/252 NT 6.6% coding (302/537 nt) def‑II peptide deformylase
?NC_002947 5180727 = 54 (0.870)coding (260/537 nt) def‑II peptide deformylase
* ? NC_002947 5201579 =33 (0.510)5 (0.110) 4/190 NT 24.0% intergenic (‑65/‑115) PP_4582/PP_4583 membrane protein/putative Peptidase
?NC_002947 5201674 = 8 (0.170)intergenic (‑160/‑20) PP_4582/PP_4583 membrane protein/putative Peptidase
* ? NC_002947 = 521023443 (0.660)6 (0.110) 6/232 NT 10.6% intergenic (‑100/+78) rnd/PP_4592 ribonuclease D/metal dependent hydrolase
?NC_002947 = 5210293 63 (1.100)intergenic (‑159/+19) rnd/PP_4592 ribonuclease D/metal dependent hydrolase
* ? NC_002947 = 522582169 (1.060)4 (0.060) 4/254 NT 6.0% coding (59/876 nt) PP_4605 AraC family transcriptional regulator
?NC_002947 = 5225852 60 (0.960)coding (90/876 nt) PP_4605 AraC family transcriptional regulator
* ? NC_002947 5258313 =53 (0.810)3 (0.050) 3/248 NT 5.2% coding (844/1212 nt) PP_4635 trans‑2‑enoyl‑CoA reductase
?NC_002947 5258382 = 59 (0.970)coding (775/1212 nt) PP_4635 trans‑2‑enoyl‑CoA reductase
* ? NC_002947 5288394 =25 (0.380)4 (0.080) 4/204 NT 20.9% intergenic (‑75/+109) PP_4660/mdaB LysR family transcriptional regulator/drug activity modulator B
?NC_002947 5288488 = 11 (0.220)intergenic (‑169/+15) PP_4660/mdaB LysR family transcriptional regulator/drug activity modulator B
* ? NC_002947 = 528842324 (0.370)3 (0.060) 3/204 NT 16.9% intergenic (‑104/+80) PP_4660/mdaB LysR family transcriptional regulator/drug activity modulator B
?NC_002947 = 5288457 11 (0.220)intergenic (‑138/+46) PP_4660/mdaB LysR family transcriptional regulator/drug activity modulator B
* ? NC_002947 = 529549483 (1.280)5 (0.080) 5/250 NT 6.0% intergenic (+25/+101) PP_4668/PP_4669 LysR family transcriptional regulator/OmpA family protein
?NC_002947 = 5295563 79 (1.280)intergenic (+94/+32) PP_4668/PP_4669 LysR family transcriptional regulator/OmpA family protein
* ? NC_002947 5366891 =82 (1.260)4 (0.060) 3/250 NT 5.3% coding (486/624 nt) rlmE ribosomal RNA large subunit methyltransferase E
?NC_002947 5366942 = 66 (1.070)coding (435/624 nt) rlmE ribosomal RNA large subunit methyltransferase E
* ? NC_002947 5384955 =58 (0.890)5 (0.080) 5/246 NT 7.5% coding (1419/1671 nt) lldP L‑lactate permease
?NC_002947 5385070 = 70 (1.160)coding (1534/1671 nt) lldP L‑lactate permease
* ? NC_002947 = 540434460 (0.920)5 (0.090) 5/232 NT 7.5% intergenic (‑642/+75) PP_4746/PP_4748 transposase/amino acid ABC transporter substrate‑binding protein
?NC_002947 = 5404374 71 (1.240)intergenic (‑672/+45) PP_4746/PP_4748 transposase/amino acid ABC transporter substrate‑binding protein
* ? NC_002947 5417913 =66 (1.010)5 (0.080) 5/252 NT 7.4% coding (1158/1368 nt) PP_4758 MFS transporter
?NC_002947 5417958 = 62 (1.000)coding (1113/1368 nt) PP_4758 MFS transporter
* ? NC_002947 = 542309870 (1.080)4 (0.060) 4/250 NT 5.8% coding (308/537 nt) PP_4763 acetyltransferase
?NC_002947 = 5423127 64 (1.040)coding (279/537 nt) PP_4763 acetyltransferase
* ? NC_002947 5430223 =77 (1.180)4 (0.060) 4/250 NT 5.3% coding (96/480 nt) PP_4769 hypothetical protein
?NC_002947 5430263 = 71 (1.150)coding (56/480 nt) PP_4769 hypothetical protein
* ? NC_002947 5441588 =74 (1.140)4 (0.060) 4/258 NT 5.0% coding (996/1653 nt) PP_4780 acyl‑CoA dehydrogenase
?NC_002947 5441618 = 79 (1.240)coding (966/1653 nt) PP_4780 acyl‑CoA dehydrogenase
* ? NC_002947 = 544267852 (0.800)3 (0.050) 3/254 NT 5.2% intergenic (‑95/+113) PP_4780/PP_4781 acyl‑CoA dehydrogenase/sensor histidine kinase
?NC_002947 = 5442726 60 (0.960)intergenic (‑143/+65) PP_4780/PP_4781 acyl‑CoA dehydrogenase/sensor histidine kinase
* ? NC_002947 = 549220968 (1.040)8 (0.130) 7/250 NT 10.4% intergenic (‑10/+109) PP_5716/cobJ hypothetical protein/precorrin‑3B C17‑methyltransferase
?NC_002947 = 5492261 74 (1.200)intergenic (‑62/+57) PP_5716/cobJ hypothetical protein/precorrin‑3B C17‑methyltransferase
* ? NC_002947 5519019 =56 (0.860)5 (0.080) 4/244 NT 8.6% coding (711/789 nt) PP_4852 AraC family transcriptional regulator
?NC_002947 5519086 = 55 (0.920)coding (644/789 nt) PP_4852 AraC family transcriptional regulator
* ? NC_002947 = 551902860 (0.920)4 (0.070) 4/244 NT 6.8% coding (702/789 nt) PP_4852 AraC family transcriptional regulator
?NC_002947 = 5519075 55 (0.920)coding (655/789 nt) PP_4852 AraC family transcriptional regulator
* ? NC_002947 = 552699258 (0.890)3 (0.050) 3/256 NT 5.1% coding (505/1134 nt) PP_4860 mannose‑6‑phosphate isomerase
?NC_002947 = 5527020 55 (0.870)coding (533/1134 nt) PP_4860 mannose‑6‑phosphate isomerase
* ? NC_002947 5537031 =23 (0.350)3 (0.060) 4/210 NT 18.0% intergenic (+8/+95) nadE/PP_4870 NH(3)‑dependent NAD(+) synthetase/azurin
?NC_002947 5537107 = 9 (0.170)intergenic (+84/+19) nadE/PP_4870 NH(3)‑dependent NAD(+) synthetase/azurin
* ? NC_002947 5540637 =68 (1.040)4 (0.060) 3/256 NT 5.8% coding (349/2355 nt) PP_4872 hypothetical protein
?NC_002947 5540669 = 63 (1.000)coding (317/2355 nt) PP_4872 hypothetical protein
* ? NC_002947 5545321 =NA (NA)50 (0.780) 43/260 NT 98.1% intergenic (‑461/+416) rpsF/rlmB 30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
?NC_002947 = 5621245 1 (0.020)coding (19/774 nt) PP_4939 hypothetical protein
* ? NC_002947 = 5545666NA (NA)76 (1.200) 63/258 NT 98.7% intergenic (‑806/+71) rpsF/rlmB 30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
?NC_002947 5621244 = 1 (0.020)coding (20/774 nt) PP_4939 hypothetical protein
* ? NC_002947 5548441 =56 (0.860)3 (0.050) 3/246 NT 5.7% coding (613/2574 nt) rnr exoribonuclease R
?NC_002947 5548480 = 48 (0.790)coding (574/2574 nt) rnr exoribonuclease R
* ? NC_002947 5555200 =73 (1.120)6 (0.100) 5/246 NT 8.4% coding (325/459 nt) PP_4887 hypothetical protein
?NC_002947 5555263 = 63 (1.040)coding (262/459 nt) PP_4887 hypothetical protein
* ? NC_002947 5591337 =61 (0.940)4 (0.060) 4/254 NT 6.9% coding (545/630 nt) nudF ADP‑ribose/sugar pyrophosphatase
?NC_002947 5591385 = 50 (0.800)coding (497/630 nt) nudF ADP‑ribose/sugar pyrophosphatase
* ? NC_002947 = 561922076 (1.170)6 (0.100) 4/248 NT 7.5% coding (469/606 nt) PP_4937 toluene tolerance protein
?NC_002947 = 5619241 76 (1.240)coding (490/606 nt) PP_4937 toluene tolerance protein
* ? NC_002947 5629835 =66 (1.010)4 (0.060) 4/250 NT 5.9% coding (431/1629 nt) putP sodium/L‑proline transporter
?NC_002947 5629883 = 66 (1.070)coding (383/1629 nt) putP sodium/L‑proline transporter
* ? NC_002947 = 563972781 (1.240)4 (0.070) 4/248 NT 5.1% coding (819/1320 nt) PP_4950 hypothetical protein
?NC_002947 = 5639774 73 (1.190)coding (866/1320 nt) PP_4950 hypothetical protein
* ? NC_002947 5644528 =62 (0.950)4 (0.070) 4/248 NT 5.9% intergenic (+9/‑120) yhiN/PP_4954 FAD/NAD(P)‑binding domain‑containing oxidoreductase/membrane protein
?NC_002947 5644617 = 70 (1.150)intergenic (+98/‑31) yhiN/PP_4954 FAD/NAD(P)‑binding domain‑containing oxidoreductase/membrane protein
* ? NC_002947 5667574 =61 (0.940)5 (0.080) 3/252 NT 8.3% coding (121/402 nt) PP_4975 acyl‑CoA thioesterase
?NC_002947 5667616 = 53 (0.850)coding (79/402 nt) PP_4975 acyl‑CoA thioesterase
* ? NC_002947 5671615 =35 (0.540)5 (0.090) 5/216 NT 15.0% intergenic (+34/‑136) PP_4978/PP_4979 hypothetical protein/substrate‑binding protein
?NC_002947 5671700 = 28 (0.530)intergenic (+119/‑51) PP_4978/PP_4979 hypothetical protein/substrate‑binding protein
* ? NC_002947 5698727 =56 (0.860)4 (0.070) 4/230 NT 9.8% intergenic (+17/‑150) hslU/PP_5002 protease HslVU ATPase subunit/hypothetical protein
?NC_002947 5698810 = 25 (0.440)intergenic (+100/‑67) hslU/PP_5002 protease HslVU ATPase subunit/hypothetical protein
* ? NC_002947 5715379 =66 (1.010)4 (0.060) 4/250 NT 6.0% coding (46/378 nt) tatB Sec‑independent protein translocase protein TatB
?NC_002947 5715434 = 63 (1.020)coding (101/378 nt) tatB Sec‑independent protein translocase protein TatB
* ? NC_002947 = 574040362 (0.950)4 (0.070) 3/246 NT 6.8% coding (1333/1365 nt) hutF formiminoglutamate deiminase
?NC_002947 = 5740534 52 (0.860)coding (545/573 nt) PP_5037 lipocalin family lipoprotein
* ? NC_002947 = 575071073 (1.120)5 (0.080) 4/254 NT 6.8% coding (853/1455 nt) thiI tRNA sulfurtransferase
?NC_002947 = 5750758 67 (1.070)coding (805/1455 nt) thiI tRNA sulfurtransferase
* ? NC_002947 = 579737165 (1.000)4 (0.060) 4/256 NT 6.6% coding (529/4446 nt) gltB L‑glutamate synthase subunit alpha
?NC_002947 = 5797412 50 (0.790)coding (488/4446 nt) gltB L‑glutamate synthase subunit alpha
* ? NC_002947 5807429 =56 (0.860)3 (0.050) 3/254 NT 5.6% coding (2018/2454 nt) mrcA penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase
?NC_002947 5807464 = 47 (0.750)coding (2053/2454 nt) mrcA penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase
* ? NC_002947 = 581187669 (1.060)4 (0.060) 4/250 NT 6.0% coding (1204/2220 nt) priA primosome assembly protein
?NC_002947 = 5811907 59 (0.960)coding (1235/2220 nt) priA primosome assembly protein
* ? NC_002947 5823897 =83 (1.280)5 (0.080) 5/252 NT 5.9% coding (833/1176 nt) yggW coproporphyrinogen/heterocyclic compound oxidase
?NC_002947 5823932 = 80 (1.290)coding (868/1176 nt) yggW coproporphyrinogen/heterocyclic compound oxidase
* ? NC_002947 5842554 =64 (0.980)4 (0.060) 4/250 NT 6.3% coding (1123/1431 nt) calB coniferyl aldehyde dehydrogenase
?NC_002947 5842578 = 58 (0.940)coding (1147/1431 nt) calB coniferyl aldehyde dehydrogenase
* ? NC_002947 = 585086444 (0.680)4 (0.070) 4/248 NT 7.6% coding (1569/1842 nt) ilvD dihydroxy‑acid dehydratase
?NC_002947 = 5850932 56 (0.920)coding (1637/1842 nt) ilvD dihydroxy‑acid dehydratase
* ? NC_002947 = 585777282 (1.260)7 (0.110) 6/254 NT 8.3% coding (321/1371 nt) PP_5134 hypothetical protein
?NC_002947 = 5857793 76 (1.210)coding (342/1371 nt) PP_5134 hypothetical protein
* ? NC_002947 5861744 =63 (0.970)4 (0.060) 4/254 NT 6.6% coding (1045/1059 nt) fbpC ABC transporter ATP‑binding protein
?NC_002947 5861782 = 52 (0.830)coding (1007/1059 nt) fbpC ABC transporter ATP‑binding protein
* ? NC_002947 = 587531561 (0.940)5 (0.080) 5/258 NT 7.2% coding (856/1515 nt) ilvA‑II threonine deaminase
?NC_002947 = 5875360 70 (1.100)coding (811/1515 nt) ilvA‑II threonine deaminase
* ? NC_002947 = 587700734 (0.520)4 (0.080) 4/216 NT 12.0% intergenic (+29/+76) rpiA/PP_5151 ribose‑5‑phosphate isomerase A/hypothetical protein
?NC_002947 = 5877041 31 (0.580)intergenic (+63/+42) rpiA/PP_5151 ribose‑5‑phosphate isomerase A/hypothetical protein
* ? NC_002947 5890484 =60 (0.920)4 (0.060) 4/250 NT 6.8% coding (2139/2367 nt) PP_5164 penicillin amidase family protein
?NC_002947 5890539 = 53 (0.860)coding (2194/2367 nt) PP_5164 penicillin amidase family protein
* ? NC_002947 5907241 =80 (1.230)5 (0.080) 4/246 NT 6.7% coding (726/1095 nt) spuE spermidine/putrescine ABC transporter substrate‑binding protein
?NC_002947 5907301 = 64 (1.060)coding (666/1095 nt) spuE spermidine/putrescine ABC transporter substrate‑binding protein
* ? NC_002947 5914157 =33 (0.510)5 (0.100) 4/208 NT 17.3% intergenic (+49/+104) spuI/argA glutamylpolyamine synthetase/amino acid N‑acetyltransferase
?NC_002947 5914253 = 22 (0.430)intergenic (+145/+8) spuI/argA glutamylpolyamine synthetase/amino acid N‑acetyltransferase
* ? NC_002947 5916596 =73 (1.120)5 (0.080) 5/256 NT 6.6% coding (231/1143 nt) argE acetylornithine deacetylase
?NC_002947 5916648 = 71 (1.130)coding (179/1143 nt) argE acetylornithine deacetylase
* ? NC_002947 = 592455151 (0.780)3 (0.060) 3/214 NT 7.4% intergenic (‑121/+76) gcvP‑II/gcvH‑II glycine dehydrogenase/glycine cleavage system protein H
?NC_002947 = 5924587 34 (0.650)intergenic (‑157/+40) gcvP‑II/gcvH‑II glycine dehydrogenase/glycine cleavage system protein H
* ? NC_002947 5943601 =47 (0.720)3 (0.060) 3/220 NT 8.9% intergenic (+9/+76) PP_5210/PP_5211 alcohol dehydrogenase/ChaC‑related protein
?NC_002947 5943666 = 22 (0.410)intergenic (+74/+11) PP_5210/PP_5211 alcohol dehydrogenase/ChaC‑related protein
* ? NC_002947 = 596119561 (0.940)4 (0.060) 4/254 NT 6.2% coding (91/1248 nt) lysA‑II diaminopimelate decarboxylase
?NC_002947 = 5961227 63 (1.010)coding (123/1248 nt) lysA‑II diaminopimelate decarboxylase
* ? NC_002947 = 596236070 (1.080)7 (0.120) 6/246 NT 9.8% coding (37/864 nt) dapF diaminopimelate epimerase
?NC_002947 = 5962379 63 (1.040)coding (56/864 nt) dapF diaminopimelate epimerase
* ? NC_002947 = 597155372 (1.110)4 (0.060) 4/250 NT 5.3% coding (133/222 nt) PP_5237 hypothetical protein
?NC_002947 = 5971603 75 (1.220)coding (183/222 nt) PP_5237 hypothetical protein
* ? NC_002947 = 601927031 (0.480)3 (0.060) 3/218 NT 10.6% intergenic (‑71/+74) dadX/dadA‑II alanine racemase/D‑amino acid:quinone oxidoreductase
?NC_002947 = 6019300 25 (0.470)intergenic (‑101/+44) dadX/dadA‑II alanine racemase/D‑amino acid:quinone oxidoreductase
* ? NC_002947 = 604002994 (1.440)6 (0.100) 5/250 NT 6.2% coding (34/780 nt) PP_5292 catabolite repression control protein
?NC_002947 = 6040072 92 (1.490)coding (77/780 nt) PP_5292 catabolite repression control protein
* ? NC_002947 = 605007473 (1.120)5 (0.080) 4/256 NT 6.5% coding (936/2109 nt) spoT bifunctional (p)ppGpp synthase/hydrolase
?NC_002947 = 6050143 73 (1.160)coding (1005/2109 nt) spoT bifunctional (p)ppGpp synthase/hydrolase
* ? NC_002947 6072711 =74 (1.140)4 (0.060) 4/254 NT 5.7% coding (1545/1671 nt) PP_5327 phosphate ABC transporter permease
?NC_002947 6072738 = 62 (0.990)coding (1518/1671 nt) PP_5327 phosphate ABC transporter permease
* ? NC_002947 6118288 =61 (0.940)4 (0.060) 4/260 NT 6.2% coding (740/1158 nt) PP_5368 MFS transporter
?NC_002947 6118338 = 60 (0.940)coding (690/1158 nt) PP_5368 MFS transporter
* ? NC_002947 6142056 =73 (1.120)6 (0.100) 6/244 NT 7.8% coding (1792/3159 nt) cusA CzcA family RND family copper transporter
?NC_002947 6142126 = 75 (1.250)coding (1862/3159 nt) cusA CzcA family RND family copper transporter
* ? NC_002947 = 614272179 (1.210)6 (0.100) 6/248 NT 7.1% coding (2457/3159 nt) cusA CzcA family RND family copper transporter
?NC_002947 = 6142749 84 (1.370)coding (2485/3159 nt) cusA CzcA family RND family copper transporter