mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| RA | CP000731 | 81 | N→G | 100% | intergenic (–/‑151) | – / → repA | –/replication protein A |
| JC | CP000731 | 6,552 | +28 bp | 100% | intergenic (+1069/‑419) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| RA | CP000731 | 25,663 | Δ1 bp | 100% | coding (316/333 nt) | USA300HOU_pUSA300HOUMR0031 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 9,710 | T→C | 5.1% | intergenic (+15/+72) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 92,982 | C→T | 6.1% | intergenic (‑67/‑70) | ricR_1 ← / → glpE | Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE |
| RA | USA300TCH1516_ALE | 92,987 | A→G | 8.3% | intergenic (‑72/‑65) | ricR_1 ← / → glpE | Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE |
| RA | USA300TCH1516_ALE | 110,660 | T→A | 8.6% | I173I (ATT→ATA) | USA300HOU_RS00515 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,512 | A→G | 26.3% | S194S (TCA→TCG) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,516 | C→A | 25.7% | Q196K (CAA→AAA) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 512,643 | A→G | 20.2% | intergenic (+711/‑6052) | recR → / → speA_2 | Recombination protein RecR/Arginine decarboxylase |
| RA | USA300TCH1516_ALE | 622,479 | T→C | 6.1% | D1014D (GAT→GAC) | sdrE → | Serine‑aspartate repeat‑containing protein E |
| RA | USA300TCH1516_ALE | 779,970 | G→A | 5.2% | intergenic (+26/+46) | csbB → / ← saeS | Putative glycosyltransferase CsbB/Histidine protein kinase SaeS |
| RA | USA300TCH1516_ALE | 937,148 | T→C | 5.6% | intergenic (+55/‑76) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 937,158 | T→A | 7.0% | intergenic (+65/‑66) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 1,042,796 | G→A | 5.9% | intergenic (+26/+63) | tagE_3 → / ← catD | Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD |
| RA | USA300TCH1516_ALE | 1,416,458 | A→T | 100% | I216N (ATT→AAT) | oppD_4 ← | Oligopeptide transport ATP‑binding protein OppD |
| RA | USA300TCH1516_ALE | 1,435,073 | G→A | 6.6% | G144S (GGT→AGT) | dapH → | 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase |
| RA | USA300TCH1516_ALE | 1,513,930 | A→T | 100% | L413F (TTA→TTT) | USA300HOU_RS07375 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,562,170 | C→A | 5.8% | intergenic (‑136/+254) | hlgC_1 ← / ← lytN_2 | Gamma‑hemolysin component C/putative cell wall hydrolase LytN |
| RA | USA300TCH1516_ALE | 1,646,189 | G→C | 100% | A155G (GCA→GGA) | ypdF ← | Aminopeptidase YpdF |
| RA | USA300TCH1516_ALE | 2,010,363 | C→T | 100% | C146Y (TGT→TAT) | USA300HOU_RS10125 ← | Putative multidrug export ATP‑binding/permease protein |
| RA | USA300TCH1516_ALE | 2,187,338 | C→T | 11.5% | G242D (GGT→GAT) | rsbU ← | Phosphoserine phosphatase RsbU |
| RA | USA300TCH1516_ALE | 2,187,389 | C→A | 10.3% | G225V (GGA→GTA) | rsbU ← | Phosphoserine phosphatase RsbU |
| RA | USA300TCH1516_ALE | 2,211,248 | A→T | 5.1% | intergenic (+241/+572) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,305 | A→G | 6.0% | intergenic (+298/+515) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,243,494 | A→T | 5.2% | intergenic (+72/+37) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,243,499 | T→A | 5.7% | intergenic (+77/+32) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,279,705 | G→A | 100% | A943V (GCA→GTA) | ebh_3 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 2,372,407 | A→G | 5.1% | intergenic (+158/+34) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,372,413 | C→G | 6.1% | intergenic (+164/+28) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,532,298 | A→T | 100% | T15T (ACA→ACT) | femA_3 → | Aminoacyltransferase FemA |
| RA | USA300TCH1516_ALE | 2,559,830 | A→G | 5.6% | intergenic (+24/+99) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,831 | G→A | 5.4% | intergenic (+25/+98) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,840 | T→G | 6.1% | intergenic (+34/+89) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,841 | C→A | 5.8% | intergenic (+35/+88) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,608,825 | A→T | 5.2% | intergenic (+106/+154) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,774,855 | A→G | 5.9% | D777D (GAT→GAC) | clfB ← | Clumping factor B |
| RA | USA300TCH1516_ALE | 2,775,089 | A→G | 5.9% | D699D (GAT→GAC) | clfB ← | Clumping factor B |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP000731 | 34 = | 390 (0.350) | 36 (0.040) | 17/146 | NT | 6.8% | intergenic (–/‑198) | –/repA | –/replication protein A |
| ? | CP000731 | 65 = | 624 (0.610) | intergenic (–/‑167) | –/repA | –/replication protein A | |||||
| * | ? | CP000731 | 12615 = | 365 (0.320) | 23 (0.020) | 8/148 | NT | 8.9% | coding (109/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase |
| ? | CP000731 | 12634 = | 135 (0.130) | coding (128/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase | |||||
| * | ? | CP000731 | = 12916 | NA (NA) | 21 (0.020) | 15/148 | NT | NA | coding (410/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase |
| ? | CP000731 | = 12919 | NA (NA) | coding (413/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase | |||||
| * | ? | CP000731 | = 17001 | NA (NA) | 32 (0.030) | 15/148 | NT | 100% | coding (61/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase |
| ? | CP000731 | = 17016 | 0 (0.000) | coding (46/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase | |||||
| * | ? | CP000731 | 17008 = | NA (NA) | 37 (0.040) | 17/148 | NT | 100% | coding (54/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase |
| ? | CP000731 | 17011 = | 0 (0.000) | coding (51/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase | |||||
| * | ? | CP000731 | = 21481 | 816 (0.720) | 42 (0.040) | 17/144 | NT | 5.2% | intergenic (‑411/‑63) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter |
| ? | CP000731 | = 21492 | 791 (0.780) | intergenic (‑422/‑52) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter | |||||
| * | ? | NC_012417 | 987 = | 4365 (0.410) | 216 (0.020) | 34/138 | NT | 5.8% | pseudogene (708/709 nt) | USA300HOU_RS14890 | replication protein |
| ? | NC_012417 | 1013 = | 3279 (0.360) | coding (182/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 997 | 3941 (0.370) | 264 (0.030) | 44/138 | NT | 7.3% | intergenic (+9/+6) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein |
| ? | NC_012417 | = 1001 | 3279 (0.360) | intergenic (+13/+2) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein | |||||
| * | ? | NC_012417 | = 1992 | 1343 (0.130) | 445 (0.050) | 42/148 | NT | 21.3% | intergenic (+225/+101) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | = 2020 | 2051 (0.210) | intergenic (+253/+73) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1993 = | NA (NA) | 277 (0.030) | 27/148 | NT | 11.5% | intergenic (+226/+100) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | 2021 = | 2296 (0.220) | intergenic (+254/+72) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 25361 | 290 (0.950) | 15 (0.060) | 11/140 | NT | 5.2% | coding (410/702 nt) | walR | Transcriptional regulatory protein WalR |
| ? | USA300TCH1516_ALE | = 25368 | 295 (1.100) | coding (417/702 nt) | walR | Transcriptional regulatory protein WalR | |||||
| * | ? | USA300TCH1516_ALE | 42564 = | 348 (1.140) | 13 (0.060) +TACATTATAAAATACATATC |
8/120 | NT | 5.2% | coding (1402/1524 nt) | USA300TCH1516_00035 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2479065 | 290 (0.950) | intergenic (+21/+119) | USA300HOU_RS12765/hrtA_2 | hypothetical protein/Putative hemin import ATP‑binding protein HrtA | |||||
| * | ? | USA300TCH1516_ALE | 118853 = | 353 (1.150) | 22 (0.080) | 16/140 | NT | 7.1% | intergenic (+401/+92) | norB_1/USA300HOU_RS00550 | Quinolone resistance protein NorB/hypothetical protein |
| ? | USA300TCH1516_ALE | 118888 = | 264 (0.990) | intergenic (+436/+57) | norB_1/USA300HOU_RS00550 | Quinolone resistance protein NorB/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 133002 = | 320 (1.050) | 18 (0.060) | 12/152 | NT | 5.4% | coding (118/996 nt) | yfiZ_1 | putative siderophore transport system permease protein YfiZ |
| ? | USA300TCH1516_ALE | 133036 = | 325 (1.120) | coding (84/996 nt) | yfiZ_1 | putative siderophore transport system permease protein YfiZ | |||||
| * | ? | USA300TCH1516_ALE | 234741 = | 319 (1.040) | 23 (0.090) | 16/140 | NT | 8.4% | intergenic (+39/+226) | USA300HOU_RS01045/gsiA | hypothetical protein/Glutathione import ATP‑binding protein GsiA |
| ? | USA300TCH1516_ALE | 234774 = | 225 (0.840) | intergenic (+72/+193) | USA300HOU_RS01045/gsiA | hypothetical protein/Glutathione import ATP‑binding protein GsiA | |||||
| * | ? | USA300TCH1516_ALE | = 286957 | 239 (0.780) | 15 (0.060) | 10/140 | NT | 6.2% | intergenic (+36/‑303) | rihA/manR_1 | Pyrimidine‑specific ribonucleoside hydrolase RihA/Transcriptional regulator ManR |
| ? | USA300TCH1516_ALE | = 286973 | 243 (0.910) | intergenic (+52/‑287) | rihA/manR_1 | Pyrimidine‑specific ribonucleoside hydrolase RihA/Transcriptional regulator ManR | |||||
| * | ? | USA300TCH1516_ALE | 318807 = | 95 (0.310) | 26 (0.090) | 7/150 | NT | 22.6% | intergenic (+170/‑58) | USA300HOU_RS01425/USA300TCH1516_00272 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1804927 | NA (NA) | intergenic (‑215/+426) | USA300TCH1516_01684/pyk | hypothetical protein/Pyruvate kinase | |||||
| * | ? | USA300TCH1516_ALE | 365029 = | 323 (1.060) | 17 (0.070) | 8/136 | NT | 6.1% | intergenic (+39/+66) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter |
| ? | USA300TCH1516_ALE | 365083 = | 250 (0.960) | intergenic (+93/+12) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter | |||||
| * | ? | USA300TCH1516_ALE | = 492723 | 272 (0.890) | 14 (0.060) | 12/128 | NT | 5.5% | intergenic (+145/+40) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein |
| ? | USA300TCH1516_ALE | = 492741 | 263 (1.080) | intergenic (+163/+22) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 512969 = | NA (NA) | 28 (0.100) | 17/142 | NT | NA | intergenic (+1037/‑5726) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 512991 = | NA (NA) | intergenic (+1059/‑5704) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 513404 = | NA (NA) | 28 (0.100) | 17/148 | NT | NA | intergenic (+1472/‑5291) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 513421 = | NA (NA) | intergenic (+1489/‑5274) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 514606 | NA (NA) | 39 (0.140) | 24/146 | NT | NA | intergenic (+2674/‑4089) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 514610 | NA (NA) | intergenic (+2678/‑4085) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 514979 = | NA (NA) | 13 (0.050) | 15/142 | NT | NA | intergenic (+3047/‑3716) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 514999 = | NA (NA) | intergenic (+3067/‑3696) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 515130 | NA (NA) | 34 (0.120) | 12/146 | NT | NA | intergenic (+3198/‑3565) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 515141 | NA (NA) | intergenic (+3209/‑3554) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 515911 = | NA (NA) | 17 (0.060) | 10/146 | NT | NA | intergenic (+3979/‑2784) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 515928 = | NA (NA) | intergenic (+3996/‑2767) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 515917 | NA (NA) | 14 (0.050) | 12/146 | NT | NA | intergenic (+3985/‑2778) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 515920 | NA (NA) | intergenic (+3988/‑2775) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 516601 | NA (NA) | 9 (0.030) | 7/146 | NT | NA | intergenic (+4669/‑2094) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 516604 | NA (NA) | intergenic (+4672/‑2091) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 516934 = | NA (NA) | 22 (0.080) | 13/148 | NT | NA | intergenic (+5002/‑1761) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 516951 = | NA (NA) | intergenic (+5019/‑1744) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 516988 = | NA (NA) | 33 (0.120) | 17/146 | NT | NA | intergenic (+5056/‑1707) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 517013 = | NA (NA) | intergenic (+5081/‑1682) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 517440 = | NA (NA) | 30 (0.110) | 15/146 | NT | NA | intergenic (+5508/‑1255) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 517458 = | NA (NA) | intergenic (+5526/‑1237) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 517446 | NA (NA) | 19 (0.070) | 8/146 | NT | NA | intergenic (+5514/‑1249) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 517450 | NA (NA) | intergenic (+5518/‑1245) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 517640 | NA (NA) | 40 (0.140) | 13/148 | NT | NA | intergenic (+5708/‑1055) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 517643 | NA (NA) | intergenic (+5711/‑1052) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 556088 = | 312 (1.020) | 80 (0.270) +TA |
14/156 | NT | 20.8% | intergenic (+556/‑129) | lysS/USA300TCH1516_00497 | Lysine‑‑tRNA ligase/tRNA‑Val |
| ? | USA300TCH1516_ALE | 561925 = | NA (NA) | intergenic (+3138/+664) | USA300TCH1516_00505/gabR | tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR | |||||
| * | ? | USA300TCH1516_ALE | = 557256 | NA (NA) | 32 (0.120) | 13/142 | NT | NA | intergenic (+314/‑1455) | USA300TCH1516_00504/USA300TCH1516_00505 | tRNA‑Ala/tRNA‑Ile |
| ? | USA300TCH1516_ALE | = 557260 | NA (NA) | intergenic (+318/‑1451) | USA300TCH1516_00504/USA300TCH1516_00505 | tRNA‑Ala/tRNA‑Ile | |||||
| * | ? | USA300TCH1516_ALE | 558897 = | NA (NA) | 25 (0.090) | 14/146 | NT | NA | intergenic (+110/+3692) | USA300TCH1516_00505/gabR | tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR |
| ? | USA300TCH1516_ALE | 558915 = | NA (NA) | intergenic (+128/+3674) | USA300TCH1516_00505/gabR | tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR | |||||
| * | ? | USA300TCH1516_ALE | 594301 = | 343 (1.120) | 18 (0.070) | 14/140 | NT | 6.0% | coding (405/414 nt) | rpsL | 30S ribosomal protein S12 |
| ? | USA300TCH1516_ALE | 594325 = | 269 (1.010) | intergenic (+15/‑51) | rpsL/rpsG | 30S ribosomal protein S12/30S ribosomal protein S7 | |||||
| * | ? | USA300TCH1516_ALE | 601279 = | 358 (1.170) | 18 (0.060) | 10/148 | NT | 5.2% | intergenic (+13/‑253) | USA300HOU_RS02890/hchA | Putative pyridoxal phosphate‑dependent acyltransferase/Molecular chaperone Hsp31 and glyoxalase 3 |
| ? | USA300TCH1516_ALE | 601302 = | 320 (1.130) | intergenic (+36/‑230) | USA300HOU_RS02890/hchA | Putative pyridoxal phosphate‑dependent acyltransferase/Molecular chaperone Hsp31 and glyoxalase 3 | |||||
| * | ? | USA300TCH1516_ALE | 686128 = | 325 (1.060) | 16 (0.060) | 10/138 | NT | 5.8% | coding (32/1848 nt) | USA300HOU_RS03310 | hypothetical protein |
| ? | USA300TCH1516_ALE | 686157 = | 244 (0.930) | coding (3/1848 nt) | USA300HOU_RS03310 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 704282 | 260 (0.850) | 21 (0.090) | 11/122 | NT | 8.4% | intergenic (+32/+1128) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | = 704292 | 262 (1.130) | intergenic (+42/+1118) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | = 775565 | 249 (0.810) | 13 (0.050) | 7/142 | NT | 5.3% | coding (549/1182 nt) | nagA | N‑acetylglucosamine‑6‑phosphate deacetylase |
| ? | USA300TCH1516_ALE | = 775573 | 244 (0.900) | coding (557/1182 nt) | nagA | N‑acetylglucosamine‑6‑phosphate deacetylase | |||||
| * | ? | USA300TCH1516_ALE | 848248 = | 227 (0.740) | 21 (0.080) | 6/144 | NT | 10.4% | intergenic (+253/‑627) | trxB/USA300HOU_RS04145 | Thioredoxin reductase/Nucleotide‑binding protein |
| ? | USA300TCH1516_ALE | 848268 = | 156 (0.570) | intergenic (+273/‑607) | trxB/USA300HOU_RS04145 | Thioredoxin reductase/Nucleotide‑binding protein | |||||
| * | ? | USA300TCH1516_ALE | = 1115642 | 262 (0.860) | 13 (0.050) | 10/146 | NT | 5.1% | intergenic (‑137/+47) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1115662 | 249 (0.890) | intergenic (‑157/+27) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1205323 | 260 (0.850) | 22 (0.080) +AGCGAAGCC |
12/142 | NT | 8.7% | intergenic (‑204/‑365) | USA300HOU_RS15290/lspA | hypothetical protein/Lipoprotein signal peptidase |
| ? | USA300TCH1516_ALE | = 1443685 | NA (NA) | intergenic (‑258/+95) | USA300TCH1516_01342/brnQ_3 | hypothetical protein/Branched‑chain amino acid transport system 2 carrier protein | |||||
| * | ? | USA300TCH1516_ALE | 1205338 = | 269 (0.880) | 14 (0.050) | 11/140 | NT | 6.0% | intergenic (‑219/‑350) | USA300HOU_RS15290/lspA | hypothetical protein/Lipoprotein signal peptidase |
| ? | USA300TCH1516_ALE | = 2478358 | 207 (0.770) | intergenic (+245/‑330) | USA300HOU_RS12760/USA300HOU_RS12765 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1427019 | NA (NA) | 21 (0.070) | 8/148 | NT | NA | intergenic (‑750/+222) | pstS/cvfB | Phosphate‑binding protein PstS/Conserved virulence factor B |
| ? | USA300TCH1516_ALE | = 1427022 | NA (NA) | intergenic (‑753/+219) | pstS/cvfB | Phosphate‑binding protein PstS/Conserved virulence factor B | |||||
| * | ? | USA300TCH1516_ALE | 1456948 = | 231 (0.750) | 30 (0.100) +GTTTT |
5/150 | NT | 11.5% | intergenic (‑62/‑182) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1918540 | 264 (0.860) | intergenic (‑258/+240) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1456995 = | 207 (0.680) | 34 (0.120) +TTAAA |
10/150 | NT | 12.8% | intergenic (‑109/‑135) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1918582 | 287 (0.940) | intergenic (‑300/+198) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1457619 | NA (NA) | 13 (0.050) | 12/148 | NT | NA | intergenic (+4/+127) | USA300HOU_RS07235/ybjG | hypothetical protein/Putative undecaprenyl‑diphosphatase YbjG |
| ? | USA300TCH1516_ALE | = 1457621 | NA (NA) | intergenic (+6/+125) | USA300HOU_RS07235/ybjG | hypothetical protein/Putative undecaprenyl‑diphosphatase YbjG | |||||
| * | ? | USA300TCH1516_ALE | 1533866 = | 287 (0.940) | 14 (0.050) | 11/138 | NT | 5.8% | coding (219/588 nt) | USA300HOU_RS07480 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1533900 = | 207 (0.790) | coding (185/588 nt) | USA300HOU_RS07480 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1545880 | 253 (0.830) | 15 (0.060) | 9/140 | NT | 5.9% | intergenic (‑183/+39) | der_1/rpsA_1 | GTPase Der/30S ribosomal protein S1 |
| ? | USA300TCH1516_ALE | = 1545890 | 254 (0.950) | intergenic (‑193/+29) | der_1/rpsA_1 | GTPase Der/30S ribosomal protein S1 | |||||
| * | ? | USA300TCH1516_ALE | = 1747722 | 234 (0.760) | 13 (0.050) | 9/146 | NT | 5.6% | coding (1727/2280 nt) | USA300HOU_RS08710 | Heme uptake protein MmpL11 |
| ? | USA300TCH1516_ALE | = 1747725 | 224 (0.800) | coding (1724/2280 nt) | USA300HOU_RS08710 | Heme uptake protein MmpL11 | |||||
| * | ? | USA300TCH1516_ALE | 1856910 = | 273 (0.890) | 13 (0.050) | 11/144 | NT | 5.4% | intergenic (‑595/+105) | aroF/USA300HOU_RS09235 | Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1856940 = | 211 (0.770) | intergenic (‑625/+75) | aroF/USA300HOU_RS09235 | Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1865746 | 227 (0.740) | 18 (0.070) | 10/138 | NT | 7.8% | intergenic (‑70/+30) | USA300HOU_RS09260/ytpP | hypothetical protein/Thioredoxin‑like protein YtpP |
| ? | USA300TCH1516_ALE | = 1865756 | 233 (0.880) | intergenic (‑80/+20) | USA300HOU_RS09260/ytpP | hypothetical protein/Thioredoxin‑like protein YtpP | |||||
| * | ? | USA300TCH1516_ALE | = 1893295 | 164 (0.540) | 13 (0.050) | 7/146 | NT | 8.0% | intergenic (‑156/+191) | USA300TCH1516_01750/ytpA | hypothetical protein/Phospholipase YtpA |
| ? | USA300TCH1516_ALE | = 1893298 | 148 (0.530) | intergenic (‑159/+188) | USA300TCH1516_01750/ytpA | hypothetical protein/Phospholipase YtpA | |||||
| * | ? | USA300TCH1516_ALE | 1955647 = | 267 (0.870) | 11 (0.040) | 9/138 | NT | 5.1% | intergenic (‑701/+421) | gdmA/lukDv_2 | Lantibiotic gallidermin/Leucotoxin LukDv |
| ? | USA300TCH1516_ALE | 1955675 = | 180 (0.680) | intergenic (‑729/+393) | gdmA/lukDv_2 | Lantibiotic gallidermin/Leucotoxin LukDv | |||||
| * | ? | USA300TCH1516_ALE | 2145574 = | 252 (0.820) | 14 (0.050) | 9/140 | NT | 5.4% | intergenic (+108/‑253) | USA300HOU_RS10945/USA300HOU_RS10950 | hypothetical protein/2‑oxoglutaramate amidase |
| ? | USA300TCH1516_ALE | = 2220716 | 268 (1.000) | intergenic (‑367/+195) | USA300HOU_RS11345/atpC | hypothetical protein/ATP synthase epsilon chain | |||||
| * | ? | USA300TCH1516_ALE | 2256396 = | 195 (0.640) | 17 (0.070) | 10/132 | NT | 9.1% | intergenic (+49/+72) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U |
| ? | USA300TCH1516_ALE | 2256443 = | 179 (0.710) | intergenic (+96/+25) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U | |||||
| * | ? | USA300TCH1516_ALE | 2335006 = | 266 (0.870) | 22 (0.090) | 14/134 | NT | 9.5% | intergenic (+11/+280) | cobB_2/USA300HOU_RS11915 | NAD‑dependent protein deacetylase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2335040 = | 197 (0.770) | intergenic (+45/+246) | cobB_2/USA300HOU_RS11915 | NAD‑dependent protein deacetylase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2442806 = | 247 (0.810) | 10 (0.040) | 6/128 | NT | 5.1% | intergenic (+3/+55) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | 2442855 = | 177 (0.730) | intergenic (+52/+6) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2442821 | 245 (0.800) | 16 (0.070) | 11/128 | NT | 7.9% | intergenic (+18/+40) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2442838 | 177 (0.730) | intergenic (+35/+23) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2483085 = | 346 (1.130) | 20 (0.080) | 12/136 | NT | 7.0% | intergenic (+5/‑158) | hssS/USA300HOU_RS12790 | Heme sensor protein HssS/putative HTH‑type transcriptional regulator |
| ? | USA300TCH1516_ALE | 2483126 = | 235 (0.910) | intergenic (+46/‑117) | hssS/USA300HOU_RS12790 | Heme sensor protein HssS/putative HTH‑type transcriptional regulator | |||||
| * | ? | USA300TCH1516_ALE | = 2526366 | 288 (0.940) | 23 (0.090) | 14/140 | NT | 7.8% | intergenic (‑172/+61) | ytmI/nirC | putative N‑acetyltransferase YtmI/Nitrite transporter NirC |
| ? | USA300TCH1516_ALE | = 2526372 | 291 (1.090) | intergenic (‑178/+55) | ytmI/nirC | putative N‑acetyltransferase YtmI/Nitrite transporter NirC | |||||
| * | ? | USA300TCH1516_ALE | = 2561214 | 299 (0.980) | 18 (0.070) | 9/132 | NT | 6.4% | intergenic (+43/+20) | USA300HOU_RS13195/cpdA | hypothetical protein/3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA |
| ? | USA300TCH1516_ALE | = 2561222 | 280 (1.110) | intergenic (+51/+12) | USA300HOU_RS13195/cpdA | hypothetical protein/3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA | |||||
| * | ? | USA300TCH1516_ALE | = 2600658 | 275 (0.900) | 17 (0.060) | 11/144 | NT | 6.2% | intergenic (‑70/+797) | dapF/USA300HOU_RS13395 | Diaminopimelate epimerase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2600666 | 266 (0.970) | intergenic (‑78/+789) | dapF/USA300HOU_RS13395 | Diaminopimelate epimerase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2660570 = | 252 (0.820) | 25 (0.100) | 11/136 | NT | 10.2% | intergenic (+12/+237) | ldhD_1/ybiV | D‑lactate dehydrogenase/Sugar phosphatase YbiV |
| ? | USA300TCH1516_ALE | 2660603 = | 228 (0.880) | intergenic (+45/+204) | ldhD_1/ybiV | D‑lactate dehydrogenase/Sugar phosphatase YbiV | |||||
| * | ? | USA300TCH1516_ALE | = 2660581 | 253 (0.830) | 23 (0.090) | 14/136 | NT | 9.4% | intergenic (+23/+226) | ldhD_1/ybiV | D‑lactate dehydrogenase/Sugar phosphatase YbiV |
| ? | USA300TCH1516_ALE | = 2660590 | 228 (0.880) | intergenic (+32/+217) | ldhD_1/ybiV | D‑lactate dehydrogenase/Sugar phosphatase YbiV | |||||
| * | ? | USA300TCH1516_ALE | = 2687481 | 243 (0.790) | 13 (0.050) | 10/138 | NT | 5.8% | intergenic (+35/+34) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2687499 | 212 (0.800) | intergenic (+53/+16) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2847743 | 240 (0.780) | 14 (0.060) | 9/132 | NT | 6.0% | intergenic (+52/+97) | yceI/USA300HOU_RS14590 | Protein YceI/Lactonase drp35 |
| ? | USA300TCH1516_ALE | = 2847754 | 241 (0.960) | intergenic (+63/+86) | yceI/USA300HOU_RS14590 | Protein YceI/Lactonase drp35 | |||||
| * | ? | USA300TCH1516_ALE | 2863041 = | 307 (1.000) | 16 (0.060) | 12/142 | NT | 5.4% | intergenic (+11/+49) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2863075 = | 290 (1.070) | intergenic (+45/+15) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2866995 | 276 (0.900) | 14 (0.050) | 12/134 | NT | 5.3% | intergenic (‑394/+59) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein |
| ? | USA300TCH1516_ALE | = 2867006 | 274 (1.070) | intergenic (‑405/+48) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein | |||||