New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913_3_hsa_pgi 257908 =NA (NA)23 (0.230) 23/296 5.1 24.7% intergenic (+9/‑768) crl/crl pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers
?NC_000913_3_hsa_pgi = 314992 70 (0.690)pseudogene (636/872 nt) eaeH pseudogene, attaching and effacing protein homology;factor; Not classified
Rejected: Coverage evenness skew score above cutoff.

TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC  >  NC_000913_3_hsa_pgi/257768‑257916
                                                                                                                                            |        
ttAAAAATATGCTAAAATTTGCCAATTTGGTAAAACAGTTGAATCACAACAGGAGATAGAAATGACTTTACAGAGAGGACACCCGAAGAGCAGATTTATCAAAAAATTTAACGAAATAAGCCCGTATATTCGTTAaggtaagtgcaaaa  >  1:165318/1‑143 (MQ=255)
                                                                                                                                            |        
TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC  >  NC_000913_3_hsa_pgi/257768‑257916

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 16 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.