breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 13,094 A→T 42.1% D311V (GAT→GTT)  dnaK → chaperone Hsp70, co‑chaperone with DnaJ
RA 17,199 G→T 48.1% intergenic (+3/‑57) nhaA → / → nhaR sodium‑proton antiporter/DNA‑binding transcriptional activator
RA 21,090 A→G 55.2% D341G (GAC→GGC)  ileS → isoleucyl‑tRNA synthetase
RA 30,585 T→C 5.3% A697A (GCT→GCC)  carB → carbamoyl‑phosphate synthase large subunit
RA 40,322 C→T 5.7% P81L (CCG→CTG)  fixA → predicted electron transfer flavoprotein subunit, ETFP adenine nucleotide‑binding domain
RA 62,679 A→G 71.4% F260F (TTT→TTC)  polB ← DNA polymerase II
RA 93,390 A→C 5.2% K124N (AAA→AAC)  secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 93,391 G→T 5.2% G125C (GGC→TGC) ‡ secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 93,392 G→A 5.2% G125D (GGC→GAC) ‡ secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 93,401 T→C 5.2% V128A (GTA→GCA) ‡ secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 93,402 A→C 5.2% V128V (GTA→GTC) ‡ secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 93,403 G→T 5.2% V129F (GTT→TTT)  secA → preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
RA 120,663 C→T 63.8% C181Y (TGC→TAC)  speE ← spermidine synthase
RA 126,351 G→A 6.1% E61K (GAA→AAA)  hpt → hypoxanthine phosphoribosyltransferase
RA 136,259 A→C 7.9% I27M (ATT→ATG)  yadK ← predicted fimbrial‑like adhesin protein
RA 136,262 G→T 8.0% A26A (GCC→GCA)  yadK ← predicted fimbrial‑like adhesin protein
RA 145,530 T→A 60.4% T233S (ACA→TCA)  sfsA ← predicted DNA‑binding transcriptional regulator
RA 151,149 C→T 60.0% S560S (AGC→AGT)  mrcB → fused glycosyl transferase and transpeptidase
RA 204,556 A→G 100% intergenic (+156/‑28) alaV → / → rrlH tRNA‑Ala/23S ribosomal RNA
RA 214,925 A→C 23.3% D12A (GAT→GCT)  dnaQ → DNA polymerase III epsilon subunit
RA 214,931 A→C 26.0% E14A (GAA→GCA)  dnaQ → DNA polymerase III epsilon subunit
RA 217,996 A→T 9.7% intergenic (‑88/‑18) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 218,030 A→G 8.7% Y6C (TAC→TGC)  yafF → conserved hypothetical protein
RA 218,049 C→T 9.1% N12N (AAC→AAT)  yafF → conserved hypothetical protein
RA 218,106 G→T 16.7% E31D (GAG→GAT)  yafF → conserved hypothetical protein
RA 226,884 T→A 8.1% M327K (ATG→AAG)  frsA → hydrolase, binds to enzyme IIA(Glc)
RA 226,889 G→C 9.1% D329H (GAT→CAT)  frsA → hydrolase, binds to enzyme IIA(Glc)
RA 226,894 T→A 7.3% A330A (GCT→GCA)  frsA → hydrolase, binds to enzyme IIA(Glc)
RA 232,635 T→C 8.3% N43D (AAC→GAC)  hemB ← porphobilinogen synthase
RA 232,901 C→T 10.0% intergenic (‑140/+30) hemB ← / ← ykiB porphobilinogen synthase/hypothetical protein
RA 234,698 T→A 9.1% intergenic (+7/‑176) yaiI → / → aroL conserved hypothetical protein/shikimate kinase II
RA 234,700 T→A 10.2% intergenic (+9/‑174) yaiI → / → aroL conserved hypothetical protein/shikimate kinase II
RA 234,703 T→A 10.7% intergenic (+12/‑171) yaiI → / → aroL conserved hypothetical protein/shikimate kinase II
RA 234,705 T→A 10.7% intergenic (+14/‑169) yaiI → / → aroL conserved hypothetical protein/shikimate kinase II
RA 288,729 A→T 5.6% E458V (GAA→GTA)  lon → DNA‑binding ATP‑dependent protease La
RA 291,204 T→C 50.0% I274T (ATC→ACC)  ppiD → peptidyl‑prolyl cis‑trans isomerase
RA 318,754 C→T 6.4% *176* (TAG→TAA)  priC ← primosomal replication protein N''
RA 318,760 G→C 7.1% T174T (ACC→ACG)  priC ← primosomal replication protein N''
RA 340,151 T→A 5.5% A14A (GCT→GCA)  ybaS → predicted glutaminase
RA 349,124 C→T 5.1% A474A (GCC→GCT)  gcl → glyoxylate carboligase
RA 350,336 C→T 11.4% intergenic (+63/‑37) hyi → / → glxR hydroxypyruvate isomerase/tartronate semialdehyde reductase, NADH‑dependent
RA 359,417 G→A 13.5% G216S (GGT→AGT)  sfmD → predicted outer membrane export usher protein
RA 359,423 T→A 11.1% W218R (TGG→AGG)  sfmD → predicted outer membrane export usher protein
RA 359,429 T→C 10.0% Y220H (TAT→CAT)  sfmD → predicted outer membrane export usher protein
RA 377,105 G→T 6.3% intergenic (‑19/‑92) fepD ← / → ybdA iron‑enterobactin transporter subunit/predicted transporter
RA 377,108 A→T 7.6% intergenic (‑22/‑89) fepD ← / → ybdA iron‑enterobactin transporter subunit/predicted transporter
RA 377,111 A→C 12.8% intergenic (‑25/‑86) fepD ← / → ybdA iron‑enterobactin transporter subunit/predicted transporter
RA 402,666 G→C 9.6% P33A (CCT→GCT)  rlpA ← minor lipoprotein
RA 406,585 A→G 46.7% D8D (GAT→GAC)  ybeB ← hypothetical protein
RA 418,094 C→T 9.9% A55T (GCT→ACT)  miaB ← isopentenyl‑adenosine A37 tRNA methylthiolase
RA 421,280 G→A 46.2% A400V (GCA→GTA)  asnB ← asparagine synthetase B
RA 450,341 C→G 5.4% intergenic (‑4/+19) kdpB ← / ← kdpA potassium translocating ATPase, subunit B/potassium translocating ATPase, subunit A
RA 485,028 T→G 9.9% G278G (GGT→GGG)  tolB → periplasmic protein
RA 530,638 T→C 53.8% E105E (GAA→GAG)  ybhP ← predicted DNase
RA 552,454 C→T 7.5% G357D (GGT→GAT) ‡ ybiW ← predicted pyruvate formate lyase
RA 552,455 C→G 7.5% G357R (GGT→CGT) ‡ ybiW ← predicted pyruvate formate lyase
RA 552,456 A→G 7.4% D356D (GAT→GAC)  ybiW ← predicted pyruvate formate lyase
RA 608,194 G→A 9.2% A687V (GCT→GTT)  pflB ← pyruvate formate lyase I
RA 608,197 A→T 5.7% L686Q (CTG→CAG)  pflB ← pyruvate formate lyase I
RA 608,200 T→C 5.1% N685S (AAC→AGC)  pflB ← pyruvate formate lyase I
RA 608,205 C→T 5.1% K683K (AAG→AAA)  pflB ← pyruvate formate lyase I
RA 608,211 A→T 5.1% V681V (GTT→GTA)  pflB ← pyruvate formate lyase I
RA 608,215 T→G 5.8% E680A (GAA→GCA) ‡ pflB ← pyruvate formate lyase I
RA 608,216 C→G 7.0% E680Q (GAA→CAA) ‡ pflB ← pyruvate formate lyase I
RA 608,217 G→A 6.0% D679D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 610,451 G→A 9.5% P239S (CCG→TCG)  focA ← formate transporter
RA 638,168 T→A 6.0% D141E (GAT→GAA)  ycbB → predicted carboxypeptidase
RA 688,340 Δ1 bp 7.8% noncoding (72/88 nt) serT ← tRNA‑Ser
RA 688,346:1 +T 8.5% noncoding (66/88 nt) serT ← tRNA‑Ser
RA 709,001 A→G 52.7% Y102H (TAT→CAT)  yceI ← hypothetical protein
RA 723,178 T→C 12.0% T149A (ACC→GCC)  rne ← fused ribonucleaseE endoribonuclease and scaffold for formation of degradosome
RA 724,481:1 +C 10.0% coding (287/960 nt) rluC → 23S rRNA pseudouridylate synthase
RA 724,486 Δ1 bp 8.8% coding (292/960 nt) rluC → 23S rRNA pseudouridylate synthase
RA 753,855 T→C 51.1% N189S (AAC→AGC)  ycfT ← predicted inner membrane protein
RA 757,001 G→T 8.8% A143S (GCG→TCG)  lolE → outer membrane‑specific lipoprotein transporter subunit
RA 775,532 C→T 6.5% N385N (AAC→AAT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,535 G→C 6.5% A386A (GCG→GCC)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,538 A→G 6.9% K387K (AAA→AAG)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,547 C→T 6.6% T390T (ACC→ACT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,559 G→A 10.5% E394E (GAG→GAA)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,571 T→A 13.9% D398E (GAT→GAA)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,580 A→G 12.2% K401K (AAA→AAG)  icd → isocitrate dehydrogenase, specific for NADP+
RA 776,453 A→T 7.1% intergenic (+825/+40) icd → / ← minE isocitrate dehydrogenase, specific for NADP+/cell division topological specificity factor
RA 780,667 T→C 58.1% D125D (GAT→GAC)  ycgM → predicted isomerase/hydrolase
RA 792,959 T→C 6.5% I443V (ATT→GTT)  cvrA ← predicted cation/proton antiporter
RA 801,126 A→G 7.5% M68T (ATG→ACG)  dhaH ← fused predicted dihydroxyacetone‑specific PTS enzyme HPr component and EI component
RA 801,414 A→G 53.1% S186S (AGT→AGC)  dhaL ← dihydroxyacetone kinase, C‑terminal domain
RA 807,688 C→A 8.0% G160V (GGC→GTC)  ycgV ← predicted adhesin
RA 807,691 T→G 8.5% D159A (GAC→GCC)  ycgV ← predicted adhesin
RA 807,696 G→A 7.8% N157N (AAC→AAT)  ycgV ← predicted adhesin
RA 826,223 G→T 56.9% G207V (GGT→GTT)  ychP → predicted invasin
RA 834,983 C→T 7.3% A1147A (GCC→GCT)  narG → nitrate reductase 1, alpha subunit
RA 835,139 C→T 9.1% I1199I (ATC→ATT)  narG → nitrate reductase 1, alpha subunit
RA 835,145 C→T 9.2% G1201G (GGC→GGT)  narG → nitrate reductase 1, alpha subunit
RA 835,148 T→C 8.7% Y1202Y (TAT→TAC)  narG → nitrate reductase 1, alpha subunit
RA 835,151 C→G 8.8% A1203A (GCC→GCG)  narG → nitrate reductase 1, alpha subunit
RA 835,154 T→G 8.6% H1204Q (CAT→CAG)  narG → nitrate reductase 1, alpha subunit
RA 835,160 A→C 8.6% A1206A (GCA→GCC)  narG → nitrate reductase 1, alpha subunit
RA 835,162 A→G 8.6% Y1207C (TAC→TGC) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,163 C→G 8.7% Y1207* (TAC→TAG) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,178 T→C 9.6% Y1212Y (TAT→TAC)  narG → nitrate reductase 1, alpha subunit
RA 835,187 A→C 8.8% V1215V (GTA→GTC)  narG → nitrate reductase 1, alpha subunit
RA 835,190 T→A 5.6% G1216G (GGT→GGA)  narG → nitrate reductase 1, alpha subunit
RA 863,791 A→C 12.3% Y31S (TAT→TCT) ‡ yciQ → predicted inner membrane protein
RA 863,792 T→A 12.7% Y31* (TAT→TAA) ‡ yciQ → predicted inner membrane protein
RA 863,793 G→T 14.0% E32* (GAA→TAA)  yciQ → predicted inner membrane protein
RA 865,062 C→T 22.7% P455S (CCT→TCT)  yciQ → predicted inner membrane protein
RA 868,851 A→C 7.1% K189T (AAA→ACA)  sohB → predicted inner membrane peptidase
RA 868,858 T→G 6.5% V191V (GTT→GTG)  sohB → predicted inner membrane peptidase
RA 916,161 T→A 6.2% R237R (CGT→CGA)  ycjF → conserved inner membrane protein
RA 916,170 T→A 11.7% N240K (AAT→AAA)  ycjF → conserved inner membrane protein
RA 922,265 C→G 6.3% A112G (GCA→GGA)  ycjZ → predicted DNA‑binding transcriptional regulator
RA 922,270 C→T 7.9% R114C (CGC→TGC)  ycjZ → predicted DNA‑binding transcriptional regulator
RA 922,273 A→G 7.9% T115A (ACA→GCA)  ycjZ → predicted DNA‑binding transcriptional regulator
RA 922,278 C→G 7.6% F116L (TTC→TTG)  ycjZ → predicted DNA‑binding transcriptional regulator
RA 939,572 T→A 7.2% I401F (ATC→TTC)  sfcA ← malate dehydrogenase, NAD‑requiring
RA 939,575 T→G 7.3% I400L (ATC→CTC)  sfcA ← malate dehydrogenase, NAD‑requiring
RA 939,576 C→A 7.6% E399D (GAG→GAT)  sfcA ← malate dehydrogenase, NAD‑requiring
RA 939,579 T→A 7.7% E398D (GAA→GAT)  sfcA ← malate dehydrogenase, NAD‑requiring
RA 963,892 C→T 13.5% G185E (GGA→GAA)  yddA ← fused predicted multidrug transporter subunits and membrane component and ATP‑binding component of ABC superfamily
RA 965,646 C→T 55.8% G83D (GGC→GAC)  ydeM ← conserved hypothetical protein
RA 965,844 A→T 8.5% V17D (GTT→GAT)  ydeM ← conserved hypothetical protein
RA 972,048 G→A 6.4% P285P (CCG→CCA)  lsrC → AI2 transporter
RA 980,208 A→G 11.1% Y33H (TAT→CAT)  cspI ← cold shock protein
RA 980,245 G→A 5.5% F20F (TTC→TTT)  cspI ← cold shock protein
RA 980,248 A→G 5.3% G19G (GGT→GGC)  cspI ← cold shock protein
RA 980,260 T→A 6.8% E15D (GAA→GAT)  cspI ← cold shock protein
RA 980,265 G→C 6.4% P14A (CCT→GCT)  cspI ← cold shock protein
RA 980,278 C→T 5.9% V9V (GTG→GTA)  cspI ← cold shock protein
RA 1,014,644 T→A 16.3% K475N (AAA→AAT) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,646 T→G 16.3% K475Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,650 G→C 15.2% A473A (GCC→GCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,653 A→G 15.2% D472D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,656 C→G 13.1% T471T (ACG→ACC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,659 C→A 12.9% V470V (GTG→GTT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,668 G→A 13.7% S467S (AGC→AGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,677 G→A 14.5% G464G (GGC→GGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,698 A→G 8.2% S457S (AGT→AGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,701 T→G 5.6% G456G (GGA→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,707 C→G 5.4% Q454H (CAG→CAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,710 C→G 5.2% A453A (GCG→GCC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,712 C→A 5.2% A453S (GCG→TCG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,719 T→C 5.5% Q450Q (CAA→CAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,720 T→A 5.5% Q450L (CAA→CTA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,725 G→C 6.2% V448V (GTC→GTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,812 A→G 6.1% I419I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,818 A→G 7.4% H417H (CAT→CAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,010 C→G 5.5% A353A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,013 T→C 5.7% K352K (AAA→AAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,015 T→G 5.7% K352Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,076 C→T 5.7% Q331Q (CAG→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,078 G→C 5.6% Q331E (CAG→GAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,079 A→G 5.7% R330R (CGT→CGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,088 C→T 6.8% K327K (AAG→AAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,097 G→A 5.8% I324I (ATC→ATT)  fumA ← aerobic Class I fumarate hydratase
RA 1,019,797 T→C 57.1% Y249C (TAT→TGT)  uidC ← predicted outer membrane porin protein
RA 1,036,505 G→A 100% A632A (GCG→GCA)  rsxC → fused predicted 4Fe‑4S ferredoxin‑type protein
RA 1,038,735 G→C 59.8% V73L (GTG→CTG)  rsxE → predicted inner membrane NADH‑quinone reductase
RA 1,044,955 A→G 13.4% intergenic (‑42/+87) tyrS ← / ← pdxH tyrosyl‑tRNA synthetase/pyridoxine 5'‑phosphate oxidase
RA 1,063,788 T→A 8.2% intergenic (+138/+24) sodB → / ← ydhP superoxide dismutase, Fe/predicted transporter
RA 1,091,167 T→C 52.1% E178E (GAA→GAG)  sufB ← component of SufBCD complex
RA 1,093,658 T→C 52.7% T907A (ACA→GCA)  ydiJ ← predicted FAD‑linked oxidoreductase
RA 1,136,280 C→A 5.4% A265E (GCA→GAA)  yniA → predicted phosphotransferase/kinase
RA 1,138,595 G→C 7.5% intergenic (+103/‑30) ydjM → / → ydjN predicted inner membrane protein regulated by LexA/predicted transporter
RA 1,153,878 G→A 45.6% T246I (ACA→ATA)  astE ← succinylglutamate desuccinylase
RA 1,187,540 G→A 34.9% G10R (GGG→AGG)  yeaI → predicted diguanylate cyclase
RA 1,200,936 T→C 10.1% V30A (GTC→GCC)  sdaA → L‑serine deaminase I
RA 1,201,033 C→T 6.3% T62T (ACC→ACT)  sdaA → L‑serine deaminase I
RA 1,201,054 T→C 5.3% G69G (GGT→GGC)  sdaA → L‑serine deaminase I
RA 1,202,022 G→A 17.5% C392Y (TGC→TAC)  sdaA → L‑serine deaminase I
RA 1,209,599 T→A 11.1% intergenic (+424/‑5) yobD → / → yebN conserved inner membrane protein/conserved inner membrane protein
RA 1,209,604 A→C 11.1% M1M (ATG→CTG) † yebN → conserved inner membrane protein
RA 1,212,849 C→G 6.6% F3L (TTC→TTG)  yobH → hypothetical protein
RA 1,212,852 C→G 5.5% I4M (ATC→ATG)  yobH → hypothetical protein
RA 1,212,854 T→A 5.5% I5N (ATT→AAT)  yobH → hypothetical protein
RA 1,216,702 T→C 47.5% Q677Q (CAA→CAG)  prc ← carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,217,271 G→C 7.4% R488G (CGT→GGT)  prc ← carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,217,277 A→T 7.0% L486M (TTG→ATG)  prc ← carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,217,283 G→C 6.8% R484G (CGT→GGT)  prc ← carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,225,925 T→C 14.8% L77P (CTT→CCT)  yebV → hypothetical protein
RA 1,232,353 T→G 9.1% T135P (ACG→CCG)  ptrB ← protease II
RA 1,232,357 C→G 9.8% A133A (GCG→GCC)  ptrB ← protease II
RA 1,232,360 C→G 9.7% M132I (ATG→ATC)  ptrB ← protease II
RA 1,232,364 C→A 10.2% G131V (GGA→GTA)  ptrB ← protease II
RA 1,237,336 C→A 6.9% R395R (CGG→CGT)  edd ← 6‑phosphogluconate dehydratase
RA 1,241,827 T→C 5.9% L88P (CTC→CCC)  pykA → pyruvate kinase II
RA 1,246,787 C→T 59.1% G70G (GGC→GGT)  znuC → zinc transporter subunit
RA 1,259,349 A→C 6.9% I525M (ATT→ATG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,351 T→G 6.3% I525L (ATT→CTT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,266,778 C→T 9.4% G210D (GGT→GAT)  yecA ← conserved metal‑binding protein
RA 1,292,502 G→A 7.3% T219M (ACG→ATG)  yeeO ← predicted multidrug efflux system
RA 1,302,608 T→C 57.1% K158R (AAG→AGG)  dacD ← D‑alanyl‑D‑alanine carboxypeptidase
RA 1,321,783 G→A 12.3% intergenic (‑237/+257) gnd ← / ← galF gluconate‑6‑phosphate dehydrogenase, decarboxylating/predicted subunit with GalU
RA 1,362,418 A→G 5.9% intergenic (‑39/‑93) mrp ← / → metG antiporter inner membrane protein/methionyl‑tRNA synthetase
RA 1,390,615 A→G 7.6% Q249Q (CAA→CAG)  nfo → endonuclease IV with intrinsic 3'‑5' exonuclease activity
RA 1,417,054 A→G 14.1% Y416C (TAT→TGT)  yejM → predicted hydrolase, inner membrane
RA 1,427,154 C→T 66.3% R220H (CGC→CAC)  napG ← ferredoxin‑type protein essential for electron transfer from ubiquinol to periplasmic nitrate reductase (NapAB)
RA 1,434,773 T→C 48.7% A465A (GCA→GCG)  yojI ← fused predicted multidrug transport subunits and membrane component and ATP‑binding component of ABC superfamily
RA 1,435,102 C→T 16.7% G356S (GGC→AGC)  yojI ← fused predicted multidrug transport subunits and membrane component and ATP‑binding component of ABC superfamily
RA 1,464,340 T→A 10.9% intergenic (‑144/+5) yfaA ← / ← gyrA hypothetical protein/DNA gyrase (type II topoisomerase), subunit A
RA 1,464,342 A→T 10.5% intergenic (‑146/+3) yfaA ← / ← gyrA hypothetical protein/DNA gyrase (type II topoisomerase), subunit A
RA 1,468,889 C→T 6.5% E945K (GAA→AAA)  yfaL ← adhesin
RA 1,484,894 T→C 8.9% M316V (ATG→GTG)  menF ← isochorismate synthase 2
RA 1,522,743 T→C 63.4% I121V (ATC→GTC)  pdxB ← erythronate‑4‑phosphate dehydrogenase
RA 1,557,166 T→G 12.3% intergenic (+1016/+247) dsdA → / ← emrY D‑serine ammonia‑lyase/predicted multidrug efflux system
RA 1,558,459 C→G 11.1% L167F (TTG→TTC)  emrK ← EmrKY‑TolC multidrug resistance efflux pump, membrane fusion protein component
RA 1,559,532 T→A 8.3% V53D (GTC→GAC)  evgA → DNA‑binding response regulator in two‑component regulatory system with EvgS
RA 1,570,272 C→T 5.8% S204S (AGC→AGT)  nupC → nucleoside (except guanosine) transporter
RA 1,581,079 C→T 7.0% G47S (GGT→AGT)  ypeB ← hypothetical protein
RA 1,585,147 T→A 11.2% N209K (AAT→AAA)  cysZ → predicted inner membrane protein
RA 1,585,148 A→C 11.2% M210L (ATG→CTG)  cysZ → predicted inner membrane protein
RA 1,585,153 G→T 9.5% Q211H (CAG→CAT)  cysZ → predicted inner membrane protein
RA 1,585,154 T→A 10.0% F212I (TTT→ATT)  cysZ → predicted inner membrane protein
RA 1,598,761 C→T 5.1% intergenic (‑94/‑70) yfeT ← / → yfeU predicted DNA‑binding transcriptional regulator/predicted PTS component
RA 1,614,492 T→C 13.1% intergenic (‑117/+100) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,618,811 C→T 13.9% V321V (GTG→GTA)  eutI ← predicted phosphotransacetylase subunit
RA 1,635,547 T→C 6.8% F562S (TTC→TCC)  acrD → aminoglycoside/multidrug efflux system
RA 1,666,801 T→A 12.3% intergenic (‑45/‑117) guaB ← / → xseA IMP dehydrogenase/exonuclease VII, large subunit
RA 1,685,303 T→C 18.2% Y42H (TAT→CAT)  sseA → 3‑mercaptopyruvate sulfurtransferase
RA 1,695,639 T→C 46.4% E124G (GAG→GGG)  yfhQ ← predicted methyltransferase
RA 1,735,602 T→C 43.5% E157E (GAA→GAG)  era ← membrane‑associated, 16S rRNA‑binding GTPase
RA 1,738,791 G→A 59.6% C340C (TGC→TGT)  lepA ← GTP binding membrane protein
RA 1,739,943 T→C 46.4% intergenic (‑133/+65) lepA ← / ← rseC GTP binding membrane protein/RseC protein involved in reduction of the SoxR iron‑sulfur cluster
RA 1,744,552 G→A 65.9% V483I (GTC→ATC)  nadB → quinolinate synthase, L‑aspartate oxidase (B protein) subunit
RA 1,751,256 G→A 52.8% intergenic (‑42/‑165) yfiF ← / → trxC predicted methyltransferase/thioredoxin 2
RA 1,763,556 T→C 61.2% noncoding (288/1542 nt) rrsG ← 16S ribosomal RNA
RA 1,763,636 A→G 10.0% noncoding (208/1542 nt) rrsG ← 16S ribosomal RNA
RA 1,804,090 G→A 27.1% G52G (GGG→GGA)  mprA → DNA‑binding transcriptional regulator
RA 1,807,994 C→T 9.1% intergenic (‑96/+54) luxS ← / ← gshA S‑ribosylhomocysteinase/gamma‑glutamate‑cysteine ligase
RA 1,813,392 G→A 49.1% R595R (CGC→CGT)  alaS ← alanyl‑tRNA synthetase
RA 1,824,288 G→A 54.5% D452D (GAC→GAT)  hypF ← carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA 1,849,874 A→G 6.1% G219G (GGT→GGC)  ygcI ← hypothetical protein
RA 1,852,438 C→T 11.2% A395T (GCG→ACG)  ygcL ← hypothetical protein
RA 1,869,837 T→C 16.6% intergenic (‑82/‑237) ygcW ← / → yqcE predicted deoxygluconate dehydrogenase/predicted transporter
RA 1,869,838 G→A 14.9% intergenic (‑83/‑236) ygcW ← / → yqcE predicted deoxygluconate dehydrogenase/predicted transporter
RA 1,869,841 A→T 14.6% intergenic (‑86/‑233) ygcW ← / → yqcE predicted deoxygluconate dehydrogenase/predicted transporter
RA 1,869,844 T→C 14.0% intergenic (‑89/‑230) ygcW ← / → yqcE predicted deoxygluconate dehydrogenase/predicted transporter
RA 1,869,845 G→A 14.9% intergenic (‑90/‑229) ygcW ← / → yqcE predicted deoxygluconate dehydrogenase/predicted transporter
RA 1,878,756 G→A 12.9% G131G (GGC→GGT)  pyrG ← CTP synthetase
RA 1,892,019:1 +GC 100% intergenic (‑437/+54) gudP ← / ← ygdL predicted D‑glucarate transporter/conserved hypothetical protein
RA 1,927,871 T→C 13.9% K450R (AAA→AGA)  araE ← arabinose transporter
RA 1,930,802 G→A 9.1% T120T (ACC→ACT)  kduI ← predicted 5‑keto 4‑deoxyuronate isomerase
RA 1,930,807 C→T 9.2% D119N (GAT→AAT)  kduI ← predicted 5‑keto 4‑deoxyuronate isomerase
RA 1,930,808 A→G 9.8% I118I (ATT→ATC)  kduI ← predicted 5‑keto 4‑deoxyuronate isomerase
RA 1,933,105 C→A 5.5% A446A (GCG→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,108 G→A 5.7% A445A (GCC→GCT) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,109 G→T 5.6% A445D (GCC→GAC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,110 C→T 5.6% A445T (GCC→ACC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,117 A→T 5.8% D442E (GAT→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,121 A→T 6.3% L441Q (CTG→CAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,126 G→A 6.2% R439R (CGC→CGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,228 G→A 10.3% D405D (GAC→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,231 G→A 10.3% N404N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,237 A→G 12.0% R402R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,240 C→T 12.5% A401A (GCG→GCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,970,934 C→T 8.0% E658K (GAG→AAG)  speA ← biosynthetic arginine decarboxylase, PLP‑binding
RA 1,970,940 C→G 9.8% E656Q (GAA→CAA)  speA ← biosynthetic arginine decarboxylase, PLP‑binding
RA 1,976,997 G→A 6.7% L83L (TTG→TTA)  sprT → conserved hypothetical protein
RA 1,992,526 C→G 6.0% intergenic (+20/‑182) mltC → / → nupG membrane‑bound lytic murein transglycosylase C/nucleoside transporter
RA 1,992,527 G→C 5.9% intergenic (+21/‑181) mltC → / → nupG membrane‑bound lytic murein transglycosylase C/nucleoside transporter
RA 1,992,530 G→C 5.9% intergenic (+24/‑178) mltC → / → nupG membrane‑bound lytic murein transglycosylase C/nucleoside transporter
RA 1,992,531 C→G 5.9% intergenic (+25/‑177) mltC → / → nupG membrane‑bound lytic murein transglycosylase C/nucleoside transporter
RA 2,012,045 T→C 56.3% M63V (ATG→GTG)  yqhA ← conserved inner membrane protein
RA 2,042,434 G→A 7.3% intergenic (+25/+18) yqiI → / ← glgS conserved hypothetical protein/predicted glycogen synthesis protein
RA 2,042,842 T→A 13.3% intergenic (‑190/‑79) glgS ← / → yqiJ predicted glycogen synthesis protein/predicted inner membrane protein
RA 2,042,845 T→A 13.3% intergenic (‑193/‑76) glgS ← / → yqiJ predicted glycogen synthesis protein/predicted inner membrane protein
RA 2,042,854 A→G 11.3% intergenic (‑202/‑67) glgS ← / → yqiJ predicted glycogen synthesis protein/predicted inner membrane protein
RA 2,044,054 T→C 11.3% F160L (TTT→CTT)  yqiK → conserved hypothetical protein
RA 2,081,573 C→T 13.3% A423V (GCA→GTA)  exuT → hexuronate transporter
RA 2,088,438 A→T 7.2% Y109F (TAC→TTC)  yhaI → predicted inner membrane protein
RA 2,088,442 A→T 7.0% G110G (GGA→GGT)  yhaI → predicted inner membrane protein
RA 2,093,175 G→A 13.7% intergenic (‑26/+312) yhaO ← / ← tdcG predicted transporter/L‑serine dehydratase 3
RA 2,136,848 C→T 5.1% intergenic (‑71/+78) rpsO ← / ← truB 30S ribosomal subunit protein S15/tRNA pseudouridine synthase
RA 2,136,852 G→T 5.2% intergenic (‑75/+74) rpsO ← / ← truB 30S ribosomal subunit protein S15/tRNA pseudouridine synthase
RA 2,136,857 A→T 5.1% intergenic (‑80/+69) rpsO ← / ← truB 30S ribosomal subunit protein S15/tRNA pseudouridine synthase
RA 2,184,926 A→G 11.1% E212E (GAA→GAG)  gltD → glutamate synthase, 4Fe‑4S protein, small subunit
RA 2,184,929 C→T 9.4% F213F (TTC→TTT)  gltD → glutamate synthase, 4Fe‑4S protein, small subunit
RA 2,184,930 A→G 9.4% K214E (AAA→GAA)  gltD → glutamate synthase, 4Fe‑4S protein, small subunit
RA 2,184,933 C→T 9.1% L215F (CTC→TTC)  gltD → glutamate synthase, 4Fe‑4S protein, small subunit
RA 2,197,407 C→T 8.4% intergenic (+15/‑75) degQ → / → degS serine endoprotease, periplasmic/serine endoprotease, periplasmic
RA 2,199,727 T→A 6.4% intergenic (‑177/‑258) mdh ← / → argR malate dehydrogenase, NAD(P)‑binding/DNA‑binding transcriptional dual regulator, L‑arginine‑binding
RA 2,207,332 A→G 56.5% intergenic (‑22/+408) tldD ← / ← yhdP predicted peptidase/conserved membrane protein, predicted transporter
RA 2,216,701 T→C 19.3% K638K (AAA→AAG)  yhdA ← conserved inner membrane protein
RA 2,222,933 G→A 23.9% V15V (GTG→GTA)  panF → pantothenate:sodium symporter
RA 2,249,096 C→G 5.4% P96A (CCC→GCC) ‡ thiF → thiamin (thiazole moiety) biosynthesis protein
RA 2,249,097 C→T 5.4% P96L (CCC→CTC) ‡ thiF → thiamin (thiazole moiety) biosynthesis protein
RA 2,249,100 A→G 5.1% D97G (GAC→GGC)  thiF → thiamin (thiazole moiety) biosynthesis protein
RA 2,256,638 C→G 5.5% D134H (GAT→CAT)  rpoC ← RNA polymerase, beta prime subunit
RA 2,256,639 G→C 5.5% R133R (CGC→CGG)  rpoC ← RNA polymerase, beta prime subunit
RA 2,256,643 A→T 5.3% L132Q (CTG→CAG)  rpoC ← RNA polymerase, beta prime subunit
RA 2,281,121 A→G 65.0% F67S (TTT→TCT)  fabR ← DNA‑binding transcriptional repressor
RA 2,359,867 G→A 37.6% noncoding (1228/2905 nt) rrlA ← 23S ribosomal RNA
RA 2,359,876 C→T 30.1% noncoding (1219/2905 nt) rrlA ← 23S ribosomal RNA
RA 2,365,579 T→C 9.2% K181K (AAA→AAG)  yigZ ← predicted elongation factor
RA 2,367,537 C→T 42.1% intergenic (‑85/‑105) pepQ ← / → fadB proline dipeptidase/fused 3‑hydroxybutyryl‑CoA epimerase/delta(3)‑cis‑delta(2)‑trans‑enoyl‑CoA isomerase/enoyl‑CoA hydratase and 3‑hydroxyacyl‑CoA dehydrogenase
RA 2,385,450 C→T 8.5% L37L (CTG→CTA)  metE ← 5‑methyltetrahydropteroyltriglutamate‑ homocysteine S‑methyltransferase
RA 2,411,718 T→C 10.7% L330L (TTG→CTG)  hemY → predicted protoheme IX synthesis protein
RA 2,417,837 A→C 7.4% intergenic (‑111/+80) yifK ← / ← rffM predicted transporter/UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase
RA 2,417,841 A→T 7.4% intergenic (‑115/+76) yifK ← / ← rffM predicted transporter/UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase
RA 2,429,321 T→C 39.2% M88V (ATG→GTG)  wzzE ← Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA 2,460,535 C→A 11.0% intergenic (+153/‑226) mioC → / → gidA FMN‑binding protein MioC/glucose‑inhibited cell‑division protein
RA 2,460,538 A→T 11.1% intergenic (+156/‑223) mioC → / → gidA FMN‑binding protein MioC/glucose‑inhibited cell‑division protein
RA 2,460,541 T→G 10.0% intergenic (+159/‑220) mioC → / → gidA FMN‑binding protein MioC/glucose‑inhibited cell‑division protein
RA 2,463,313 G→A 50.0% V200V (GTG→GTA)  gidB → methyltransferase, glucose‑inhibited cell‑division protein
RA 2,512,108 C→T 39.7% C141Y (TGC→TAC)  yicE ← predicted transporter
RA 2,523,621 C→T 71.0% G32S (GGT→AGT)  dinD ← DNA‑damage‑inducible protein
RA 2,523,766 T→A 8.5% intergenic (‑52/+169) dinD ← / ← yicC DNA‑damage‑inducible protein/conserved hypothetical protein
RA 2,523,769 T→A 9.1% intergenic (‑55/+166) dinD ← / ← yicC DNA‑damage‑inducible protein/conserved hypothetical protein
RA 2,526,945 C→T 62.7% E13K (GAG→AAG)  ttk ← division inhibitor
RA 2,537,451 C→A 7.9% F48L (TTC→TTA)  rfaB → UDP‑D‑galactose:(glucosyl)lipopolysaccharide‑1, 6‑D‑galactosyltransferase
RA 2,537,459 G→A 9.4% R51H (CGT→CAT)  rfaB → UDP‑D‑galactose:(glucosyl)lipopolysaccharide‑1, 6‑D‑galactosyltransferase
RA 2,537,461 A→T 9.8% N52Y (AAT→TAT) ‡ rfaB → UDP‑D‑galactose:(glucosyl)lipopolysaccharide‑1, 6‑D‑galactosyltransferase
RA 2,537,463 T→C 9.8% N52N (AAT→AAC) ‡ rfaB → UDP‑D‑galactose:(glucosyl)lipopolysaccharide‑1, 6‑D‑galactosyltransferase
RA 2,543,241 T→A 6.1% intergenic (+5/+27) rfaK → / ← rfaL lipopolysaccharide core biosynthesis/O‑antigen ligase
RA 2,546,001 C→T 51.6% M182I (ATG→ATA)  rfaF ← ADP‑heptose:LPS heptosyltransferase II
RA 2,547,976 T→C 10.2% V62A (GTT→GCT)  htrL → hypothetical protein
RA 2,550,360 A→G 52.9% K77K (AAA→AAG)  tdh → threonine 3‑dehydrogenase, NAD(P)‑binding
RA 2,551,927 A→C 8.3% K178N (AAA→AAC)  yibD → predicted glycosyl transferase
RA 2,557,807 A→C 6.3% D154A (GAT→GCT) ‡ secB → protein export chaperone
RA 2,557,808 T→A 5.9% D154E (GAT→GAA) ‡ secB → protein export chaperone
RA 2,557,809 G→T 5.9% A155S (GCC→TCC)  secB → protein export chaperone
RA 2,571,178 G→C 5.3% R361R (CGG→CGC)  yibH → hypothetical protein
RA 2,572,487 A→G 13.3% intergenic (+1255/‑524) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,989 T→C 7.5% intergenic (+1757/‑22) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,581,799 T→G 5.2% intergenic (+289/‑81) gadA → / → gadX glutamate decarboxylase A, PLP‑dependent/DNA‑binding transcriptional dual regulator
RA 2,581,803 T→G 5.3% intergenic (+293/‑77) gadA → / → gadX glutamate decarboxylase A, PLP‑dependent/DNA‑binding transcriptional dual regulator
RA 2,585,230 G→A 7.8% L683L (CTG→TTG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,171 G→A 5.1% T369M (ACG→ATG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,174 G→C 5.4% P368R (CCG→CGG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,589,325 A→G 5.5% intergenic (‑1/+798) gadE ← / ← hdeD DNA‑binding transcriptional activator/acid‑resistance membrane protein
RA 2,590,087 A→T 14.6% intergenic (‑763/+36) gadE ← / ← hdeD DNA‑binding transcriptional activator/acid‑resistance membrane protein
RA 2,590,089 C→G 15.3% intergenic (‑765/+34) gadE ← / ← hdeD DNA‑binding transcriptional activator/acid‑resistance membrane protein
RA 2,590,091 A→T 15.3% intergenic (‑767/+32) gadE ← / ← hdeD DNA‑binding transcriptional activator/acid‑resistance membrane protein
RA 2,597,519 T→A 9.2% intergenic (‑515/+362) arsR ← / ← gor DNA‑binding transcriptional regulator/glutathione oxidoreductase
RA 2,597,522 T→A 10.0% intergenic (‑518/+359) arsR ← / ← gor DNA‑binding transcriptional regulator/glutathione oxidoreductase
RA 2,597,527 T→A 10.5% intergenic (‑523/+354) arsR ← / ← gor DNA‑binding transcriptional regulator/glutathione oxidoreductase
RA 2,605,853 T→C 46.1% V14V (GTT→GTC)  yhiO → predicted universal stress (ethanol tolerance) protein B
RA 2,613,354 C→T 9.2% E57K (GAA→AAA)  nikA ← nickel transporter subunit
RA 2,613,357 A→G 9.7% Y56H (TAT→CAT)  nikA ← nickel transporter subunit
RA 2,625,149 G→A 35.2% R16H (CGT→CAT)  ftsX → predicted transporter subunit
RA 2,639,772 T→G 9.2% C233G (TGT→GGT)  ugpQ → glycerophosphodiester phosphodiesterase, cytosolic
RA 2,639,777 C→A 9.0% T234T (ACC→ACA)  ugpQ → glycerophosphodiester phosphodiesterase, cytosolic
RA 2,687,465 C→T 13.6% G272S (GGC→AGC)  pck ← phosphoenolpyruvate carboxykinase
RA 2,708,236 A→G 8.1% E260G (GAA→GGA)  trpS → tryptophanyl‑tRNA synthetase
RA 2,714,239 C→A 48.9% R41L (CGC→CTC)  nirB ← nitrite reductase, large subunit, NAD(P)H‑binding
RA 2,727,940 T→C 60.5% F59F (TTT→TTC)  kefB → potassium:proton antiporter
RA 2,736,671 T→C 57.5% F605F (TTT→TTC)  fusA → protein chain elongation factor EF‑G
RA 2,745,289 C→G 8.9% T50S (ACT→AGT)  rpsN → 30S ribosomal subunit protein S14
RA 2,745,295 C→A 8.8% P52Q (CCG→CAG)  rpsN → 30S ribosomal subunit protein S14
RA 2,797,173 C→G 10.1% G186G (GGC→GGG)  dinF → DNA‑damage‑inducible SOS response protein
RA 2,811,028 G→A 54.9% A573V (GCA→GTA)  uvrA ← ATPase and DNA damage recognition protein of nucleotide excision repair excinuclease UvrABC
RA 2,823,561 A→C 60.6% intergenic (+306/+652) nrfG → / ← pheU heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA 2,823,628 G→A 6.6% intergenic (+373/+585) nrfG → / ← pheU heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA 2,823,871 A→G 9.2% intergenic (+616/+342) nrfG → / ← pheU heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA 2,829,664 T→C 47.7% N109S (AAC→AGC)  aspA ← aspartate ammonia‑lyase
RA 2,852,255 G→A 8.9% T306I (ACC→ATC)  rsgA ← ribosome small subunit‑dependent GTPase A
RA 2,852,261 T→C 9.4% H304R (CAC→CGC)  rsgA ← ribosome small subunit‑dependent GTPase A
RA 2,852,263 T→A 9.4% K303N (AAA→AAT)  rsgA ← ribosome small subunit‑dependent GTPase A
RA 2,852,270 T→A 9.2% D301V (GAT→GTT)  rsgA ← ribosome small subunit‑dependent GTPase A
RA 2,852,272 G→A 8.9% R300R (CGC→CGT)  rsgA ← ribosome small subunit‑dependent GTPase A
RA 2,887,887 T→A 8.2% intergenic (+52/+27) ytfK → / ← ytfL conserved hypothetical protein/predicted inner membrane protein
RA 2,892,177 G→A 47.6% D278N (GAC→AAC)  ytfQ → predicted sugar transporter subunit
RA 2,895,458 G→A 62.0% A164A (GCG→GCA)  yjfF → predicted sugar transporter subunit
RA 2,919,516 T→A 10.0% R60R (CGA→CGT)  argI ← ornithine carbamoyltransferase 1
RA 2,951,011 A→T 6.2% K170* (AAA→TAA)  bglJ → DNA‑binding transcriptional regulator
RA 2,951,014 T→A 5.7% F171I (TTT→ATT)  bglJ → DNA‑binding transcriptional regulator
RA 2,951,017 A→T 6.0% N172Y (AAT→TAT)  bglJ → DNA‑binding transcriptional regulator
RA 2,954,718 A→G 8.0% R82G (AGG→GGG)  rimI → acetylase for 30S ribosomal subunit protein S18
RA 2,970,436 C→T 5.2% *215* (TGA→TAA)  ytjB ← conserved hypothetical protein
RA 2,973,690 A→T 55.7% K29I (AAA→ATA)  nadR → bifunctional DNA‑binding transcriptional repressor and NMN adenylyltransferase

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? minE 3845 =34 (0.580)6 (0.120) 4/90 NT 13.8% coding (112/1287 nt) thrC threonine synthase
?minE 3877 = 45 (0.860)coding (144/1287 nt) thrC threonine synthase
* ? minE = 4271642 (0.710)4 (0.080) 3/88 NT 10.0% coding (859/1287 nt) fixC predicted oxidoreductase, FAD/NAD(P)‑binding domain
?minE = 42759 36 (0.710)coding (902/1287 nt) fixC predicted oxidoreductase, FAD/NAD(P)‑binding domain
* ? minE 43749 =59 (1.000)3 (0.060) 3/88 NT 5.8% coding (265/1332 nt) yaaU predicted transporter
?minE 43775 = 46 (0.900)coding (291/1332 nt) yaaU predicted transporter
* ? minE 48676 =40 (0.680)6 (0.110) 3/92 NT 13.3% coding (225/843 nt) apaH diadenosine tetraphosphatase
?minE 48712 = 42 (0.790)coding (189/843 nt) apaH diadenosine tetraphosphatase
* ? minE 65954 =86 (1.460)4 (0.070) 3/94 NT 5.7% coding (745/1092 nt) leuB 3‑isopropylmalate dehydrogenase
?minE 65986 = 54 (0.990)coding (713/1092 nt) leuB 3‑isopropylmalate dehydrogenase
* ? minE = 9543185 (1.440)6 (0.110) 4/92 NT 8.1% coding (2413/2706 nt) secA preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
?minE = 95447 59 (1.110)coding (2429/2706 nt) secA preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
* ? minE = 11085140 (0.680)7 (0.120) 4/98 NT 17.8% coding (417/1893 nt) aceF pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2
?minE = 110874 26 (0.460)coding (440/1893 nt) aceF pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2
* ? minE 142010 =25 (0.420)6 (0.100) 3/102 NT 16.2% coding (463/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
?minE 142041 = 37 (0.630)coding (432/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
* ? minE 147275 =49 (0.830)4 (0.080) 3/90 NT 7.6% coding (431/2430 nt) hrpB predicted ATP‑dependent helicase
?minE 147295 = 54 (1.040)coding (451/2430 nt) hrpB predicted ATP‑dependent helicase
* ? minE 148622 =62 (1.050)5 (0.100) 4/88 NT 8.7% coding (1778/2430 nt) hrpB predicted ATP‑dependent helicase
?minE 148657 = 51 (1.000)coding (1813/2430 nt) hrpB predicted ATP‑dependent helicase
* ? minE 152453 =111 (1.880)6 (0.120) 4/90 NT 6.5% coding (1255/1281 nt) hemL glutamate‑1‑semialdehyde aminotransferase
?minE 152488 = 76 (1.460)coding (1220/1281 nt) hemL glutamate‑1‑semialdehyde aminotransferase
* ? minE 162556 =38 (0.640)6 (0.110) 3/92 NT 11.7% coding (365/387 nt) yaeH conserved hypothetical protein
?minE 162581 = 56 (1.050)coding (340/387 nt) yaeH conserved hypothetical protein
* ? minE = 17704248 (0.810)3 (0.060) 3/90 NT 6.5% coding (290/2433 nt) yaeT conserved hypothetical protein
?minE = 177076 44 (0.850)coding (324/2433 nt) yaeT conserved hypothetical protein
* ? minE = 19794937 (0.630)4 (0.080) 3/92 NT 9.7% coding (471/708 nt) yaeB conserved hypothetical protein
?minE = 197965 41 (0.770)coding (455/708 nt) yaeB conserved hypothetical protein
* ? minE 202816 =NA (NA)9 (0.170) 4/92 NT NA noncoding (221/1542 nt) rrsH 16S ribosomal RNA
?minE 202837 = NA (NA)noncoding (242/1542 nt) rrsH 16S ribosomal RNA
* ? minE 202882 =NA (NA)7 (0.120) 6/100 NT NA noncoding (287/1542 nt) rrsH 16S ribosomal RNA
?minE 202909 = NA (NA)noncoding (314/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 202890NA (NA)8 (0.160) 3/88 NT NA noncoding (295/1542 nt) rrsH 16S ribosomal RNA
?minE = 202899 NA (NA)noncoding (304/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203199NA (NA)5 (0.100) 3/88 NT NA noncoding (604/1542 nt) rrsH 16S ribosomal RNA
?minE = 203228 NA (NA)noncoding (633/1542 nt) rrsH 16S ribosomal RNA
* ? minE 203376 =NA (NA)7 (0.120) 4/100 NT NA noncoding (781/1542 nt) rrsH 16S ribosomal RNA
?minE 203397 = NA (NA)noncoding (802/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203668NA (NA)5 (0.100) 3/90 NT NA noncoding (1073/1542 nt) rrsH 16S ribosomal RNA
?minE = 203696 NA (NA)noncoding (1101/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203909NA (NA)15 (0.290) 4/88 NT NA noncoding (1314/1542 nt) rrsH 16S ribosomal RNA
?minE = 203917 NA (NA)noncoding (1322/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203951NA (NA)12 (0.230) 6/92 NT NA noncoding (1356/1542 nt) rrsH 16S ribosomal RNA
?minE = 203960 NA (NA)noncoding (1365/1542 nt) rrsH 16S ribosomal RNA
* ? minE 203979 =NA (NA)4 (0.080) 3/92 NT NA noncoding (1384/1542 nt) rrsH 16S ribosomal RNA
?minE 204001 = NA (NA)noncoding (1406/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 204106NA (NA)7 (0.130) 6/92 NT NA noncoding (1511/1542 nt) rrsH 16S ribosomal RNA
?minE = 204118 NA (NA)noncoding (1523/1542 nt) rrsH 16S ribosomal RNA
* ? minE 204107 =NA (NA)26 (0.490) 6/92 NT 100% noncoding (1512/1542 nt) rrsH 16S ribosomal RNA
?minE 204119 = 0 (0.000)noncoding (1524/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 204740NA (NA)25 (0.500) 10/86 NT NA noncoding (157/2904 nt) rrlH 23S ribosomal RNA
?minE = 204751 NA (NA)noncoding (168/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 204771NA (NA)14 (0.260) 7/92 NT NA noncoding (188/2904 nt) rrlH 23S ribosomal RNA
?minE = 204790 NA (NA)noncoding (207/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205107NA (NA)8 (0.140) 4/96 NT NA noncoding (524/2904 nt) rrlH 23S ribosomal RNA
?minE = 205132 NA (NA)noncoding (549/2904 nt) rrlH 23S ribosomal RNA
* ? minE 205174 =NA (NA)9 (0.170) 4/92 NT NA noncoding (591/2904 nt) rrlH 23S ribosomal RNA
?minE 205200 = NA (NA)noncoding (617/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205178NA (NA)3 (0.060) 3/92 NT NA noncoding (595/2904 nt) rrlH 23S ribosomal RNA
?minE = 205194 NA (NA)noncoding (611/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205385NA (NA)4 (0.080) 3/90 NT NA noncoding (802/2904 nt) rrlH 23S ribosomal RNA
?minE = 205393 NA (NA)noncoding (810/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205532NA (NA)11 (0.200) 7/94 NT NA noncoding (949/2904 nt) rrlH 23S ribosomal RNA
?minE = 205550 NA (NA)noncoding (967/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205642NA (NA)12 (0.220) 8/96 NT NA noncoding (1059/2904 nt) rrlH 23S ribosomal RNA
?minE = 205661 NA (NA)noncoding (1078/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205864NA (NA)7 (0.130) 3/90 NT NA noncoding (1281/2904 nt) rrlH 23S ribosomal RNA
?minE = 205871 NA (NA)noncoding (1288/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 206065NA (NA)3 (0.050) 3/98 NT NA noncoding (1482/2904 nt) rrlH 23S ribosomal RNA
?minE = 206089 NA (NA)noncoding (1506/2904 nt) rrlH 23S ribosomal RNA
* ? minE 206269 =NA (NA)14 (0.250) 5/96 NT NA noncoding (1686/2904 nt) rrlH 23S ribosomal RNA
?minE 206291 = NA (NA)noncoding (1708/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 206326NA (NA)6 (0.110) 3/92 NT NA noncoding (1743/2904 nt) rrlH 23S ribosomal RNA
?minE = 206343 NA (NA)noncoding (1760/2904 nt) rrlH 23S ribosomal RNA
* ? minE 206717 =NA (NA)4 (0.070) 4/96 NT NA noncoding (2134/2904 nt) rrlH 23S ribosomal RNA
?minE 206765 = NA (NA)noncoding (2182/2904 nt) rrlH 23S ribosomal RNA
* ? minE 206841 =NA (NA)14 (0.280) 6/88 NT NA noncoding (2258/2904 nt) rrlH 23S ribosomal RNA
?minE 206866 = NA (NA)noncoding (2283/2904 nt) rrlH 23S ribosomal RNA
* ? minE 206882 =NA (NA)9 (0.170) 4/92 NT NA noncoding (2299/2904 nt) rrlH 23S ribosomal RNA
?minE 206901 = NA (NA)noncoding (2318/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 206979NA (NA)10 (0.190) 6/92 NT NA noncoding (2396/2904 nt) rrlH 23S ribosomal RNA
?minE = 207009 NA (NA)noncoding (2426/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 207550NA (NA)15 (0.290) 10/90 NT NA intergenic (+63/‑30) rrlH/rrfH 23S ribosomal RNA/5S ribosomal RNA
?minE = 207562 NA (NA)intergenic (+75/‑18) rrlH/rrfH 23S ribosomal RNA/5S ribosomal RNA
* ? minE 212436 =61 (1.030)6 (0.110) 3/94 NT 10.4% coding (344/1359 nt) mltD predicted membrane‑bound lytic murein transglycosylase D
?minE 212461 = 47 (0.860)coding (319/1359 nt) mltD predicted membrane‑bound lytic murein transglycosylase D
* ? minE 218276 =51 (0.860)6 (0.110) 3/96 NT 12.2% coding (738/771 nt) yafV predicted C‑N hydrolase family amidase, NAD(P)‑binding
?minE 218305 = 38 (0.680)coding (709/771 nt) yafV predicted C‑N hydrolase family amidase, NAD(P)‑binding
* ? minE = 24618254 (0.920)5 (0.100) 4/88 NT 10.5% coding (572/690 nt) phoB DNA‑binding response regulator in two‑component regulatory system with PhoR (or CreC)
?minE = 246199 39 (0.770)coding (589/690 nt) phoB DNA‑binding response regulator in two‑component regulatory system with PhoR (or CreC)
* ? minE = 25791463 (1.070)7 (0.130) 3/92 NT 9.3% coding (1799/1848 nt) secD SecYEG protein translocase auxillary subunit
?minE = 257928 80 (1.500)coding (1813/1848 nt) secD SecYEG protein translocase auxillary subunit
* ? minE = 28504944 (0.750)8 (0.150) 3/92 NT 16.9% intergenic (+149/‑97) tig/clpP peptidyl‑prolyl cis/trans isomerase/proteolytic subunit of ClpA‑ClpP and ClpX‑ClpP ATP‑dependent serine proteases
?minE = 285060 39 (0.730)intergenic (+160/‑86) tig/clpP peptidyl‑prolyl cis/trans isomerase/proteolytic subunit of ClpA‑ClpP and ClpX‑ClpP ATP‑dependent serine proteases
* ? minE 322303 =80 (1.360)8 (0.160) 3/88 NT 12.6% coding (1743/1932 nt) dnaX DNA polymerase III/DNA elongation factor III, tau and gamma subunits
?minE 322331 = 42 (0.830)coding (1771/1932 nt) dnaX DNA polymerase III/DNA elongation factor III, tau and gamma subunits
* ? minE 409429 =54 (0.920)6 (0.110) 3/92 NT 11.8% coding (330/582 nt) rlpB minor lipoprotein
?minE 409460 = 41 (0.770)coding (299/582 nt) rlpB minor lipoprotein
* ? minE 415786 =44 (0.750)6 (0.110) 3/98 NT 11.2% coding (933/1080 nt) ybeZ hypothetical protein with nucleoside triphosphate hydrolase domain
?minE 415807 = 53 (0.940)coding (912/1080 nt) ybeZ hypothetical protein with nucleoside triphosphate hydrolase domain
* ? minE 428834 =71 (1.200)5 (0.090) 3/92 NT 7.6% coding (1590/1947 nt) nagE fused N‑acetyl glucosamine specific PTS enzyme IICBA components
?minE 428867 = 57 (1.070)coding (1623/1947 nt) nagE fused N‑acetyl glucosamine specific PTS enzyme IICBA components
* ? minE 430094 =53 (0.900)4 (0.080) 3/92 NT 7.6% coding (701/1665 nt) glnS glutamyl‑tRNA synthetase
?minE 430131 = 50 (0.940)coding (738/1665 nt) glnS glutamyl‑tRNA synthetase
* ? minE = 43431658 (0.980)5 (0.090) 3/98 NT 8.4% coding (451/531 nt) fldA flavodoxin 1
?minE = 434342 53 (0.940)coding (425/531 nt) fldA flavodoxin 1
* ? minE 436259 =36 (0.610)12 (0.220) 11/94 NT 26.6% intergenic (‑156/‑29) ybfF/seqA conserved hypothetical protein/regulatory protein for replication initiation
?minE = 2706018 33 (0.610)coding (836/837 nt) dam DNA adenine methylase
* ? minE = 43683349 (0.830)12 (0.200) 8/102 NT 17.4% coding (546/546 nt) seqA regulatory protein for replication initiation
?minE 1803907 = 65 (1.100)intergenic (+63/‑28) ygaH/mprA predicted inner membrane protein/DNA‑binding transcriptional regulator
* ? minE 438512 =29 (0.490)11 (0.310)
+ACGTATGACAAACACAGAAT
3/62 NT 33.1% intergenic (+13/‑201) pgm/ybfP phosphoglucomutase/hypothetical protein
?minE 2493639 = 44 (0.750)intergenic (+21/‑354) gyrB/ibpA DNA gyrase, subunit B/heat shock chaperone
* ? minE 449616 =53 (0.900)6 (0.110) 3/96 NT 10.8% coding (722/2049 nt) kdpB potassium translocating ATPase, subunit B
?minE 449637 = 49 (0.880)coding (701/2049 nt) kdpB potassium translocating ATPase, subunit B
* ? minE 481460 =80 (1.360)9 (0.170) 3/90 NT 13.2% coding (254/405 nt) ybgC predicted acyl‑CoA thioesterase
?minE 481488 = 48 (0.920)coding (282/405 nt) ybgC predicted acyl‑CoA thioesterase
* ? minE 494979 =46 (0.780)5 (0.090) 3/92 NT 10.5% coding (314/1041 nt) galM galactose‑1‑epimerase
?minE 495022 = 44 (0.830)coding (271/1041 nt) galM galactose‑1‑epimerase
* ? minE 509765 =93 (1.580)4 (0.080) 3/90 NT 5.9% coding (1424/1434 nt) ybhI predicted transporter
?minE 509805 = 46 (0.880)intergenic (+30/‑153) ybhI/ybhJ predicted transporter/predicted hydratase
* ? minE = 58962523 (0.390)4 (0.080) 3/88 NT 14.1% coding (332/495 nt) lrp DNA‑binding transcriptional dual regulator, leucine‑binding
?minE = 589656 29 (0.570)coding (363/495 nt) lrp DNA‑binding transcriptional dual regulator, leucine‑binding
* ? minE = 62736040 (0.680)6 (0.120) 5/88 NT 13.4% intergenic (+40/‑12) ycaQ/ycaR conserved hypothetical protein/conserved hypothetical protein
?minE = 627371 43 (0.840)intergenic (+51/‑1) ycaQ/ycaR conserved hypothetical protein/conserved hypothetical protein
* ? minE = 63479649 (0.830)4 (0.080) 3/90 NT 8.3% coding (1772/4461 nt) mukB fused chromosome partitioning proteins
?minE = 634816 45 (0.860)coding (1792/4461 nt) mukB fused chromosome partitioning proteins
* ? minE = 68366771 (1.200)5 (0.090) 3/96 NT 6.9% coding (48/459 nt) mgsA methylglyoxal synthase
?minE = 683688 69 (1.240)coding (27/459 nt) mgsA methylglyoxal synthase
* ? minE 688504 =58 (0.980)4 (0.080) 3/90 NT 7.3% intergenic (‑93/‑334) serT/hyaA tRNA‑Ser/hydrogenase 1, small subunit
?minE 688531 = 50 (0.960)intergenic (‑120/‑307) serT/hyaA tRNA‑Ser/hydrogenase 1, small subunit
* ? minE 704051 =36 (0.610)5 (0.100) 3/90 NT 13.0% coding (594/2097 nt) ymcA conserved hypothetical protein
?minE 704072 = 35 (0.670)coding (573/2097 nt) ymcA conserved hypothetical protein
* ? minE 712998 =71 (1.200)7 (0.130) 3/90 NT 10.2% coding (438/1047 nt) pyrC dihydro‑orotase
?minE 713021 = 60 (1.150)coding (415/1047 nt) pyrC dihydro‑orotase
* ? minE 715224 =56 (0.950)8 (0.150) 3/94 NT 10.9% coding (931/1209 nt) mdtH predicted drug efflux system
?minE 715252 = 79 (1.450)coding (903/1209 nt) mdtH predicted drug efflux system
* ? minE = 72364582 (1.390)5 (0.090) 3/94 NT 6.1% intergenic (‑23/‑112) rne/yceQ fused ribonucleaseE endoribonuclease and scaffold for formation of degradosome/hypothetical protein
?minE = 723669 79 (1.450)intergenic (‑47/‑88) rne/yceQ fused ribonucleaseE endoribonuclease and scaffold for formation of degradosome/hypothetical protein
* ? minE = 73261955 (0.930)7 (0.130) 4/96 NT 13.4% coding (65/810 nt) pabC 4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
?minE = 732639 39 (0.700)coding (85/810 nt) pabC 4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
* ? minE 759738 =48 (0.810)4 (0.080) 3/90 NT 9.0% coding (785/789 nt) ycfZ predicted inner membrane protein
?minE 759772 = 39 (0.750)coding (751/789 nt) ycfZ predicted inner membrane protein
* ? minE = 78918781 (1.370)13 (0.220) 4/102 NT 15.4% coding (269/1533 nt) ycgB conserved hypothetical protein
?minE = 789215 62 (1.050)coding (241/1533 nt) ycgB conserved hypothetical protein
* ? minE 808136 =50 (0.850)6 (0.120) 3/90 NT 12.8% coding (31/2868 nt) ycgV predicted adhesin
?minE 808171 = 38 (0.730)intergenic (‑5/+764) ycgV/ychF predicted adhesin/predicted GTP‑binding protein
* ? minE 809715 =82 (1.390)4 (0.070) 3/94 NT 5.5% coding (312/1092 nt) ychF predicted GTP‑binding protein
?minE 809751 = 62 (1.140)coding (276/1092 nt) ychF predicted GTP‑binding protein
* ? minE 812571 =41 (0.700)3 (0.060) 3/94 NT 7.2% coding (447/1680 nt) ychM predicted transporter
?minE 812595 = 39 (0.720)coding (423/1680 nt) ychM predicted transporter
* ? minE = 86036547 (0.800)3 (0.060) 3/90 NT 7.2% coding (1536/1563 nt) trpE component I of anthranilate synthase
?minE = 860375 36 (0.690)coding (1526/1563 nt) trpE component I of anthranilate synthase
* ? minE = 86921251 (0.860)10 (0.190) 4/92 NT 18.2% coding (927/1050 nt) sohB predicted inner membrane peptidase
?minE = 869257 44 (0.830)coding (972/1050 nt) sohB predicted inner membrane peptidase
* ? minE 882505 =35 (0.590)4 (0.090) 3/78 NT 14.3% intergenic (‑223/+46) osmB/yciT lipoprotein/predicted DNA‑binding transcriptional regulator
?minE 882535 = 21 (0.470)intergenic (‑253/+16) osmB/yciT lipoprotein/predicted DNA‑binding transcriptional regulator
* ? minE 889667 =75 (1.270)9 (0.160) 3/96 NT 11.5% coding (327/789 nt) fabI enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent
?minE 889691 = 68 (1.220)coding (303/789 nt) fabI enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent
* ? minE 930253 =61 (1.030)3 (0.060) 3/92 NT 5.2% coding (565/957 nt) yddK hypothetical protein
?minE 930278 = 55 (1.030)coding (540/957 nt) yddK hypothetical protein
* ? minE 949549 =82 (1.390)12 (0.220) 3/94 NT 13.7% coding (1288/2400 nt) dos cAMP phosphodiesterase, heme‑regulated
?minE 949570 = 75 (1.380)coding (1267/2400 nt) dos cAMP phosphodiesterase, heme‑regulated
* ? minE = 96960952 (0.880)3 (0.060) 3/84 NT 6.4% intergenic (‑193/‑56) ydeW/ego predicted DNA‑binding transcriptional regulator/fused AI2 transporter subunits and ATP‑binding components of ABC superfamily
?minE = 969624 45 (0.930)intergenic (‑208/‑41) ydeW/ego predicted DNA‑binding transcriptional regulator/fused AI2 transporter subunits and ATP‑binding components of ABC superfamily
* ? minE 974186 =93 (1.580)10 (0.190) 4/90 NT 11.2% coding (961/1023 nt) lsrB AI2 transporter
?minE 974243 = 77 (1.480)coding (1018/1023 nt) lsrB AI2 transporter
* ? minE = 975564102 (1.730)6 (0.110) 4/96 NT 5.6% coding (51/375 nt) ydeH conserved hypothetical protein
?minE = 975584 108 (1.950)coding (31/375 nt) ydeH conserved hypothetical protein
* ? minE 977434 =57 (0.970)4 (0.080) 3/88 NT 7.6% coding (1711/2046 nt) dcp dipeptidyl carboxypeptidase II
?minE 977463 = 48 (0.940)coding (1682/2046 nt) dcp dipeptidyl carboxypeptidase II
* ? minE 981092 =48 (0.810)5 (0.090) 3/94 NT 8.8% coding (73/498 nt) ydfP conserved hypothetical protein
?minE 981138 = 60 (1.100)coding (27/498 nt) ydfP conserved hypothetical protein
* ? minE 1000972 =54 (0.920)4 (0.080) 3/90 NT 8.2% coding (221/366 nt) mdtJ multidrug efflux system transporter
?minE 1001000 = 42 (0.810)coding (193/366 nt) mdtJ multidrug efflux system transporter
* ? minE 1022294 =47 (0.800)4 (0.080) 3/92 NT 8.9% coding (1469/1812 nt) uidA beta‑D‑glucuronidase
?minE 1022319 = 40 (0.750)coding (1444/1812 nt) uidA beta‑D‑glucuronidase
* ? minE 1037327 =87 (1.470)10 (0.190) 5/92 NT 11.9% coding (495/1059 nt) rsxD predicted inner membrane oxidoreductase
?minE 1037353 = 70 (1.320)coding (521/1059 nt) rsxD predicted inner membrane oxidoreductase
* ? minE 1056693 =70 (1.190)6 (0.120) 3/84 NT 9.5% intergenic (+8/‑85) rnt/lhr ribonuclease T (RNase T)/predicted ATP‑dependent helicase
?minE 1056725 = 57 (1.170)intergenic (+40/‑53) rnt/lhr ribonuclease T (RNase T)/predicted ATP‑dependent helicase
* ? minE 1066246 =63 (1.070)5 (0.090) 3/96 NT 7.7% coding (712/1026 nt) purR DNA‑binding transcriptional repressor, hypoxanthine‑binding
?minE 1066291 = 61 (1.100)coding (757/1026 nt) purR DNA‑binding transcriptional repressor, hypoxanthine‑binding
* ? minE = 107280589 (1.510)7 (0.130) 3/92 NT 7.5% coding (1014/1257 nt) ydhQ conserved hypothetical protein
?minE = 1072846 92 (1.730)coding (973/1257 nt) ydhQ conserved hypothetical protein
* ? minE = 108242632 (0.540)2 (0.040) 3/88 NT 6.7% intergenic (‑258/+197) ydhY/ydhZ predicted 4Fe‑4S ferridoxin‑type protein/hypothetical protein
?minE = 1082435 28 (0.550)intergenic (‑267/+188) ydhY/ydhZ predicted 4Fe‑4S ferridoxin‑type protein/hypothetical protein
* ? minE = 109441542 (0.710)6 (0.110) 4/94 NT 12.5% coding (1962/3057 nt) ydiJ predicted FAD‑linked oxidoreductase
?minE = 1094431 45 (0.830)coding (1946/3057 nt) ydiJ predicted FAD‑linked oxidoreductase
* ? minE = 1102207105 (1.780)7 (0.130) 5/92 NT 6.3% coding (728/867 nt) ydiB quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding
?minE = 1102226 113 (2.120)coding (747/867 nt) ydiB quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding
* ? minE = 110648637 (0.630)5 (0.090) 3/94 NT 10.4% coding (507/912 nt) ydiP predicted DNA‑binding transcriptional regulator
?minE = 1106504 52 (0.960)coding (489/912 nt) ydiP predicted DNA‑binding transcriptional regulator
* ? minE 1163606 =45 (0.760)5 (0.090) 3/94 NT 10.9% coding (401/549 nt) ynjA conserved hypothetical protein
?minE 1163628 = 40 (0.740)coding (423/549 nt) ynjA conserved hypothetical protein
* ? minE = 121319248 (0.810)3 (0.060) 3/80 NT 6.0% intergenic (+112/+32) yobH/kdgR hypothetical protein/predicted DNA‑binding transcriptional regulator
?minE = 1213205 56 (1.210)intergenic (+125/+19) yobH/kdgR hypothetical protein/predicted DNA‑binding transcriptional regulator
* ? minE 1228464 =37 (0.630)3 (0.060) 3/88 NT 5.9% coding (44/873 nt) yebZ predicted inner membrane protein
?minE 1228520 = 63 (1.240)coding (366/375 nt) yobA conserved hypothetical protein
* ? minE = 123887957 (0.970)4 (0.080) 3/92 NT 6.8% coding (1352/1476 nt) zwf glucose‑6‑phosphate dehydrogenase
?minE = 1238886 58 (1.090)coding (1345/1476 nt) zwf glucose‑6‑phosphate dehydrogenase
* ? minE = 124024640 (0.680)7 (0.140) 4/88 NT 16.2% intergenic (‑16/‑322) zwf/yebK glucose‑6‑phosphate dehydrogenase/predicted DNA‑binding transcriptional regulator
?minE = 1240259 38 (0.750)intergenic (‑29/‑309) zwf/yebK glucose‑6‑phosphate dehydrogenase/predicted DNA‑binding transcriptional regulator
* ? minE 1262733 =55 (0.930)4 (0.080) 3/90 NT 6.8% coding (450/747 nt) cutC copper homeostasis protein
?minE 1262759 = 61 (1.170)coding (424/747 nt) cutC copper homeostasis protein
* ? minE 1270365 =71 (1.200)4 (0.080) 3/90 NT 6.3% coding (616/816 nt) yedP conserved hypothetical protein
?minE 1270390 = 57 (1.100)coding (641/816 nt) yedP conserved hypothetical protein
* ? minE 1275427 =73 (1.240)4 (0.080) 3/82 NT 7.6% intergenic (+91/‑252) yodA/yodB conserved metal‑binding protein/predicted cytochrome
?minE 1275460 = 39 (0.820)intergenic (+124/‑219) yodA/yodB conserved metal‑binding protein/predicted cytochrome
* ? minE 1281187 =66 (1.120)6 (0.110) 3/96 NT 8.9% coding (2966/7104 nt) yeeJ adhesin
?minE 1281223 = 60 (1.080)coding (3002/7104 nt) yeeJ adhesin
* ? minE 1330180 =57 (0.970)4 (0.080) 3/84 NT 9.0% intergenic (‑20/+35) wcaJ/cpsG predicted UDP‑glucose lipid carrier transferase/phosphomannomutase
?minE 1330204 = 34 (0.700)intergenic (‑44/+11) wcaJ/cpsG predicted UDP‑glucose lipid carrier transferase/phosphomannomutase
* ? minE 1352904 =103 (1.750)10 (0.190) 3/92 NT 9.3% coding (609/789 nt) thiM hydoxyethylthiazole kinase
?minE 1352939 = 102 (1.920)coding (574/789 nt) thiM hydoxyethylthiazole kinase
* ? minE 1400840 =60 (1.020)4 (0.080) 3/90 NT 6.7% coding (555/714 nt) yeiU undecaprenyl pyrophosphate phosphatase
?minE 1400874 = 58 (1.110)coding (589/714 nt) yeiU undecaprenyl pyrophosphate phosphatase
* ? minE = 140113342 (0.710)9 (0.170) 3/90 NT 20.7% intergenic (+134/‑278) yeiU/spr undecaprenyl pyrophosphate phosphatase/predicted peptidase, outer membrane lipoprotein
?minE = 1401140 32 (0.610)intergenic (+141/‑271) yeiU/spr undecaprenyl pyrophosphate phosphatase/predicted peptidase, outer membrane lipoprotein
* ? minE 1405274 =52 (0.880)4 (0.080) 3/88 NT 9.4% coding (1479/1815 nt) yejA predicted oligopeptide transporter subunit
?minE 1405305 = 32 (0.630)coding (1510/1815 nt) yejA predicted oligopeptide transporter subunit
* ? minE 1443925 =106 (1.800)5 (0.090) 3/92 NT 5.8% coding (197/651 nt) rcsB DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
?minE 1443960 = 68 (1.280)coding (232/651 nt) rcsB DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
* ? minE 1468984 =43 (0.730)5 (0.090) 3/92 NT 11.4% coding (2738/3753 nt) yfaL adhesin
?minE 1469005 = 39 (0.730)coding (2717/3753 nt) yfaL adhesin
* ? minE = 154090331 (0.530)4 (0.080) 3/88 NT 13.6% intergenic (‑5/+676) yfcV/sixA predicted fimbrial‑like adhesin protein/phosphohistidine phosphatase
?minE = 1540916 24 (0.470)intergenic (‑18/+663) yfcV/sixA predicted fimbrial‑like adhesin protein/phosphohistidine phosphatase
* ? minE = 155318443 (0.730)6 (0.120) 3/90 NT 12.3% coding (66/936 nt) dsdC DNA‑binding transcriptional dual regulator
?minE = 1553192 48 (0.920)coding (58/936 nt) dsdC DNA‑binding transcriptional dual regulator
* ? minE 1557153 =62 (1.050)3 (0.050) 3/98 NT 5.4% intergenic (+1003/+260) dsdA/emrY D‑serine ammonia‑lyase/predicted multidrug efflux system
?minE 1557174 = 45 (0.790)intergenic (+1024/+239) dsdA/emrY D‑serine ammonia‑lyase/predicted multidrug efflux system
* ? minE = 157293341 (0.700)5 (0.090) 4/92 NT 12.2% coding (798/1416 nt) gltX glutamyl‑tRNA synthetase
?minE = 1572957 35 (0.660)coding (774/1416 nt) gltX glutamyl‑tRNA synthetase
* ? minE 1586261 =44 (0.750)4 (0.080) 3/92 NT 11.0% coding (795/972 nt) cysK cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
?minE 1586289 = 25 (0.470)coding (823/972 nt) cysK cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
* ? minE = 159299452 (0.880)4 (0.080) 3/92 NT 8.1% coding (879/1098 nt) cysA sulfate/thiosulfate transporter subunit
?minE = 1593014 44 (0.830)coding (859/1098 nt) cysA sulfate/thiosulfate transporter subunit
* ? minE = 159660342 (0.710)5 (0.100) 3/86 NT 12.8% intergenic (‑17/+287) cysP/ucpA thiosulfate transporter subunit/predicted oxidoredutase, sulfate metabolism protein
?minE = 1596628 33 (0.660)intergenic (‑42/+262) cysP/ucpA thiosulfate transporter subunit/predicted oxidoredutase, sulfate metabolism protein
* ? minE 1605349 =66 (1.120)7 (0.130) 4/92 NT 12.6% intergenic (‑153/‑61) ypeA/amiA predicted acyltransferase with acyl‑CoA N‑acyltransferase domain/N‑acetylmuramoyl‑l‑alanine amidase I
?minE 1605372 = 38 (0.710)intergenic (‑176/‑38) ypeA/amiA predicted acyltransferase with acyl‑CoA N‑acyltransferase domain/N‑acetylmuramoyl‑l‑alanine amidase I
* ? minE 1607174 =23 (0.390)4 (0.070) 3/94 NT 16.3% coding (892/900 nt) hemF coproporphyrinogen III oxidase
?minE 1607197 = 20 (0.370)coding (1044/1053 nt) yfeG predicted DNA‑binding transcriptional regulator
* ? minE 1615730 =63 (1.070)4 (0.080) 3/90 NT 7.0% coding (50/1188 nt) eutG predicted alcohol dehydrogenase in ethanolamine utilization
?minE 1615752 = 50 (0.960)coding (28/1188 nt) eutG predicted alcohol dehydrogenase in ethanolamine utilization
* ? minE 1616198 =51 (0.860)6 (0.120) 3/88 NT 11.9% coding (408/837 nt) eutJ predicted chaperonin, ethanolamine utilization protein
?minE 1616221 = 45 (0.880)coding (385/837 nt) eutJ predicted chaperonin, ethanolamine utilization protein
* ? minE = 162661049 (0.830)4 (0.080) 3/90 NT 7.7% coding (707/2004 nt) tktB transketolase 2, thiamin‑binding
?minE = 1626621 52 (1.000)coding (718/2004 nt) tktB transketolase 2, thiamin‑binding
* ? minE = 165787370 (1.190)5 (0.090) 3/94 NT 7.3% coding (73/1542 nt) ppx exopolyphosphatase
?minE = 1657886 63 (1.160)coding (86/1542 nt) ppx exopolyphosphatase
* ? minE = 165914359 (1.000)5 (0.090) 3/92 NT 8.1% coding (1343/1542 nt) ppx exopolyphosphatase
?minE = 1659178 61 (1.150)coding (1378/1542 nt) ppx exopolyphosphatase
* ? minE = 166044662 (1.050)8 (0.150) 4/90 NT 12.8% coding (1179/2244 nt) yfgF predicted inner membrane protein
?minE = 1660457 54 (1.040)coding (1168/2244 nt) yfgF predicted inner membrane protein
* ? minE 1699109 =35 (0.590)6 (0.100) 3/100 NT 14.6% coding (989/1281 nt) csiE stationary phase inducible protein
?minE 1699134 = 36 (0.620)coding (1014/1281 nt) csiE stationary phase inducible protein
* ? minE 1720522 =57 (0.970)5 (0.090) 4/96 NT 9.3% coding (968/1335 nt) yfhA predicted DNA‑binding response regulator in two‑component system
?minE 1720547 = 44 (0.790)coding (943/1335 nt) yfhA predicted DNA‑binding response regulator in two‑component system
* ? minE = 173500254 (0.920)6 (0.120) 3/88 NT 9.9% coding (154/729 nt) recO gap repair protein
?minE = 1735012 63 (1.240)coding (144/729 nt) recO gap repair protein
* ? minE 1736409 =35 (0.590)3 (0.050) 3/96 NT 8.6% coding (341/681 nt) rnc RNase III
?minE 1736433 = 31 (0.560)coding (317/681 nt) rnc RNase III
* ? minE = 175689839 (0.660)8 (0.160) 4/88 NT 18.5% coding (34/273 nt) yfiM hypothetical protein
?minE = 1756905 37 (0.730)coding (41/273 nt) yfiM hypothetical protein
* ? minE 1761899 =19 (0.320)3 (0.060) 3/94 NT 14.6% intergenic (‑29/+156) rrlG/gltW 23S ribosomal RNA/tRNA‑Glu
?minE 2232352 = NA (NA)intergenic (‑8/+186) rrlD/gltV 23S ribosomal RNA/tRNA‑Glu
* ? minE 1763935 =NA (NA)5 (0.090) 4/94 NT NA intergenic (‑92/+351) rrsG/clpB 16S ribosomal RNA/protein disaggregation chaperone
?minE 1763965 = NA (NA)intergenic (‑122/+321) rrsG/clpB 16S ribosomal RNA/protein disaggregation chaperone
* ? minE = 181236037 (0.630)6 (0.110) 3/96 NT 12.3% intergenic (‑49/+186) csrA/alaS pleiotropic regulatory protein for carbon source metabolism/alanyl‑tRNA synthetase
?minE = 1812377 51 (0.920)intergenic (‑66/+169) csrA/alaS pleiotropic regulatory protein for carbon source metabolism/alanyl‑tRNA synthetase
* ? minE = 185256653 (0.900)7 (0.140) 3/86 NT 14.2% coding (1055/1509 nt) ygcL hypothetical protein
?minE = 1852580 40 (0.800)coding (1041/1509 nt) ygcL hypothetical protein
* ? minE 1864946 =58 (0.980)3 (0.060) 3/92 NT 5.7% coding (316/861 nt) ygcQ predicted flavoprotein
?minE 1864972 = 47 (0.880)coding (290/861 nt) ygcQ predicted flavoprotein
* ? minE 1867538 =98 (1.660)6 (0.110) 5/98 NT 5.8% coding (1363/1455 nt) ygcU predicted FAD containing dehydrogenase
?minE 1867566 = 99 (1.750)coding (1335/1455 nt) ygcU predicted FAD containing dehydrogenase
* ? minE = 187904863 (1.070)5 (0.090) 3/94 NT 7.3% coding (101/1638 nt) pyrG CTP synthetase
?minE = 1879059 69 (1.270)coding (90/1638 nt) pyrG CTP synthetase
* ? minE = 188581647 (0.800)5 (0.090) 3/92 NT 9.3% coding (1278/2757 nt) barA hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
?minE = 1885828 55 (1.030)coding (1290/2757 nt) barA hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
* ? minE = 190368746 (0.780)10 (0.200) 3/86 NT 20.5% coding (2235/2889 nt) ptr protease III
?minE = 1903712 39 (0.780)coding (2210/2889 nt) ptr protease III
* ? minE = 190850446 (0.780)4 (0.080) 3/92 NT 9.4% coding (962/3369 nt) recC exonuclease V (RecBCD complex), gamma chain
?minE = 1908524 36 (0.680)coding (942/3369 nt) recC exonuclease V (RecBCD complex), gamma chain
* ? minE 1915974 =68 (1.150)5 (0.090) 3/92 NT 8.4% coding (41/531 nt) nudH nucleotide hydrolase
?minE 1916005 = 48 (0.900)coding (10/531 nt) nudH nucleotide hydrolase
* ? minE 1928403 =70 (1.190)8 (0.150) 3/92 NT 10.1% coding (817/1419 nt) araE arabinose transporter
?minE 1928438 = 80 (1.500)coding (782/1419 nt) araE arabinose transporter
* ? minE 1939651 =73 (1.240)5 (0.100) 3/88 NT 7.5% intergenic (+7/+33) fldB/ygfX flavodoxin 2/hypothetical protein
?minE 1939681 = 60 (1.180)intergenic (+37/+3) fldB/ygfX flavodoxin 2/hypothetical protein
* ? minE 1940973 =45 (0.760)7 (0.120) 4/100 NT 14.3% coding (393/981 nt) ygfZ predicted folate‑dependent regulatory protein
?minE 1941002 = 40 (0.690)coding (422/981 nt) ygfZ predicted folate‑dependent regulatory protein
* ? minE = 195630671 (1.200)5 (0.100) 3/88 NT 7.9% intergenic (+249/+140) ygfA/serA predicted ligase/D‑3‑phosphoglycerate dehydrogenase
?minE = 1956330 55 (1.080)intergenic (+273/+116) ygfA/serA predicted ligase/D‑3‑phosphoglycerate dehydrogenase
* ? minE 1958332 =38 (0.640)15 (0.290) 4/88 NT 34.6% coding (262/660 nt) rpiA ribosephosphate isomerase, constitutive
?minE 1958358 = 24 (0.470)coding (236/660 nt) rpiA ribosephosphate isomerase, constitutive
* ? minE = 197520354 (0.920)8 (0.160) 5/88 NT 13.8% intergenic (+349/‑75) metK/galP methionine adenosyltransferase 1/D‑galactose transporter
?minE = 1975209 53 (1.040)intergenic (+355/‑69) metK/galP methionine adenosyltransferase 1/D‑galactose transporter
* ? minE = 198680852 (0.880)7 (0.130) 3/92 NT 12.4% coding (915/1047 nt) ansB periplasmic L‑asparaginase II
?minE = 1986819 52 (0.980)coding (904/1047 nt) ansB periplasmic L‑asparaginase II
* ? minE = 198776066 (1.120)5 (0.090) 3/94 NT 7.9% intergenic (‑38/+138) ansB/yggN periplasmic L‑asparaginase II/hypothetical protein
?minE = 1987772 56 (1.030)intergenic (‑50/+126) ansB/yggN periplasmic L‑asparaginase II/hypothetical protein
* ? minE 1999373 =38 (0.640)7 (0.170) 3/72 NT 24.2% intergenic (‑242/+50) pitB/gss phosphate transporter/fused glutathionylspermidine amidase and glutathionylspermidine synthetase
?minE 1999408 = 17 (0.410)intergenic (‑277/+15) pitB/gss phosphate transporter/fused glutathionylspermidine amidase and glutathionylspermidine synthetase
* ? minE = 200101345 (0.760)8 (0.160) 4/88 NT 16.0% coding (270/1860 nt) gss fused glutathionylspermidine amidase and glutathionylspermidine synthetase
?minE = 2001023 45 (0.880)coding (260/1860 nt) gss fused glutathionylspermidine amidase and glutathionylspermidine synthetase
* ? minE 2001438 =72 (1.220)4 (0.080) 3/92 NT 5.6% intergenic (‑156/‑49) gss/yghU fused glutathionylspermidine amidase and glutathionylspermidine synthetase/predicted S‑transferase
?minE 2001487 = 70 (1.320)coding (1/867 nt) yghU predicted S‑transferase
* ? minE = 204112694 (1.590)9 (0.170) 3/90 NT 9.7% intergenic (+173/‑219) yqiH/yqiI predicted periplasmic pilin chaperone/conserved hypothetical protein
?minE = 2041151 84 (1.610)intergenic (+198/‑194) yqiH/yqiI predicted periplasmic pilin chaperone/conserved hypothetical protein
* ? minE = 206527561 (1.030)5 (0.090) 3/92 NT 8.5% coding (1516/1842 nt) rpoD RNA polymerase, sigma 70 (sigma D) factor
?minE = 2065303 53 (1.000)coding (1544/1842 nt) rpoD RNA polymerase, sigma 70 (sigma D) factor
* ? minE = 207008987 (1.470)6 (0.100) 3/102 NT 6.4% intergenic (‑300/‑91) aer/ygjG fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component/putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent
?minE = 2070114 88 (1.490)intergenic (‑325/‑66) aer/ygjG fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component/putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent
* ? minE 2114423 =86 (1.460)4 (0.080) 3/90 NT 5.6% coding (523/2517 nt) yraJ predicted outer membrane protein
?minE 2114447 = 60 (1.150)coding (547/2517 nt) yraJ predicted outer membrane protein
* ? minE 2123477 =59 (1.000)7 (0.120) 3/100 NT 11.1% coding (457/636 nt) yraR predicted nucleoside‑diphosphate‑sugar epimerase
?minE 2123505 = 54 (0.930)coding (429/636 nt) yraR predicted nucleoside‑diphosphate‑sugar epimerase
* ? minE = 217263450 (0.850)7 (0.140) 3/86 NT 16.1% coding (427/855 nt) yhbJ hypothetical protein with nucleoside triphosphate hydrolase domain
?minE = 2172672 31 (0.620)coding (465/855 nt) yhbJ hypothetical protein with nucleoside triphosphate hydrolase domain
* ? minE = 219261750 (0.850)7 (0.130) 4/92 NT 13.3% coding (86/639 nt) sspA stringent starvation protein A
?minE = 2192634 46 (0.860)coding (69/639 nt) sspA stringent starvation protein A
* ? minE = 224697336 (0.610)3 (0.060) 3/90 NT 7.2% coding (686/1896 nt) thiC thiamin (pyrimidine moiety) biosynthesis protein
?minE = 2246999 46 (0.880)coding (712/1896 nt) thiC thiamin (pyrimidine moiety) biosynthesis protein
* ? minE = 225882172 (1.220)11 (0.200) 3/96 NT 13.9% coding (2322/4029 nt) rpoB RNA polymerase, beta subunit
?minE = 2258846 68 (1.220)coding (2297/4029 nt) rpoB RNA polymerase, beta subunit
* ? minE = 226649244 (0.750)8 (0.150) 3/92 NT 14.0% intergenic (‑49/+66) tufB/thrT protein chain elongation factor EF‑Tu/tRNA‑Thr
?minE = 2266511 59 (1.110)intergenic (‑68/+47) tufB/thrT protein chain elongation factor EF‑Tu/tRNA‑Thr
* ? minE 2275478 =NA (NA)7 (0.130) 5/90 NT 100% noncoding (251/1542 nt) rrsB 16S ribosomal RNA
?minE 2362809 = 0 (0.000)noncoding (274/1542 nt) rrsA 16S ribosomal RNA
* ? minE 2281412 =33 (0.560)9 (0.170) 4/94 NT 21.6% intergenic (‑92/‑185) fabR/sthA DNA‑binding transcriptional repressor/pyridine nucleotide transhydrogenase, soluble
?minE 2281464 = 35 (0.640)intergenic (‑144/‑133) fabR/sthA DNA‑binding transcriptional repressor/pyridine nucleotide transhydrogenase, soluble
* ? minE 2295682 =53 (0.900)10 (0.180) 5/96 NT 17.4% coding (116/906 nt) yijE predicted permease
?minE 2295707 = 45 (0.810)coding (91/906 nt) yijE predicted permease
* ? minE = 229836616 (0.270)3 (0.060) 3/88 NT 16.3% intergenic (‑296/+33) katG/metF catalase/hydroperoxidase HPI(I)/5,10‑methylenetetrahydrofolate reductase
?minE = 2298380 17 (0.330)intergenic (‑310/+19) katG/metF catalase/hydroperoxidase HPI(I)/5,10‑methylenetetrahydrofolate reductase
* ? minE 2307169 =43 (0.730)10 (0.200) 3/88 NT 20.6% coding (2075/2199 nt) priA primosome factor n'
?minE 2307203 = 40 (0.790)coding (2109/2199 nt) priA primosome factor n'
* ? minE = 230968659 (1.000)4 (0.080) 3/88 NT 7.9% coding (69/531 nt) hslV peptidase component of the HslUV protease
?minE = 2309706 43 (0.840)coding (89/531 nt) hslV peptidase component of the HslUV protease
* ? minE = 231341343 (0.730)7 (0.140) 3/88 NT 14.9% intergenic (‑23/‑402) yiiU/glpF conserved hypothetical protein/glycerol facilitator
?minE = 2313447 43 (0.840)intergenic (‑57/‑368) yiiU/glpF conserved hypothetical protein/glycerol facilitator
* ? minE 2318657 =62 (1.050)5 (0.090) 4/94 NT 8.7% coding (282/300 nt) yiiS conserved hypothetical protein
?minE 2318677 = 48 (0.880)coding (262/300 nt) yiiS conserved hypothetical protein
* ? minE 2324191 =73 (1.240)7 (0.130) 4/92 NT 10.7% coding (163/963 nt) pfkA 6‑phosphofructokinase I
?minE 2324225 = 51 (0.960)coding (129/963 nt) pfkA 6‑phosphofructokinase I
* ? minE 2325828 =53 (0.900)5 (0.090) 3/98 NT 10.4% coding (258/501 nt) cpxP periplasmic protein combats stress
?minE 2325853 = 35 (0.620)coding (233/501 nt) cpxP periplasmic protein combats stress
* ? minE 2341764 =60 (1.020)6 (0.120) 3/88 NT 11.8% coding (1186/1410 nt) glnA glutamine synthetase
?minE 2341812 = 38 (0.750)coding (1234/1410 nt) glnA glutamine synthetase
* ? minE 2345484 =53 (0.900)13 (0.240) 4/92 NT 17.7% coding (1085/1374 nt) hemN coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
?minE 2345509 = 73 (1.370)coding (1060/1374 nt) hemN coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
* ? minE = 234557378 (1.320)11 (0.210) 4/92 NT 15.5% coding (996/1374 nt) hemN coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
?minE = 2345583 50 (0.940)coding (986/1374 nt) hemN coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
* ? minE = 234658253 (0.900)5 (0.090) 3/96 NT 10.7% intergenic (‑14/+175) hemN/yihI coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/conserved hypothetical protein
?minE = 2346601 34 (0.610)intergenic (‑33/+156) hemN/yihI coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/conserved hypothetical protein
* ? minE = 235215475 (1.270)6 (0.110) 3/94 NT 8.2% coding (144/933 nt) yihG predicted endonuclease
?minE = 2352173 65 (1.200)coding (163/933 nt) yihG predicted endonuclease
* ? minE = 235608350 (0.850)4 (0.070) 3/94 NT 8.7% coding (116/987 nt) yihE predicted kinase
?minE = 2356108 38 (0.700)coding (91/987 nt) yihE predicted kinase
* ? minE 2369694 =76 (1.290)5 (0.090) 3/92 NT 6.9% coding (2053/2190 nt) fadB fused 3‑hydroxybutyryl‑CoA epimerase/delta(3)‑cis‑delta(2)‑trans‑enoyl‑CoA isomerase/enoyl‑CoA hydratase and 3‑hydroxyacyl‑CoA dehydrogenase
?minE 2369713 = 67 (1.260)coding (2072/2190 nt) fadB fused 3‑hydroxybutyryl‑CoA epimerase/delta(3)‑cis‑delta(2)‑trans‑enoyl‑CoA isomerase/enoyl‑CoA hydratase and 3‑hydroxyacyl‑CoA dehydrogenase
* ? minE 2395757 =88 (1.490)4 (0.080) 3/90 NT 5.6% coding (338/381 nt) yigG predicted inner membrane protein
?minE 2395785 = 56 (1.080)coding (366/381 nt) yigG predicted inner membrane protein
* ? minE 2406152 =45 (0.760)8 (0.160) 4/88 NT 16.0% coding (1309/2547 nt) cyaA adenylate cyclase
?minE 2406177 = 45 (0.880)coding (1284/2547 nt) cyaA adenylate cyclase
* ? minE = 240787447 (0.800)4 (0.080) 3/92 NT 6.9% coding (28/942 nt) hemC hydroxymethylbilane synthase
?minE = 2407897 65 (1.220)coding (51/942 nt) hemC hydroxymethylbilane synthase
* ? minE 2432292 =88 (1.490)5 (0.090) 3/94 NT 6.4% coding (91/102 nt) rhoL rho operon leader peptide
?minE 2432341 = 64 (1.180)coding (42/102 nt) rhoL rho operon leader peptide
* ? minE 2434539 =78 (1.320)8 (0.150) 4/92 NT 10.0% coding (156/1485 nt) gpp guanosine pentaphosphatase/exopolyphosphatase
?minE 2434558 = 73 (1.370)coding (175/1485 nt) gpp guanosine pentaphosphatase/exopolyphosphatase
* ? minE 2437945 =54 (0.920)5 (0.090) 3/94 NT 10.1% intergenic (‑9/‑208) rep/yifN DNA helicase and single‑stranded DNA‑dependent ATPase/ECK3769:JW3750:b3777; conserved hypothetical protein
?minE 2437979 = 39 (0.720)intergenic (‑43/‑174) rep/yifN DNA helicase and single‑stranded DNA‑dependent ATPase/ECK3769:JW3750:b3777; conserved hypothetical protein
* ? minE 2446401 =64 (1.080)4 (0.080) 3/90 NT 7.1% coding (12/264 nt) ilvM acetolactate synthase II, small subunit
?minE 2446430 = 49 (0.940)pseudogene (1626/1647 nt) ilvG Mutation in protein compared to W3110: p.Glu327_Ilefs*223 Restoration of IlvG found in MG1655 (548 amino acids), fusion of N‑ter and C‑ter fragments ECK3760:JW3740+JW3741:b4488; large subunit of acetolactate synthase II
* ? minE 2449166 =36 (0.610)7 (0.120) 4/100 NT 13.8% coding (551/1551 nt) yifB predicted bifunctional protein, enzyme and transcriptional regulator
?minE 2449203 = 52 (0.900)coding (588/1551 nt) yifB predicted bifunctional protein, enzyme and transcriptional regulator
* ? minE 2463558 =45 (0.760)5 (0.090) 4/92 NT 10.8% intergenic (+221/‑396) gidB/atpI methyltransferase, glucose‑inhibited cell‑division protein/ATP synthase, membrane‑bound accesory subunit
?minE 2463597 = 42 (0.790)intergenic (+260/‑357) gidB/atpI methyltransferase, glucose‑inhibited cell‑division protein/ATP synthase, membrane‑bound accesory subunit
* ? minE 2467762 =68 (1.150)13 (0.260) 3/88 NT 20.2% coding (1226/1542 nt) atpA F1 sector of membrane‑bound ATP synthase, alpha subunit
?minE 2467786 = 44 (0.860)coding (1250/1542 nt) atpA F1 sector of membrane‑bound ATP synthase, alpha subunit
* ? minE 2478469 =63 (1.070)3 (0.060) 3/86 NT 6.1% coding (442/774 nt) pstB phosphate transporter subunit
?minE 2478497 = 40 (0.800)coding (470/774 nt) pstB phosphate transporter subunit
* ? minE = 247861876 (1.290)4 (0.080) 3/88 NT 5.6% coding (591/774 nt) pstB phosphate transporter subunit
?minE = 2478641 70 (1.380)coding (614/774 nt) pstB phosphate transporter subunit
* ? minE 2518040 =56 (0.950)6 (0.110) 3/94 NT 10.6% coding (1035/2109 nt) spoT bifunctional (p)ppGpp synthetase II and guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
?minE 2518070 = 50 (0.920)coding (1005/2109 nt) spoT bifunctional (p)ppGpp synthetase II and guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
* ? minE 2527264 =49 (0.830)6 (0.110) 3/94 NT 10.3% coding (280/456 nt) dut deoxyuridinetriphosphatase
?minE 2527296 = 59 (1.090)coding (248/456 nt) dut deoxyuridinetriphosphatase
* ? minE 2542293 =41 (0.700)8 (0.160) 6/86 NT 18.9% coding (131/1074 nt) rfaK lipopolysaccharide core biosynthesis
?minE 2542315 = 34 (0.680)coding (153/1074 nt) rfaK lipopolysaccharide core biosynthesis
* ? minE = 254720464 (1.080)4 (0.080) 3/92 NT 5.5% coding (285/933 nt) rfaD ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
?minE = 2547224 79 (1.480)coding (265/933 nt) rfaD ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
* ? minE 2577253 =110 (1.860)6 (0.110) 3/94 NT 5.8% coding (846/1650 nt) treF cytoplasmic trehalase
?minE 2577286 = 95 (1.750)coding (813/1650 nt) treF cytoplasmic trehalase
* ? minE = 258164766 (1.120)5 (0.100) 4/90 NT 7.6% intergenic (+137/‑233) gadA/gadX glutamate decarboxylase A, PLP‑dependent/DNA‑binding transcriptional dual regulator
?minE = 2581660 64 (1.230)intergenic (+150/‑220) gadA/gadX glutamate decarboxylase A, PLP‑dependent/DNA‑binding transcriptional dual regulator
* ? minE 2581882 =88 (1.490)7 (0.130) 4/92 NT 9.2% coding (3/825 nt) gadX DNA‑binding transcriptional dual regulator
?minE 2581912 = 59 (1.110)coding (33/825 nt) gadX DNA‑binding transcriptional dual regulator
* ? minE = 259330853 (0.900)6 (0.120) 3/90 NT 11.6% coding (422/567 nt) slp outer membrane lipoprotein
?minE = 2593325 45 (0.860)coding (405/567 nt) slp outer membrane lipoprotein
* ? minE = 259415479 (1.340)7 (0.130) 4/92 NT 9.8% intergenic (‑425/+716) slp/arsC outer membrane lipoprotein/arsenate reductase
?minE = 2594172 58 (1.090)intergenic (‑443/+698) slp/arsC outer membrane lipoprotein/arsenate reductase
* ? minE 2602170 =56 (0.950)4 (0.080) 3/90 NT 6.0% coding (1821/2043 nt) prlC oligopeptidase A
?minE 2602216 = 77 (1.480)coding (1867/2043 nt) prlC oligopeptidase A
* ? minE 2618363 =57 (0.970)4 (0.080) 3/92 NT 7.2% coding (171/246 nt) yhhP conserved hypothetical protein required for cell growth
?minE 2618392 = 51 (0.960)coding (200/246 nt) yhhP conserved hypothetical protein required for cell growth
* ? minE = 265943663 (1.070)6 (0.120) 3/84 NT 9.8% coding (165/327 nt) glpE thiosulfate:cyanide sulfurtransferase
?minE = 2659464 59 (1.210)coding (193/327 nt) glpE thiosulfate:cyanide sulfurtransferase
* ? minE 2659853 =51 (0.860)9 (0.180) 3/86 NT 18.6% coding (211/831 nt) glpG predicted intramembrane serine protease
?minE 2659878 = 36 (0.720)coding (236/831 nt) glpG predicted intramembrane serine protease
* ? minE = 266144552 (0.880)5 (0.090) 3/94 NT 9.6% coding (1384/1599 nt) rtcR sigma 54‑dependent transcriptional regulator of rtcBA expression
?minE = 2661470 46 (0.850)coding (1359/1599 nt) rtcR sigma 54‑dependent transcriptional regulator of rtcBA expression
* ? minE 2676216 =72 (1.220)4 (0.070) 3/100 NT 5.0% intergenic (‑2/‑36) gntX/bioH gluconate periplasmic binding protein with phosphoribosyltransferase domain, GNT I system/carboxylesterase of pimeloyl‑CoA synthesis
?minE 2676259 = 81 (1.400)coding (8/771 nt) bioH carboxylesterase of pimeloyl‑CoA synthesis
* ? minE 2684302 =58 (0.980)7 (0.130) 3/90 NT 13.2% intergenic (‑18/‑210) greB/ompR transcription elongation factor/DNA‑binding response regulator in two‑component regulatory system with EnvZ
?minE 2684350 = 41 (0.790)intergenic (‑66/‑162) greB/ompR transcription elongation factor/DNA‑binding response regulator in two‑component regulatory system with EnvZ
* ? minE 2704186 =53 (0.900)4 (0.080) 3/90 NT 6.9% coding (397/1287 nt) damX hypothetical protein
?minE 2704220 = 62 (1.190)coding (431/1287 nt) damX hypothetical protein
* ? minE = 270568054 (0.920)5 (0.090) 3/94 NT 9.1% coding (498/837 nt) dam DNA adenine methylase
?minE = 2705688 50 (0.920)coding (506/837 nt) dam DNA adenine methylase
* ? minE 2716414 =66 (1.120)5 (0.090) 3/94 NT 6.7% coding (341/573 nt) ppiA peptidyl‑prolyl cis‑trans isomerase A
?minE 2716451 = 78 (1.430)coding (378/573 nt) ppiA peptidyl‑prolyl cis‑trans isomerase A
* ? minE = 275179656 (0.950)6 (0.120) 3/90 NT 11.7% coding (801/990 nt) rpoA RNA polymerase, alpha subunit
?minE = 2751807 41 (0.790)coding (812/990 nt) rpoA RNA polymerase, alpha subunit
* ? minE = 275311851 (0.860)8 (0.150) 4/90 NT 12.9% coding (224/426 nt) zntR DNA‑binding transcriptional activator
?minE = 2753130 63 (1.210)coding (236/426 nt) zntR DNA‑binding transcriptional activator
* ? minE = 277593736 (0.610)7 (0.130) 3/92 NT 16.0% coding (1749/2187 nt) arpA regulator of acetyl CoA synthetase
?minE = 2775963 41 (0.770)coding (1723/2187 nt) arpA regulator of acetyl CoA synthetase
* ? minE = 278258655 (0.930)6 (0.110) 3/92 NT 9.7% coding (3561/3684 nt) metH homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
?minE = 2782595 62 (1.170)coding (3570/3684 nt) metH homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
* ? minE 2794500 =63 (1.070)5 (0.090) 3/92 NT 8.9% coding (841/2424 nt) plsB glycerol‑3‑phosphate O‑acyltransferase
?minE 2794521 = 45 (0.850)coding (820/2424 nt) plsB glycerol‑3‑phosphate O‑acyltransferase
* ? minE = 280935770 (1.190)8 (0.150) 3/90 NT 9.9% coding (246/417 nt) yjbQ conserved hypothetical protein
?minE = 2809376 84 (1.610)coding (265/417 nt) yjbQ conserved hypothetical protein
* ? minE 2814840 =43 (0.730)4 (0.080) 3/92 NT 10.3% coding (496/1587 nt) yjcC predicted signal transduction protein
?minE 2814859 = 31 (0.580)coding (515/1587 nt) yjcC predicted signal transduction protein
* ? minE = 283418985 (1.440)12 (0.220) 4/96 NT 12.1% coding (1503/1647 nt) groL Cpn60 chaperonin GroEL, large subunit of GroESL
?minE = 2834202 94 (1.690)coding (1516/1647 nt) groL Cpn60 chaperonin GroEL, large subunit of GroESL
* ? minE = 284498062 (1.050)4 (0.070) 3/96 NT 6.3% coding (676/978 nt) poxA predicted lysyl‑tRNA synthetase
?minE = 2845032 61 (1.100)coding (728/978 nt) poxA predicted lysyl‑tRNA synthetase
* ? minE 2889932 =99 (1.680)7 (0.130) 3/96 NT 8.3% coding (287/639 nt) msrA methionine sulfoxide reductase A
?minE 2889960 = 62 (1.120)coding (259/639 nt) msrA methionine sulfoxide reductase A
* ? minE = 289126162 (1.050)11 (0.220) 3/88 NT 15.4% intergenic (‑225/‑85) ppa/ytfQ inorganic pyrophosphatase/predicted sugar transporter subunit
?minE = 2891268 67 (1.320)intergenic (‑232/‑78) ppa/ytfQ inorganic pyrophosphatase/predicted sugar transporter subunit
* ? minE 2923517 =74 (1.250)5 (0.090) 4/96 NT 5.5% coding (1705/2856 nt) valS valyl‑tRNA synthetase
?minE 2923556 = 102 (1.840)coding (1666/2856 nt) valS valyl‑tRNA synthetase
* ? minE = 292766663 (1.070)4 (0.070) 3/102 NT 6.2% coding (65/1101 nt) yjgP conserved inner membrane protein
?minE = 2927692 58 (0.980)coding (91/1101 nt) yjgP conserved inner membrane protein
* ? minE = 294285969 (1.170)7 (0.130) 3/94 NT 7.9% coding (1870/2325 nt) fecA ferric citrate outer membrane transporter
?minE = 2942886 100 (1.840)coding (1843/2325 nt) fecA ferric citrate outer membrane transporter
* ? minE = 295793252 (0.880)4 (0.080) 4/90 NT 7.0% coding (247/606 nt) osmY periplasmic protein
?minE = 2957954 60 (1.150)coding (269/606 nt) osmY periplasmic protein
* ? minE 2962902 =72 (1.220)9 (0.170) 3/92 NT 11.5% coding (454/1551 nt) yjjI conserved hypothetical protein
?minE 2962924 = 74 (1.390)coding (432/1551 nt) yjjI conserved hypothetical protein
* ? minE = 297047550 (0.850)5 (0.080) 3/102 NT 10.2% coding (605/645 nt) ytjB conserved hypothetical protein
?minE = 2970512 38 (0.640)coding (568/645 nt) ytjB conserved hypothetical protein
* ? minE 2977650 =54 (0.920)6 (0.110) 3/94 NT 9.7% coding (628/1938 nt) slt lytic murein transglycosylase, soluble
?minE 2977677 = 62 (1.140)coding (655/1938 nt) slt lytic murein transglycosylase, soluble
* ? minE 2987034 =43 (0.730)5 (0.100) 4/90 NT 11.5% intergenic (+202/‑198) yjjY/yjtD hypothetical protein/predicted rRNA methyltransferase
?minE 2987057 = 39 (0.750)intergenic (+225/‑175) yjjY/yjtD hypothetical protein/predicted rRNA methyltransferase