breseq  version 0.32.1  revision aa8f2595a244
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation annotation gene description
RA 7,925 +A coding (35/1431 nt) yaaJ ← putative transporter
RA 10,647 A→G V237A (GTC→GCC)  yaaW ← UPF0174 family protein
RA 14,301 C→T A45V (GCG→GTG)  dnaJ → chaperone Hsp40, DnaK co‑chaperone
RA 28,269 C→T intergenic (+62/‑105) rihC → / → dapB ribonucleoside hydrolase 3/dihydrodipicolinate reductase
RA 30,616 T→C P322P (CCT→CCC)  carA → carbamoyl phosphate synthetase small subunit, glutamine amidotransferase
RA 35,373 G→C intergenic (‑2/+4) caiE ← / ← caiD stimulator of CaiD and CaiB enzyme activities/carnitinyl‑CoA dehydratase
RA 37,903 C→T D405N (GAC→AAC)  caiB ← crotonobetainyl CoA:carnitine CoA transferase
RA 47,776 G→A *177* (TAG→TAA) 
S3N (AGC→AAC) 
kefF →
kefC →
potassium‑efflux system ancillary protein for KefC, glutathione‑regulated, quinone oxidoreductase, FMN‑dependent
potassium:proton antiporter
RA 49,765 C→T intergenic (+134/‑58) kefC → / → folA potassium:proton antiporter/dihydrofolate reductase
RA 49,767 A→G intergenic (+136/‑56) kefC → / → folA potassium:proton antiporter/dihydrofolate reductase
RA 66,447 T→C E35G (GAG→GGG)  araD ← L‑ribulose‑5‑phosphate 4‑epimerase
RA 66,614 T→A intergenic (‑64/+221) araD ← / ← araA L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase
RA 72,115 G→A *255* (TAG→TAA)  yabI → DedA family inner membrane protein
RA 72,229 C→T *233* (TAG→TAA)  thiQ ← thiamine/thiamine pyrophosphate ABC transporter ATPase
RA 75,447 A→G C12R (TGC→CGC)  thiB ← thiamine/thiamine pyrophosphate/thiamine monophosphate ABC transporter periplasmic binding protein
RA 84,735 A→G D123G (GAC→GGC)  leuO → global transcription factor
RA 96,008 G→A *453* (TAG→TAA) 
V3I (GTT→ATT) 
murF →
mraY →
UDP‑N‑acetylmuramoyl‑tripeptide:D‑alanyl‑D‑ alanine ligase
phospho‑N‑acetylmuramoyl‑pentapeptide transferase
RA 104,352 A→G E124G (GAG→GGG)  ftsA → ATP‑binding cell division FtsK recruitment protein
RA 111,433 G→A *130* (TAG→TAA)  mutT → dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase
RA 115,661 T→C M22V (ATG→GTG)  hofC ← assembly protein in type IV pilin biogenesis, transmembrane protein
RA 117,074 A→G L9P (CTG→CCG)  hofB ← T2SE secretion family protein, P‑loop ATPase superfamily protein
RA 117,798 A→G L283P (CTA→CCA)  nadC ← quinolinate phosphoribosyltransferase
RA 122,856 G→A *255* (TAG→TAA)  pdhR → pyruvate dehydrogenase complex repressor, autorepressor
RA 125,227 T→C R737R (CGT→CGC)  aceE → pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
RA 150,947 T→C T3A (ACT→GCT)  yadC ← putative fimbrial‑like adhesin protein
RA 152,036 C→T V66I (GTA→ATA)  yadL ← putative fimbrial‑like adhesin protein
RA 155,935 T→C K89K (AAA→AAG)  yadV ← putative periplasmic pilin chaperone
RA 160,782 C→T *235* (TAG→TAA)  sfsA ← sugar fermentation stimulation protein A
RA 162,927 G→A A275T (GCT→ACT)  hrpB → putative ATP‑dependent helicase
RA 167,743 C→T T87I (ACC→ATC)  fhuA → ferrichrome outer membrane transporter
RA 169,645 A→G Y721C (TAC→TGC)  fhuA → ferrichrome outer membrane transporter
RA 170,349 A→G H191R (CAC→CGC)  fhuC → iron(3+)‑hydroxamate import ABC transporter ATPase
RA 177,662 C→T *267* (TAG→TAA)  btuF ← vitamin B12 ABC transporter periplasmic binding protein
RA 183,215 C→T G251G (GGC→GGT)  cdaR → carbohydrate diacid regulon transcriptional regulator, autoregulator
RA 183,607 Δ1 bp coding (1145/1158 nt) cdaR → carbohydrate diacid regulon transcriptional regulator, autoregulator
RA 183,620 G→A *386* (TAG→TAA)  cdaR → carbohydrate diacid regulon transcriptional regulator, autoregulator
RA 184,257 C→T *271* (TAG→TAA)  yaeI ← phosphodiesterase with model substrate bis‑pNPP
RA 197,574 T→C S343S (AGT→AGC)  rseP → inner membrane zinc RIP metalloprotease, RpoE activator, by degrading RseA, cleaved signal peptide endoprotease
RA 200,214 C→T P763S (CCA→TCA)  bamA → BamABCDE complex OM biogenesis outer membrane pore‑forming assembly factor
RA 219,364 T→C P77P (CCA→CCG)  tsaA ← tRNA‑Thr(GGU) m(6)t(6)A37 methyltransferase, SAM‑dependent
RA 220,239 C→T L230L (CTG→CTA)  metQ ← DL‑methionine transporter subunit
RA 239,378 G→A pseudogene (273/273 nt) yafF → pseudogene, H repeat‑associated protein
RA 247,461 G→A *250* (TAG→TAA)  yafL → putative lipoprotein and C40 family peptidase
RA 247,466 Δ1 bp intergenic (+5/‑171) yafL → / → rayT putative lipoprotein and C40 family peptidase/RAYT REP element‑mobilizing transposase, TnpA(REP)
RA 253,084 A→G T126A (ACA→GCA)  yafP → GNAT family putative N‑acetyltransferase
RA 255,659 A→G C20R (TGT→CGT)  pepD ← aminoacyl‑histidine dipeptidase (peptidase D)
MC JC 257,908 Δ776 bp [crl] [crl]
RA 262,563 G→A R354H (CGT→CAT)  proA → gamma‑glutamylphosphate reductase
RA 280,024 C→T pseudogene (94/174 nt) insI1 → IS30 transposase,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA 281,662 Δ1 bp coding (322/1155 nt) yagA ← CP4‑6 prophage, putative DNA‑binding transcriptional regulator
RA 284,869 C→T P557S (CCG→TCG)  yagF → CP4‑6 prophage, dehydratase family protein
RA 287,977 A→G M397V (ATG→GTG)  yagH → CP4‑6 prophage, putative xylosidase/arabinosidase
RA 291,324 C→T C8Y (TGT→TAT)  insA ← IS1 repressor TnpA
RA 309,358 C→T *223* (TAG→TAA)  ecpB ← ECP production pilus chaperone
RA 309,486 C→T G181S (GGT→AGT)  ecpB ← ECP production pilus chaperone
RA 312,189 C→T G26G (GGC→GGT)  ykgL → uncharacterized protein
RA 315,244 G→A intergenic (+16/‑47) eaeH → / → insE1 pseudogene, attaching and effacing protein homology,factor, Not classified/IS3 transposase A
RA 316,453 G→A *289* (TAG→TAA)  insF1 → IS3 transposase B
RA 321,564 (G)7→6 intergenic (+483/‑44) rclR → / → ykgE reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein, putative electron transport chain YkgEFG component
RA 323,355 C→T P340S (CCA→TCA)  ykgF → ferridoxin‑like LutB family protein, putative electron transport chain YkgEFG component
RA 335,970 C→T Q16* (CAA→TAA)  yahE → DUF2877 family protein
RA 340,089 G→A intergenic (+346/‑76) yahG → / → yahI DUF1116 family protein/carbamate kinase‑like protein
RA 344,674 T→C Y167H (TAC→CAC)  yahL → uncharacterized protein
RA 344,991 G→A *272* (TAG→TAA)  yahL → uncharacterized protein
RA 345,649 G→A *82* (TAG→TAA)  yahM → uncharacterized protein
RA 349,847 T→C intergenic (+275/‑165) prpB → / → prpC 2‑methylisocitrate lyase/2‑methylcitrate synthase
RA 354,592 G→A *629* (TAG→TAA)  prpE → propionate‑‑CoA ligase
RA 357,591 C→T intergenic (+137/+200) codA → / ← cynR cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA 357,606 C→T intergenic (+152/+185) codA → / ← cynR cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA 357,626 2 bp→TA intergenic (+172/+164) codA → / ← cynR cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA 357,791 C→T *300* (TAG→TAA)  cynR ← transcriptional activator of cyn operon, autorepressor
RA 371,542 C→T Q102* (CAA→TAA)  mhpC → 2‑hydroxy‑6‑ketonona‑2,4‑dienedioic acid hydrolase
RA 372,966 A→G T16A (ACC→GCC)  mhpF → acetaldehyde‑CoA dehydrogenase II, NAD‑binding
RA 375,067 A→G intergenic (+186/‑392) mhpE → / → mhpT 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA 375,075 G→A intergenic (+194/‑384) mhpE → / → mhpT 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA 375,307 C→T intergenic (+426/‑152) mhpE → / → mhpT 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA 379,606 C→T *92* (TAG→TAA)  frmR ← regulator protein that represses frmRAB operon
RA 380,022 (G)10→11 intergenic (‑141/+47) frmR ← / ← yaiO regulator protein that represses frmRAB operon/outer membrane protein
RA 382,579 G→A *302* (TAG→TAA)  insD1 → IS2 transposase TnpB
RA 383,259 C→T R226Q (CGG→CAG)  yaiP ← putative family 2 glycosyltransferase
RA 384,059 C→T *186* (TAG→TAA)  yaiS ← putative PIG‑L family deacetylase
RA 385,737 A→G D169G (GAT→GGT)  tauA → taurine ABC transporter periplasmic binding protein
RA 391,739 C→T *289* (TAG→TAA)  insF1 ← IS3 transposase B
RA 401,548 (G)5→4 coding (163/261 nt) iraP → anti‑RssB factor, RpoS stabilzer during Pi starvation, anti‑adapter protein
RA 405,224 G→A P141S (CCA→TCA)  proC ← pyrroline‑5‑carboxylate reductase, NAD(P)‑binding
RA 411,297 C→T *395* (TAG→TAA)  araJ ← L‑arabinose‑inducible putative transporter, MFS family
RA 437,107 G→A *173* (TAG→TAA)  pgpA → phosphatidylglycerophosphatase A
RA 443,051 C→T *197* (TAG→TAA)  yajL ← oxidative‑stress‑resistance chaperone
RA 443,604 C→T S13N (AGT→AAT) 
*304* (TAG→TAA) 
yajL ←
panE ←
oxidative‑stress‑resistance chaperone
2‑dehydropantoate reductase, NADPH‑specific
RA 444,641 C→T intergenic (‑126/‑42) panE ← / → yajQ 2‑dehydropantoate reductase, NADPH‑specific/phage Phi6 host factor, ATP/GTP binding protein
RA 450,764 C→T A283T (GCT→ACT)  cyoA ← cytochrome o ubiquinol oxidase subunit II
RA 461,242 G→A *785* (TAG→TAA)  lon → DNA‑binding ATP‑dependent protease La
RA 468,510 A→G E43G (GAG→GGG)  ybaO → putative DNA‑binding transcriptional regulator
RA 469,429 A→G K187E (AAG→GAG)  mdlA → putative multidrug ABC transporter ATPase
RA 470,643 G→A *591* (TAG→TAA) 
S3N (AGT→AAT) 
mdlA →
mdlB →
putative multidrug ABC transporter ATPase
putative multidrug ABC transporter ATPase
RA 475,667 T→C S97P (TCA→CCA)  ybaY → outer membrane lipoprotein
RA 477,025 G→A *118* (TAG→TAA)  ybaA → DUF1428 family protein
RA 477,435 T→C T395A (ACT→GCT)  ylaB ← putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 478,533 C→T A29T (GCC→ACC)  ylaB ← putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 480,334 C→T *125* (TAG→TAA)  tomB ← Hha toxicity attenuator, conjugation‑related protein
RA 486,641 T→C S36P (TCA→CCA)  mscK → mechanosensitive channel protein, intermediate conductance, K+ regulated
RA 490,285 C→T *176* (TAG→TAA)  priC ← primosomal replication protein N''
RA 491,776 T→C V122A (GTT→GCT)  apt → adenine phosphoribosyltransferase
RA 499,014 C→T R320R (CGC→CGT) 
*320* (TAG→TAA) 
hemH →
aes ←
ferrochelatase
acetyl esterase
RA 515,808 C→T intergenic (‑35/‑111) qmcA ← / → fetA PHB domain membrane‑anchored putative protease/iron export ABC transporter ATPase, peroxide resistance protein
RA 518,721 C→A M143I (ATG→ATT)  ybbO ← putative oxidoreductase
RA 522,463 T→C V683A (GTG→GCG)  ybbP → putative ABC transporter permease
RA 524,158 C→T L300L (CTG→TTG)  rhsD → Rhs protein with DUF4329 family putative toxin domain, putative neighboring cell growth inhibitor
RA 540,515 C→T intergenic (+7/‑50) allB → / → ybbY allantoinase/putative uracil/xanthine transporter
RA 542,530 A→G T215A (ACG→GCG)  glxK → glycerate kinase II
RA 544,754 C→T R180H (CGT→CAT)  allC ← allantoate amidohydrolase
RA 551,332 G→A *298* (TAG→TAA)  ybcF → putative carbonate kinase
RA 568,004 G→A *289* (TAG→TAA)  insF1 → IS3 transposase B
RA 571,444 G→A *184* (TAG→TAA)  ybcL → inactive polymorphonuclear leukocyte migration suppressor, DLP12 prophage, UPF0098 family secreted protein
RA 572,454 C→T C29C (TGC→TGT)  ylcH → uncharacterized protein, DLP12 prophage
RA 578,568 G→A *154* (TAG→TAA)  rzpD → DLP12 prophage, putative murein endopeptidase
RA 582,148 Δ1 bp intergenic (+51/+4) tfaD → / ← ybcY pseudogene, DLP12 prophage, tail fiber assembly protein family,Phage or Prophage Related/pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related
RA 582,152 C→T pseudogene (653/653 nt) ybcY ← pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related
RA 586,280 T→C N210S (AAC→AGC)  envY ← porin thermoregulatory transcriptional activator
RA 607,988 G→A *51* (TAG→TAA)  hokE → toxic polypeptide, small
RA 631,812 T→C F640S (TTC→TCC)  cstA → carbon starvation protein involved in peptide utilization, APC peptide transporter family protein
RA 634,746 2 bp→AT [ybdL]–[ybdM] [ybdL], [ybdM]
RA 649,372 A→G F67S (TTC→TCC)  citF ← citrate lyase, citrate‑ACP transferase (alpha) subunit
RA 649,648 A→G G281G (GGT→GGC)  citE ← citrate lyase, citryl‑ACP lyase (beta) subunit
RA 662,153 C→A E42D (GAG→GAT)  lipB ← octanoyltransferase, octanoyl‑[ACP]:protein N‑octanoyltransferase
RA 664,102 C→T *363* (TAG→TAA)  rlpA ← septal ring protein, suppressor of prc, minor lipoprotein
RA 672,947 C→A V613F (GTT→TTT)  leuS ← leucyl‑tRNA synthetase
RA 675,570 C→T *326* (TAG→TAA)  ybeQ ← Sel1 family TPR‑like repeat protein
RA 675,601 Δ1 bp coding (947/978 nt) ybeQ ← Sel1 family TPR‑like repeat protein
RA 677,889 G→A A159T (GCC→ACC)  djlB → putative HscC co‑chaperone, uncharacterized J domain‑containing protein
RA 679,874 G→A G123R (GGG→AGG)  ybeU → DUF1266 family protein
RA 696,276 G→A *392* (TAG→TAA)  ubiF → 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase
RA 711,724 C→T A59T (GCG→ACG)  ybfE ← LexA‑regulated protein, CopB family
RA 716,388 C→T pseudogene (210/651 nt) ybfG ← pseudogene
RA 723,528 (T)8→9 coding (887/2685 nt) kdpD ← fused sensory histidine kinase in two‑component regulatory system with KdpE: signal sensing protein
RA 738,853 G→A *254* (TAG→TAA)  ybfD → H repeat‑associated putative transposase
RA 746,723 C→T H263H (CAC→CAT) 
*349* (TAG→TAA) 
nei →
abrB ←
endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase
regulator of aidB expression, inner membrane protein
RA 746,726 G→A *264* (TAG→TAA) 
A348A (GCC→GCT) 
nei →
abrB ←
endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase
regulator of aidB expression, inner membrane protein
RA 762,739 G→A *406* (TAG→TAA)  sucB → dihydrolipoyltranssuccinase
RA 775,120 G→A A123A (GCG→GCA)  ybgC → acyl‑CoA thioester hydrolase
RA 777,644 A→G intergenic (+37/‑96) tolA → / → tolB membrane anchored protein in TolA‑TolQ‑TolR complex/periplasmic protein
RA 789,464 G→A I172I (ATC→ATT)  galK ← galactokinase
RA 812,947 G→A *226* (TAG→TAA)  bioD → dethiobiotin synthetase
RA 819,747 G→A *151* (TAG→TAA)  moaE → molybdopterin synthase, large subunit
RA 821,506 G→A *238* (TAG→TAA)  ybhM → BAX Inhibitor‑1 family inner membrane protein
RA 825,102 G→A A336V (GCG→GTG)  ybhR ← putative ABC transporter permease
RA 826,119 C→T *378* (TAG→TAA)  ybhS ← putative ABC transporter permease
RA 829,972 C→T M1M (GTG→ATG) †
*224* (TAG→TAA) 
ybhG ←
ybiH ←
putative membrane fusion protein (MFP) component of efflux pump, membrane anchor
DUF1956 domain‑containing tetR family putative transcriptional regulator
RA 850,389 T→C intergenic (‑292/‑61) rhtA ← / → ompX threonine and homoserine efflux system/outer membrane protein X
RA 852,869 C→T *43* (TAG→TAA)  mntS ← Mn(2)‑response protein, MntR‑repressed
RA 854,765 G→A *373* (TAG→TAA)  ybiR → putative transporter
RA 855,796 A→G intergenic (‑52/‑167) ldtB ← / → ybiT L,D‑transpeptidase linking Lpp to murein/ABC‑F family putative regulatory ATPase
RA 860,638 A→G Y657H (TAT→CAT)  ybiW ← putative pyruvate formate lyase
RA 872,801 G→A *304* (TAG→TAA)  gsiD → glutathione ABC transporter permease
RA 875,327 G→A *783* (TAG→TAA)  yliE → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 879,857 G→A *372* (TAG→TAA) 
S208S (AGC→AGT) 
yliI →
gstB ←
soluble aldose sugar dehydrogenase
glutathione S‑transferase
JC JC 883,665 IS1 (–) +9 bp [mdfA] [mdfA]
RA 887,959 G→A *179* (TAG→TAA)  rcdA → transcriptional regulator of csgD and ybiJI, autoregulator
RA 889,215 A→G L202P (CTG→CCG)  ybjL ← putative transporter
RA 892,869 G→A *301* (TAG→TAA)  rimK → ribosomal protein S6 modification protein
RA 899,254 (G)6→7 coding (737/1128 nt) rlmC → 23S rRNA m(5)U747 methyltransferase, SAM‑dependent
RA 905,743 G→A *277* (TAG→TAA) 
R337R (CGC→CGT) 
amiD →
ybjS ←
1,6‑anhydro‑N‑acetylmuramyl‑L‑alanine amidase, Zn‑dependent, OM lipoprotein
putative NAD(P)H‑dependent oxidoreductase
RA 911,132 A→G intergenic (‑83/+50) poxB ← / ← hcr pyruvate dehydrogenase, thiamine triphosphate‑binding, FAD‑binding/HCP oxidoreductase, NADH‑dependent
RA 913,349 G→A L156L (CTG→TTG)  hcp ← hybrid‑cluster [4Fe‑2S‑2O] subunit of anaerobic terminal reductases
RA 915,730 T→C K106K (AAA→AAG)  aqpZ ← aquaporin Z
RA 922,366 C→T *75* (TAG→TAA)  cspD ← inhibitor of DNA replication, cold shock protein homolog
RA 927,205 A→G R76R (CGT→CGC)  aat ← leucyl/phenylalanyl‑tRNA‑protein transferase
RA 932,340 (A)8→7 intergenic (‑290/‑255) trxB ← / → lrp thioredoxin reductase, FAD/NAD(P)‑binding/leucine‑responsive global transcriptional regulator
RA 937,983 G→A *204* (TAG→TAA)  lolA → lipoprotein chaperone
RA 966,584 G→A *755* (TAG→TAA)  ycaI → ComEC family inner membrane protein
RA 967,118 A→G Q166Q (CAA→CAG)  msbA → lipid ABC transporter permease/ATPase
RA 969,352 G→A *329* (TAG→TAA)  lpxK → lipid A 4'kinase
RA 983,623 G→A *183* (TAG→TAA)  ycbK → M15A protease‑related family periplasmic protein
RA 986,671 A→G R104R (CGT→CGC)  ompF ← outer membrane porin 1a (Ia,b,F)
RA 1,006,415 Δ1 bp coding (464/543 nt) zapC → FtsZ stabilizer
RA 1,006,491 C→T V180V (GTC→GTT) 
*370* (TAG→TAA) 
zapC →
ycbX ←
FtsZ stabilizer
6‑N‑hydroxylaminopurine detoxification oxidoreductase
RA 1,050,350 C→A S108S (TCC→TCA)  insB1 → IS1 transposase B
RA 1,053,516 (G)6→7 coding (2663/2745 nt) torS ← hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA 1,068,254 G→A *58* (TAG→TAA)  ymdF → KGG family protein
RA 1,068,276 Δ1 bp intergenic (+22/+235) ymdF → / ← rutG KGG family protein/pyrimidine permease
RA 1,068,285 Δ1 bp intergenic (+31/+226) ymdF → / ← rutG KGG family protein/pyrimidine permease
RA 1,072,060 G→A L34L (CTG→TTG)  rutC ← putative aminoacrylate deaminase, reactive intermediate detoxification, weak enamine/imine deaminase activity
RA 1,073,732 C→T A94T (GCG→ACG)  rutA ← pyrimidine oxygenase, FMN‑dependent
RA 1,082,060 A→G pseudogene (601/726 nt) efeU → ferrous iron permease (pseudogene)
RA 1,089,570 T→C E96E (GAA→GAG)  pgaB ← poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA 1,094,275 C→T *289* (TAG→TAA)  insF1 ← IS3 transposase B
RA 1,102,221 T→C E107E (GAA→GAG)  csgE ← curlin secretion specificity factor
RA 1,119,307 C→T *47* (TAG→TAA)  yceO ← uncharacterized protein
RA 1,125,011 A→G C106R (TGC→CGC)  mdtH ← multidrug resistance efflux transporter conferring overexpression resistance to norfloxacin and enoxacin
RA 1,139,406 Δ1 bp coding (1029/1644 nt) flgK → flagellar hook‑filament junction protein 1
RA 1,146,011 C→T *195* (TAG→TAA)  yceF ← m(7)GTP pyrophosphatase
RA 1,148,691 G→A *357* (TAG→TAA)  plsX → putative phosphate acyltransferase
RA 1,149,712 G→A *318* (TAG→TAA)  fabH → 3‑oxoacyl‑[acyl‑carrier‑protein] synthase III
RA 1,153,047 A→G D370G (GAT→GGT)  fabF → 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II
RA 1,154,109 G→A *270* (TAG→TAA)  pabC → 4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA 1,168,350 Δ1 bp coding (483/633 nt) ycfQ ← repressor for bhsA(ycfR)
RA 1,200,881 G→A A51V (GCC→GTC)  xisE ← e14 prophage, putative excisionase
RA 1,203,224 G→A *67* (TAG→TAA)  croE → e14 prophage, putative DNA‑binding transcriptional regulator
RA 1,204,160 G→A *113* (TAG→TAA)  ymfM → e14 prophage, uncharacterized protein
RA 1,205,731 G→A *61* (TAG→TAA) 
pseudogene (1/412 nt)
ymfR →
beeE →
e14 prophage, uncharacterized protein
pseudogene, portal protein family, e14 prophage,Phage or Prophage Related
RA 1,208,517 C→T P129L (CCT→CTT) 
*201* (TAG→TAA) 
tfaP →
tfaE ←
e14 prophage, uncharacterized protein
e14 prophage, putative tail fiber assembly protein
RA 1,208,534 Δ1 bp coding (403/414 nt);coding (586/603 nt) tfaP →
tfaE ←
e14 prophage, uncharacterized protein
e14 prophage, putative tail fiber assembly protein
RA 1,211,652 C→T intergenic (+75/+28) icdC → / ← iraM pseudogene, isocitrate dehydrogenase C‑terminal gene fragment, idcC' is a 54 codon 3' gene fragment created during e14 prophage insertion/RpoS stabilzer during Mg starvation, anti‑RssB factor
RA 1,212,233 A→G intergenic (‑230/+470) iraM ← / ← ycgX RpoS stabilzer during Mg starvation, anti‑RssB factor/DUF1398 family protein
RA 1,212,703 C→T *135* (TAG→TAA)  ycgX ← DUF1398 family protein
RA 1,216,996 Δ2 bp [ymgC] [ymgC]
RA 1,228,724 A→G T216A (ACT→GCT)  ycgM → putative isomerase/hydrolase
RA 1,245,600 G→A *147* (TAG→TAA)  ycgY → uncharacterized protein
RA 1,250,629 (C)5→6 coding (210/1071 nt) dhaK ← dihydroxyacetone kinase, PTS‑dependent, dihydroxyacetone‑binding subunit
RA 1,252,038 G→A A325T (GCT→ACT)  dhaR → dhaKLM operon transcription activator
RA 1,260,528 A→G I92I (ATT→ATC)  dauA ← C4‑dicarboxylic acid transporter
RA 1,264,970 G→A *419* (TAG→TAA)  hemA → glutamyl tRNA reductase
MC JC 1,265,001 1086 bp→GAGG [prfA] [prfA]
RA 1,271,455 G→A T132I (ACC→ATC)  chaA ← calcium/sodium:proton antiporter
RA 1,275,815 T→C E5E (GAA→GAG)  narL ← response regulator in two‑component regulatory system with NarX
RA 1,286,793 A→G intergenic (+267/+273) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,286,796 T→C intergenic (+270/+270) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,286,805 2 bp→AA intergenic (+279/+260) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,286,831 T→A intergenic (+305/+235) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,286,859 T→C intergenic (+333/+207) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,286,984 G→A intergenic (+458/+82) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,287,152 T→C noncoding (85/171 nt)
T9A (ACT→GCT) 
rttR ←
tpr ←
rtT sRNA, processed from tyrT transcript
protamine‑like protein
RA 1,287,161 2 bp→AA noncoding (75‑76/171 nt)
coding (15‑16/90 nt)
rttR ←
tpr ←
rtT sRNA, processed from tyrT transcript
protamine‑like protein
RA 1,309,016 C→T *418* (TAG→TAA)  kch ← voltage‑gated potassium channel
RA 1,317,517 A→G I300T (ATC→ACC)  trpB ← tryptophan synthase, beta subunit
RA 1,347,450 C→T G488D (GGT→GAT)  rnb ← ribonuclease II
RA 1,354,505 C→T S5N (AGC→AAC) 
*322* (TAG→TAA) 
sapC ←
sapB ←
antimicrobial peptide transport ABC transporter permease
antimicrobial peptide transport ABC transporter permease
RA 1,366,935 C→T *326* (TAG→TAA)  pspF ← psp operon transcriptional activator
RA 1,370,044 (T)9→8 intergenic (+41/‑172) pspE → / → ycjM thiosulfate:cyanide sulfurtransferase (rhodanese)/alpha amylase catalytic domain family protein
RA 1,380,807 G→A *220* (TAG→TAA)  ycjU → beta‑phosphoglucomutase
RA 1,381,789 G→A pseudogene (13/126 nt) ycjV → pseudogene, putative ATP‑binding component of a transport system
RA 1,389,242 C→T Q105* (CAA→TAA)  ycjG → L‑Ala‑D/L‑Glu epimerase
RA 1,389,499 C→T C190C (TGC→TGT)  ycjG → L‑Ala‑D/L‑Glu epimerase
RA 1,389,895 G→A *322* (TAG→TAA) 
P235L (CCT→CTT) 
ycjG →
mpaA ←
L‑Ala‑D/L‑Glu epimerase
murein peptide amidase A
RA 1,392,890 G→A *300* (TAG→TAA)  pgrR → murein peptide degradation regulator
RA 1,399,985 (C)7→8 coding (252/516 nt) ogt ← O‑6‑alkylguanine‑DNA:cysteine‑protein methyltransferase
RA 1,400,348 G→A P476S (CCC→TCC)  abgT ← p‑aminobenzoyl‑glutamate transporter, membrane protein
RA 1,412,000 C→T *412* (TAG→TAA)  intR ← Rac prophage, integrase
RA 1,418,386 G→A intergenic (‑157/‑285) kilR ← / → sieB killing protein, Rac prophage, FtsZ inhibitor protein/phage superinfection exclusion protein, Rac prophage
RA 1,419,159 G→A *163* (TAG→TAA) 
S51S (AGC→AGT) 
sieB →
ydaF ←
phage superinfection exclusion protein, Rac prophage
uncharacterized protein, Rac prophage
RA 1,419,344 G→A A38V (GCT→GTT)  ydaG ← Rac prophage, uncharacterized protein
RA 1,425,228 (T)8→7 coding (1447/1458 nt) trkG → Rac prophage, potassium transporter subunit
RA 1,425,980 G→A pseudogene (351/453 nt) ydaY → pseudogene, Rac prophage,Phage or Prophage Related
RA 1,426,288 G→A intergenic (+206/‑166) ydaY → / → tmpR pseudogene, Rac prophage,Phage or Prophage Related/Rac prophage, pseudogene, tail protein family,Phage or Prophage Related, putative alpha helix protein
RA 1,431,882 T→C V945A (GTG→GCG)  stfR → Rac prophage, putative tail fiber protein
RA 1,432,273 G→A A1075A (GCG→GCA)  stfR → Rac prophage, putative tail fiber protein
RA 1,450,392 C→T A320T (GCA→ACA)  tynA ← tyramine oxidase, copper‑requiring
RA 1,454,292 C→A G122G (GGC→GGA)  paaA → ring 1,2‑phenylacetyl‑CoA epoxidase subunit
RA 1,458,617 A→G A118A (GCA→GCG)  paaG → 1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming
RA 1,459,052 G→A *263* (TAG→TAA)  paaG → 1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming
RA 1,464,489 G→A *317* (TAG→TAA) 
D7N (GAC→AAC) 
paaX →
paaY →
transcriptional repressor of phenylacetic acid degradation paa operon, phenylacetyl‑CoA inducer
thioesterase required for phenylacetic acid degradation, trimeric, phenylacetate regulatory and detoxification protein, hexapeptide repeat protein
RA 1,466,996 T→C pseudogene (1605/2513 nt) ydbA → pseudogene, autotransporter homolog, interrupted by IS2 and IS30
RA 1,467,921 C→T *302* (TAG→TAA)  insD1 ← IS2 transposase TnpB
RA 1,491,389 A→G K163R (AAG→AGG)  cybB → cytochrome b561
RA 1,493,219 A→G E250E (GAA→GAG)  trg → methyl‑accepting chemotaxis protein III, ribose and galactose sensor receptor
RA 1,497,308 A→G E151E (GAA→GAG)  opgD → OPG biosynthetic periplasmic protein
RA 1,503,125 G→A *223* (TAG→TAA)  ydcL → lipoprotein
RA 1,513,468 T→C S218P (TCC→CCC)  ydcT → putative ABC transporter ATPase
RA 1,529,938 G→A pseudogene (2037/2037 nt)
R6K (AGA→AAA) 
rhsE →
ydcD →
pseudogene, Rhs family
putative immunity protein for RhsE
RA 1,533,045 C→T intergenic (+93/‑7) ydcC → / → pptA H repeat‑associated putative transposase/4‑oxalocrotonate tautomerase
RA 1,544,384 C→T pseudogene (381/381 nt) yddK ← pseudogene, leucine‑rich protein, putative glycoportein
RA 1,548,360 C→T D320D (GAC→GAT)  fdnG → formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA 1,557,112 C→T *309* (TAG→TAA)  ddpF ← D,D‑dipeptide ABC transporter ATPase
RA 1,559,680 G→A G77G (GGC→GGT)  ddpC ← D,D‑dipeptide ABC transporter permease
RA 1,565,758 C→T *461* (TAG→TAA)  dosC ← diguanylate cyclase, cold‑ and stationary phase‑induced oxygen‑dependent biofilm regulator
RA 1,571,332 G→T I238I (ATC→ATA)  gadB ← glutamate decarboxylase B, PLP‑dependent
RA 1,571,902 G→A D48D (GAC→GAT)  gadB ← glutamate decarboxylase B, PLP‑dependent
RA 1,571,917 G→A F43F (TTC→TTT)  gadB ← glutamate decarboxylase B, PLP‑dependent
RA 1,598,617 C→T *531* (TAG→TAA)  lsrK ← autoinducer‑2 (AI‑2) kinase
RA 1,614,789 C→T intergenic (‑86/‑15) sad ← / → yneJ succinate semialdehyde dehydrogenase, NAD(P)+‑dependent/putative DNA‑binding transcriptional regulator
RA 1,618,218 G→A *397* (TAG→TAA)  ydeA → arabinose efflux transporter, arabinose‑inducible
RA 1,619,957 G→A *128* (TAG→TAA)  marA → multiple antibiotic resistance transcriptional regulator
RA 1,620,207 G→A *73* (TAG→TAA)  marB → periplasmic mar operon regulator
RA 1,621,542 G→A D71N (GAC→AAC)  ydeE → putative transporter
RA 1,624,357 (T)8→7 coding (141/393 nt) ydeI ← hydrogen peroxide resistance OB fold protein, putative periplasmic protein
RA 1,626,825 C→T V186I (GTT→ATT)  dcp ← dipeptidyl carboxypeptidase II
RA 1,627,124 T→C D86G (GAT→GGT)  dcp ← dipeptidyl carboxypeptidase II
RA 1,627,625 T→C L37L (TTG→CTG)  ydfG → NADP‑dependent 3‑hydroxy acid dehydrogenase, malonic semialdehyde reductase
RA 1,630,986 A→G intergenic (‑73/+16) ydfI ← / ← ydfJ putative NAD‑dependent D‑mannonate oxidoreductase/pseudogene, MFS transporter family, interrupted by Qin prophage,Phage or Prophage Related, putative transport protein
RA 1,639,030 C→T *166* (TAG→TAA)  rzpQ ← Rz‑like protein, Qin prophage
RA 1,649,041 G→A *73* (TAG→TAA)  ydfC → uncharacterized protein, Qin prophage
RA 1,651,537 G→A pseudogene (693/693 nt) insD1 → IS2 transposase TnpB,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA 1,655,057 T→C T29A (ACG→GCG)  rspA ← bifunctional D‑altronate/D‑mannonate dehydratase
RA 1,655,347 C→T *109* (TAG→TAA)  ynfA ← UPF0060 family inner membrane protein
RA 1,655,360 (C)5→4 coding (314/327 nt) ynfA ← UPF0060 family inner membrane protein
RA 1,656,744 G→A *187* (TAG→TAA)  speG → spermidine N(1)‑acetyltransferase
RA 1,664,096 T→C I163T (ATA→ACA)  ynfH → oxidoreductase, membrane subunit
RA 1,665,120 G→A *205* (TAG→TAA)  dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,670,581 G→A G295R (GGA→AGA)  ynfM → putative arabinose efflux transporter
RA 1,673,314 A→G L63P (CTG→CCG)  mdtJ ← multidrug efflux system transporter
RA 1,673,789 T→C intergenic (‑288/‑124) mdtJ ← / → tqsA multidrug efflux system transporter/pheromone AI‑2 transporter
RA 1,676,624 T→C H427R (CAC→CGC)  pntA ← pyridine nucleotide transhydrogenase, alpha subunit
RA 1,685,542 (C)6→5 coding (1047/1404 nt) fumC ← fumarate hydratase (fumarase C),aerobic Class II
RA 1,691,192 G→A Q447Q (CAG→CAA)  ydgA → DUF945 family protein
RA 1,696,452 (A)5→4 intergenic (‑381/+10) uidA ← / ← uidR beta‑D‑glucuronidase/transcriptional repressor
RA 1,700,201 (T)5→6 coding (847/1593 nt) malX → maltose and glucose‑specific PTS enzyme IIB component and IIC component
RA 1,709,163 T→C S8P (TCC→CCC)  rsxD → SoxR iron‑sulfur cluster reduction factor component, putative membrane protein of electron transport complex
RA 1,712,518 (C)6→7 intergenic (+360/‑251) nth → / → dtpA DNA glycosylase and apyrimidinic (AP) lyase (endonuclease III)/dipeptide and tripeptide permease A
RA 1,714,326 (T)9→8 intergenic (+55/‑51) dtpA → / → gstA dipeptide and tripeptide permease A/glutathionine S‑transferase
RA 1,719,058 G→A P182L (CCG→CTG)  anmK ← anhydro‑N‑acetylmuramic acid kinase
RA 1,726,622 G→A *200* (TAG→TAA)  nemR → transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated
RA 1,733,703 G→A *1539* (TAG→TAA)  lhr → putative ATP‑dependent helicase
RA 1,735,484 T→C V36A (GTC→GCC)  sodB → superoxide dismutase, Fe
RA 1,742,575 G→A intergenic (+14/+26) cfa → / ← ribC cyclopropane fatty acyl phospholipid synthase, SAM‑dependent/riboflavin synthase, alpha subunit
RA 1,744,740 C→T G428G (GGC→GGT)  mdtK → multidrug efflux system transporter
RA 1,757,006 G→A A437T (GCT→ACT)  pykF → pyruvate kinase I
RA 1,757,721 C→T *335* (TAG→TAA)  ldtE ← murein L,D‑transpeptidase
MC JC 1,757,753 Δ5 bp coding (969‑973/1005 nt) ldtE ← murein L,D‑transpeptidase
RA 1,759,680 (C)5→6 coding (844/1221 nt) sufS ← cysteine desulfurase, stimulated by SufE, selenocysteine lyase, PLP‑dependent
RA 1,761,518 G→A R92C (CGT→TGT)  sufD ← component of SufBCD Fe‑S cluster assembly scaffold
RA 1,763,987 Δ1 bp coding (23/1488 nt) sufB ← component of SufBCD Fe‑S cluster assembly scaffold
RA 1,764,018 C→T *123* (TAG→TAA)  sufA ← Fe‑S cluster assembly protein
RA 1,769,478 (G)7→8 coding (405/1113 nt) ydiK → UPF0118 family inner membrane protein
RA 1,781,964 C→G G190G (GGC→GGG)  ydiS → putative oxidoreductase
RA 1,788,278 G→A *278* (TAG→TAA)  ppsR → PEP synthase kinase and PEP synthase pyrophosphorylase
RA 1,789,804 G→A *64* (TAG→TAA)  ydiE → hemin uptake protein HemP homolog
RA 1,792,267 C→T *155* (TAG→TAA)  nlpC ← putative C40 clan peptidase lipoprotein
RA 1,794,172 C→T *327* (TAG→TAA)  btuC ← vitamin B12 ABC transporter permease
RA 1,799,883 T→C K39K (AAA→AAG)  rpmI ← 50S ribosomal subunit protein L35
RA 1,803,567 G→A pseudogene (50/1476 nt) arpB → pseudogene, ankyrin repeats
RA 1,819,569 A→G G79G (GGT→GGC)  chbA ← N,N'‑diacetylchitobiose‑specific enzyme IIA component of PTS
RA 1,821,867 (A)8→7 intergenic (‑248/+51) chbB ← / ← osmE N,N'‑diacetylchitobiose‑specific enzyme IIB component of PTS/osmotically‑inducible lipoprotein
RA 1,826,546 T→C E126E (GAA→GAG)  astE ← succinylglutamate desuccinylase
RA 1,834,111 G→A *237* (TAG→TAA)  ydjX → TVP38/TMEM64 family inner membrane protein
RA 1,841,897 G→A *136* (TAG→TAA) 
T80I (ACT→ATT) 
nudG →
ynjH ←
CTP pyrophosphohydrolase, also hydrolyzes 2‑hydroxy‑dATP, 8‑hydroxy‑dGTP, 5‑hydroxy‑CTP, dCTP and 5‑methyl‑dCTP
DUF1496 family protein
RA 1,850,810 (C)5→4 intergenic (+117/‑50) sppA → / → ansA protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA 1,862,634 A→G intergenic (‑205/‑137) msrB ← / → gapA methionine sulfoxide reductase B/glyceraldehyde‑3‑phosphate dehydrogenase A
RA 1,863,004 T→C R78R (CGT→CGC)  gapA → glyceraldehyde‑3‑phosphate dehydrogenase A
RA 1,869,022 (T)6→5 coding (68/1284 nt) yeaH → UPF0229 family protein
RA 1,874,078 C→T *35* (TAG→TAA)  yoaI ← uncharacterized protein
RA 1,874,798 G→A *149* (TAG→TAA) 
T260I (ACT→ATT) 
yeaL →
yeaM ←
UPF0756 family putative inner membrane protein
putative DNA‑binding transcriptional regulator
RA 1,875,056 (C)6→5 coding (521/822 nt) yeaM ← putative DNA‑binding transcriptional regulator
RA 1,881,463 G→A A116V (GCG→GTG)  dmlR ← transcriptional activator of dmlA
RA 1,886,810 G→A *322* (TAG→TAA)  yeaX → putative YeaWX dioxygenase beta subunit, reductase component
RA 1,892,402 A→G S278S (AGT→AGC)  yoaA ← putative ATP‑dependent helicase, DinG family
RA 1,905,805 G→A G40S (GGC→AGC)  mntP → putative Mn(2+) efflux pump, mntR‑regulated
RA 1,910,474 T→C S67P (TCC→CCC)  yebQ → putative transporter
RA 1,920,205 (T)7→8 intergenic (+62/‑18) yebT → / → rsmF MCE domain protein/16S rRNA m(5)C1407 methyltransferase, SAM‑dependent
RA 1,926,096 G→A *219* (TAG→TAA)  yobB → C‑N hydrolase family protein
RA 1,926,782 G→A *221* (TAG→TAA) 
D686D (GAC→GAT) 
exoX →
ptrB ←
exodeoxyribonuclease 10, DNA exonuclease X
protease II
RA 1,939,673 T→C N174S (AAC→AGC)  lpxM ← myristoyl‑acyl carrier protein (ACP)‑dependent acyltransferase
RA 1,942,993 G→A G111E (GGG→GAG)  znuC → zinc ABC transporter ATPase
RA 1,950,559 (C)5→6 intergenic (‑37/‑273) aspS ← / → yecD aspartyl‑tRNA synthetase/isochorismatase family protein
RA 1,952,661 G→A *132* (TAG→TAA)  yecN → MAPEG family inner membrane protein
RA 1,964,697 G→A L118L (CTC→CTT)  flhA ← putative flagellar export pore protein
MC JC 1,978,503 Δ776 bp insB1–insA insB1, insA
RA 1,980,188 C→T *475* (TAG→TAA)  otsA ← trehalose‑6‑phosphate synthase
RA 1,998,494 C→T *329* (TAG→TAA)  dcyD ← D‑cysteine desulfhydrase, PLP‑dependent
RA 2,012,001 C→T pseudogene (40/678 nt) yedN ← pseudogene, IpaH/YopM family
RA 2,012,700 C→T *105* (TAG→TAA)  fliE ← flagellar basal‑body component
RA 2,016,095 G→A L76L (CTG→CTA)  fliH → negative regulator of FliI ATPase activity
RA 2,021,501 G→A *138* (TAG→TAA)  fliN → flagellar motor switching and energizing component
RA 2,022,606 G→A *246* (TAG→TAA)  fliP → flagellar biosynthesis protein
RA 2,022,810 C→T A65A (GCC→GCT)  fliQ → flagellar biosynthesis protein
RA 2,022,885 G→A *90* (TAG→TAA)  fliQ → flagellar biosynthesis protein
RA 2,029,729 (C)6→5 coding (191/921 nt) yedA → amino acid exporter for phenylalanine, threonine
RA 2,034,536 G→A pseudogene (486/663 nt) yedS → pseudogene, outer membrane protein homology, putative outer membrane protein
RA 2,049,336 C→T P1467S (CCG→TCG)  yeeJ → putative adhesin
RA 2,051,158 A→G D2074G (GAC→GGC)  yeeJ → putative adhesin
RA 2,059,964 C→T *317* (TAG→TAA)  cbl ← ssuEADCB/tauABCD operon transcriptional activator
RA 2,068,952 C→T *302* (TAG→TAA)  insD1 ← IS2 transposase TnpB
RA 2,084,773 G→A G251G (GGC→GGT)  yeeE ← UPF0394 family inner membrane protein
RA 2,090,046 G→A *17* (TAG→TAA)  hisL → his operon leader peptide
RA 2,099,237 G→A A126V (GCG→GTG)  ugd ← UDP‑glucose 6‑dehydrogenase
RA 2,104,494 C→T V6I (GTC→ATC) 
*197* (TAG→TAA) 
wbbK ←
wbbJ ←
lipopolysaccharide biosynthesis protein
putative lipopolysaccharide biosynthesis O‑acetyl transferase
RA 2,114,502 C→T *465* (TAG→TAA)  wcaM ← colanic acid biosynthesis protein
RA 2,115,907 C→T *407* (TAG→TAA)  wcaL ← putative glycosyl transferase
RA 2,118,164 G→A R81C (CGT→TGT)  wcaK ← colanic acid biosynthesis protein
RA 2,130,853 C→T S9N (AGC→AAC) 
*406* (TAG→TAA) 
wcaD ←
wcaC ←
putative colanic acid polymerase
putative glycosyl transferase
RA 2,131,667 T→C D135G (GAC→GGC)  wcaC ← putative glycosyl transferase
RA 2,139,759 C→T *618* (TAG→TAA)  asmA ← suppressor of OmpF assembly mutants, putative outer membrane protein assembly factor, inner membrane‑anchored periplasmic protein
RA 2,149,963 G→T G341G (GGC→GGA)  yegI ← protein kinase‑related putative non‑specific DNA‑binding protein
RA 2,152,876 G→A P85S (CCG→TCG)  yegL ← VMA domain protein
RA 2,161,529 G→A Q22Q (CAG→CAA)  iceT → putative citrate/iron‑citrate/zinc‑citrate efflux transporter
RA 2,163,207 A→G D111G (GAT→GGT)  baeS → sensory histidine kinase in two‑component regulatory system with BaeR
RA 2,164,998 G→A *241* (TAG→TAA)  baeR → response regulator in two‑component regulatory system with BaeS
RA 2,169,693 C→T pseudogene (475/475 nt) gatR ← pseudogene, repressor for gat operon, interrupted by IS3, split galactitol utilization operon repressor, fragment 2, split galactitol utilization operon repressor, interrupted
RA 2,171,398 G→A *289* (TAG→TAA)  insF1 → IS3 transposase B
RA 2,173,363 Δ2 bp intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC
RA 2,179,330 T→C S170S (AGT→AGC)  yegT → nucleoside transporter, low affinity
RA 2,182,035 C→T L314L (CTA→TTA) 
*249* (TAG→TAA) 
yegV →
yegW ←
putative kinase
putative DNA‑binding transcriptional regulator
RA 2,182,061 G→A *322* (TAG→TAA) 
L241L (CTA→TTA) 
yegV →
yegW ←
putative kinase
putative DNA‑binding transcriptional regulator
RA 2,189,594 C→T A439A (GCG→GCA)  yehB ← putative outer membrane protein
RA 2,200,454 (A)8→7 coding (176/3633 nt) yehI → DUF4132 domain‑containing protein
RA 2,203,986 (A)5→6 coding (15/318 nt) yehK → uncharacterized protein
RA 2,210,944 G→A pseudogene (1845/2001 nt) yehQ → pseudogene
RA 2,214,339 (C)6→5 coding (306/1686 nt) yehU ← inner membrane putative sensory kinase in two‑component system with YehT
RA 2,218,207 C→T A117A (GCG→GCA)  yehY ← putative ABC transporter permease
RA 2,220,789 G→A R401C (CGT→TGT)  bglX ← beta‑D‑glucoside glucohydrolase, periplasmic
RA 2,225,044 C→T *196* (TAG→TAA)  yohC ← Yip1 family inner membrane protein
RA 2,226,509 C→T *254* (TAG→TAA)  yohF ← putative oxidoreductase
RA 2,233,597 G→A *240* (TAG→TAA)  sanA → DUF218 superfamily vancomycin high temperature exclusion protein
RA 2,240,754 (C)5→6 coding (915/1041 nt) galS ← galactose‑ and fucose‑inducible galactose regulon transcriptional isorepressor, mgl operon transcriptional repressor, autorepressor
RA 2,244,245 G→A A112A (GCG→GCA)  yeiG → S‑formylglutathione hydrolase
RA 2,263,478 T→C V6V (GTA→GTG)  fruB ← fused fructose‑specific PTS enzymes: IIA component/HPr component
RA 2,266,013 T→C R188R (CGT→CGC)  yeiP → elongation factor P‑like protein
RA 2,274,166 A→G K601K (AAA→AAG)  yejA → microcin C ABC transporter periplasmic binding protein
RA 2,274,178 G→A *605* (TAG→TAA)  yejA → microcin C ABC transporter periplasmic binding protein
RA 2,276,298 G→A *342* (TAG→TAA)  yejE → microcin C ABC transporter permease
RA 2,276,530 G→A S77S (TCG→TCA)  yejF → microcin C ABC transporter ATPase
RA 2,288,561 (C)7→6 pseudogene (354/2525 nt) yejO ← pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system
RA 2,289,027 G→A intergenic (‑113/+38) yejO ← / ← insH1 pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system/IS5 transposase and trans‑activator
RA 2,291,973 T→C G146G (GGA→GGG)  ccmH ← heme lyase, CcmH subunit
RA 2,316,160 G→A *891* (TAG→TAA)  rcsD → phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA 2,317,027 C→T *950* (TAG→TAA)  rcsC ← hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA 2,318,019 G→A R620C (CGT→TGT)  rcsC ← hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA 2,334,336 C→T pseudogene (67/4605 nt)
*208* (TAG→TAA) 
yfaS ←
yfaT ←
pseudogene, bacterial alpha2‑macroglobulin YfaS variant family, putative membrane protein
DUF1175 family protein, putative host defense protein
RA 2,350,162 A→G L284L (TTG→CTG)  glpQ ← periplasmic glycerophosphodiester phosphodiesterase
RA 2,358,163 G→A A228V (GCG→GTG)  rhmA ← 2‑keto‑3‑deoxy‑L‑rhamnonate aldolase
RA 2,370,019 T→C *661R (TGA→CGA) 
M1T (ATG→ACG) †
arnA →
arnD →
fused UDP‑L‑Ara4N formyltransferase/UDP‑GlcA C‑4'‑decarboxylase
undecaprenyl phosphate‑alpha‑L‑ara4FN deformylase
RA 2,379,348 C→T *432* (TAG→TAA)  menF ← isochorismate synthase 2
RA 2,414,699 T→C intergenic (+27/‑48) ackA → / → pta acetate kinase A and propionate kinase 2/phosphate acetyltransferase
RA 2,416,763 2 bp→TC coding (2017‑2018/2145 nt) pta → phosphate acetyltransferase
RA 2,438,548 T→C V200A (GTG→GCG)  flk → putative flagella assembly protein
RA 2,449,228 C→T *274* (TAG→TAA)  yfcO ← DUF2544 family putative outer membrane protein
RA 2,453,265 C→T pseudogene (1737/2646 nt) yfcU ← pseudogene, FimD fimbrial export usher family,putative membrane, Not classified, putative outer membrane protein
RA 2,462,889 (C)9→8 intergenic (+243/‑123) fadL → / → yfdF long‑chain fatty acid outer membrane transporter/uncharacterized protein
RA 2,468,106 T→C A84A (GCT→GCC)  gtrA → CPS‑53 (KpLE1) prophage, bactoprenol‑linked glucose translocase/flippase
RA 2,471,105 G→A pseudogene (291/291 nt)
P138L (CCT→CTT) 
tfaS →
yfdK ←
pseudogene, CPS‑53 (KpLE1) prophage, tail fiber assembly protein fragment,Phage or Prophage Related
CPS‑53 (KpLE1) prophage, conserved protein
RA 2,478,092 A→G V82V (GTA→GTG)  dsdX → D‑serine transporter
RA 2,484,897 (C)6→7 coding (524/3594 nt) evgS → hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA 2,494,950 T→C Y85H (TAT→CAT)  ypdI → putative lipoprotein involved in colanic acid biosynthesis
RA 2,494,973 G→A *92* (TAG→TAA)  ypdI → putative lipoprotein involved in colanic acid biosynthesis
RA 2,495,050 C→T *81* (TAG→TAA)  yfdY ← DUF2545 family putative inner membrane protein
RA 2,504,391 T→C E32G (GAA→GGA)  fryA ← putative PTS enzyme: Hpr, enzyme I and IIA components
RA 2,510,111 G→A G161D (GGC→GAC)  yfeO → putative ion channel protein
RA 2,510,886 G→A *419* (TAG→TAA)  yfeO → putative ion channel protein
RA 2,511,468 C→T *413* (TAG→TAA)  mntH ← manganese/divalent cation transporter
RA 2,521,593 C→T *295* (TAG→TAA)  xapR ← transcriptional activator of xapAB
RA 2,521,852 T→C D209G (GAT→GGT)  xapR ← transcriptional activator of xapAB
MC JC 2,525,917 Δ9 bp intergenic (+26/+5) yfeN → / ← yfeR putative outer membrane protein/transcriptional regulator of yefH
RA 2,525,930 C→T *309* (TAG→TAA)  yfeR ← transcriptional regulator of yefH
RA 2,534,031 T→C intergenic (+10/‑35) ptsH → / → ptsI phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)/PEP‑protein phosphotransferase of PTS system (enzyme I)
RA 2,552,094 G→A I15I (ATC→ATT)  ypeA ← GNAT family putative N‑acetyltransferase
RA 2,574,135 G→A D57D (GAC→GAT)  eutT ← cobalamin adenosyltransferase involved in ethanolamine utilization
RA 2,589,535 C→T I647I (ATC→ATT)  acrD → aminoglycoside/multidrug efflux system
RA 2,591,603 G→A *119* (TAG→TAA)  yffB → putative ArsC family reductase
RA 2,595,227 T→C Q211Q (CAA→CAG)  tmcA ← elongator methionine tRNA (ac4C34) acetyltransferase
RA 2,600,609 (C)5→6 coding (132/471 nt) bcp → peroxiredoxin, thiol peroxidase, thioredoxin‑dependent
MC JC 2,614,614 Δ3 bp coding (681‑683/849 nt) focB → putative formate transporter
RA 2,618,075 C→T *234* (TAG→TAA)  hda ← ATPase regulatory factor involved in DnaA inactivation
RA 2,621,307 A→G E37E (GAA→GAG)  purM → phosphoribosylaminoimidazole synthetase
RA 2,629,481 G→A *64* (TAG→TAA)  yfgG → uncharacterized protein
RA 2,637,295 C→T R21H (CGT→CAT)  der ← GTPase, multicopy suppressor of ftsJ
RA 2,645,013 C→T *771* (TAG→TAA)  pbpC ← penicillin‑insensitive murein repair transglycosylase, inactive transpeptidase domain protein
RA 2,655,767 T→C T198A (ACT→GCT)  pepB ← aminopeptidase B
RA 2,673,768 G→A *141* (TAG→TAA)  yphA → DoxX family inner membrane protein
RA 2,682,157 (C)7→8 coding (589/3282 nt) yphG ← DUF4380 domain‑containing TPR repeat protein
RA 2,684,971 G→A G179G (GGC→GGT)  glyA ← serine hydroxymethyltransferase
RA 2,685,561 T→C intergenic (‑54/‑274) glyA ← / → hmp serine hydroxymethyltransferase/fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA 2,685,910 G→A A26T (GCC→ACC)  hmp → fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA 2,697,915 C→T *212* (TAG→TAA)  pgpC ← phosphatidylglycerophosphatase C, membrane bound
RA 2,713,568 T→C W225R (TGG→CGG)  srmB → ATP‑dependent RNA helicase
RA 2,721,193 C→T A414V (GCA→GTA)  pka → protein lysine acetyltransferase
RA 2,723,065 G→A A113A (GCG→GCA)  pssA → phosphatidylserine synthase, CDP‑diacylglycerol‑serine O‑phosphatidyltransferase
RA 2,724,448 C→T H107H (CAC→CAT) 
*433* (TAG→TAA) 
yfiM →
kgtP ←
putative lipoprotein
alpha‑ketoglutarate transporter
RA 2,737,495 G→A *114* (TAG→TAA)  raiA → cold shock protein associated with 30S ribosomal subunit
RA 2,742,962 G→A D194N (GAT→AAT)  yfiN → putative membrane‑anchored diguanylate cyclase
RA 2,765,829 (C)5→4 intergenic (‑53/‑89) yfjM ← / → rnlA CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, RNase LS
RA 2,767,445 (C)7→8 intergenic (+90/‑265) rnlB → / → yfjP CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, 50S ribosome‑binding GTPase family protein
RA 2,769,486 G→A *274* (TAG→TAA)  yfjQ → CP4‑57 prophage, uncharacterized protein
RA 2,769,648 (C)6→5 intergenic (+162/‑55) yfjQ → / → yfjR CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, putative DNA‑binding transcriptional regulator
RA 2,770,404 G→A *234* (TAG→TAA)  yfjR → CP4‑57 prophage, putative DNA‑binding transcriptional regulator
RA 2,781,132 T→C D532G (GAC→GGC)  ypjA ← adhesin‑like autotransporter
RA 2,782,393 (C)5→4 coding (334/4581 nt) ypjA ← adhesin‑like autotransporter
RA 2,784,529 C→T pseudogene (483/1374 nt) ypjC ← pseudogene
RA 2,786,729 G→A pseudogene (333/2253 nt) ygaQ → uncharacterized protein, putative enzyme
RA 2,786,746 Δ1 bp pseudogene (350/2253 nt) ygaQ → uncharacterized protein, putative enzyme
RA 2,787,434 G→A pseudogene (1038/2253 nt) ygaQ → uncharacterized protein, putative enzyme
RA 2,788,238 G→A pseudogene (1842/2253 nt) ygaQ → uncharacterized protein, putative enzyme
RA 2,794,015 G→A *427* (TAG→TAA)  gabT → 4‑aminobutyrate aminotransferase, PLP‑dependent
RA 2,796,146 C→T A158V (GCG→GTG)  csiR → transcriptional repressor of csiD
RA 2,796,337 C→T *150* (TAG→TAA)  ygaU ← uncharacterized protein
RA 2,796,916 T→C Y38C (TAT→TGT)  yqaE ← cyaR sRNA‑regulated protein
RA 2,800,475 G→A *110* (TAG→TAA)  ygaM → putative membrane‑anchored DUF883 family ribosome‑binding protein
RA 2,814,218 C→T *172* (TAG→TAA)  luxS ← S‑ribosylhomocysteine lyase
RA 2,824,491 C→T *362* (TAG→TAA)  mltB ← membrane‑bound lytic murein transglycosylase B
RA 2,824,496 Δ1 bp coding (1081/1086 nt) mltB ← membrane‑bound lytic murein transglycosylase B
RA 2,827,351 G→A *320* (TAG→TAA)  srlE → glucitol/sorbitol‑specific enzyme IIB component of PTS
RA 2,835,045 G→A *378* (TAG→TAA)  norW → NADH:flavorubredoxin oxidoreductase
RA 2,839,384 T→A intergenic (‑120/‑140) ascG ← / → ascF asc operon transcriptional repressor, prpBC operon repressor/cellobiose/arbutin/salicin‑specific PTS enzymes, IIB and IC components
RA 2,842,414 G→A *475* (TAG→TAA)  ascB → cryptic 6‑phospho‑beta‑glucosidase
RA 2,842,573 C→T *157* (TAG→TAA)  hycI ← protease involved in processing C‑terminal end of HycE
RA 2,851,873 G→A *291* (TAG→TAA) 
G4S (GGC→AGC) 
hypB →
hypC →
GTP hydrolase involved in nickel liganding into hydrogenases
hydrogenase maturation protein
RA 2,856,453 C→T *118* (TAG→TAA)  ygbA ← uncharacterized protein
RA 2,859,538 C→T L816L (CTG→TTG)  mutS → methyl‑directed mismatch repair protein
RA 2,860,416 G→A *219* (TAG→TAA)  pphB → serine/threonine‑specific protein phosphatase 2
RA 2,860,426 Δ1 bp intergenic (+10/+41) pphB → / ← ygbI serine/threonine‑specific protein phosphatase 2/DeoR family putative transcriptional regulator
RA 2,876,944 G→A A122T (GCC→ACC)  iap → aminopeptidase in alkaline phosphatase isozyme conversion
RA 2,893,928 G→A *424* (TAG→TAA) 
A4T (GCC→ACC) 
ygcN →
ygcO →
putative oxidoreductase
putative 4Fe‑4S cluster‑containing protein
MC JC 2,893,961 Δ3 bp coding (43‑45/261 nt) ygcO → putative 4Fe‑4S cluster‑containing protein
RA 2,902,543 G→A G216G (GGG→GGA)  ygcE → putative kinase
RA 2,905,532 T→C intergenic (‑114/‑25) queE ← / → yqcG 7‑carboxy‑7‑deazaguanine synthase, queosine biosynthesis/membrane stress resistance protein
RA 2,910,756 C→T *112* (TAG→TAA)  mazF ← mRNA interferase toxin, antitoxin is MazE
RA 2,911,417 C→T *745* (TAG→TAA)  relA ← (p)ppGpp synthetase I/GTP pyrophosphokinase
RA 2,913,699 C→T *434* (TAG→TAA)  rlmD ← 23S rRNA m(5)U1939 methyltransferase, SAM‑dependent
RA 2,915,105 C→T P17S (CCG→TCG)  barA → hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
RA 2,935,917 G→A G112S (GGC→AGC)  fucI → L‑fucose isomerase
RA 2,936,931 T→C F450L (TTC→CTC)  fucI → L‑fucose isomerase
RA 2,937,802 A→G D112G (GAC→GGC)  fucK → L‑fuculokinase
RA 2,962,441 C→T *108* (TAG→TAA)  ppdC ← putative prepilin peptidase‑dependent protein
RA 2,966,188 C→T *749* (TAG→TAA)  ptsP ← PEP‑protein phosphotransferase enzyme I, GAF domain containing protein
RA 2,967,135 G→A R434C (CGT→TGT)  ptsP ← PEP‑protein phosphotransferase enzyme I, GAF domain containing protein
RA 2,970,351 G→A *230* (TAG→TAA)  mutH → methyl‑directed mismatch repair protein
RA 2,979,943 C→T A308V (GCT→GTT) 
*231* (TAG→TAA) 
lysR →
ygeA ←
transcriptional activator of lysA, autorepressor
Asp/Glu_racemase family protein
RA 2,983,288 C→T *279* (TAG→TAA)  kduI ← hexuronate isomerase
RA 2,984,411 C→T *394* (TAG→TAA)  yqeF ← short chain acyltransferase
RA 2,993,856 G→A *73* (TAG→TAA)  ygeI → uncharacterized protein
RA 2,994,415 G→A pseudogene (34/60 nt) pbl → pseudogene, peptidoglycan‑binding enzyme family
RA 2,995,314 C→T pseudogene (447/447 nt) ygeN ← pseudogene, orgB family, part of T3SS PAI ETT2 remnant
RA 2,996,372 C→T *302* (TAG→TAA)  insD1 ← IS2 transposase TnpB
RA 2,997,689 C→T intergenic (‑89/+3) insC1 ← / ← ygeQ IS2 repressor TnpA/pseudogene, glycosyl hydrolase family 15, part of T3SS PAI ETT2 remnant
RA 3,001,304 (G)7→8 coding (960/2259 nt) xdhA → xanthine dehydrogenase, molybdenum binding subunit
RA 3,012,553 Δ1 bp intergenic (+160/+61) yqeA → / ← yqeB putative amino acid kinase/XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold
RA 3,014,259 Δ1 bp intergenic (‑20/+28) yqeB ← / ← yqeC XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold/putative selenium‑dependent hydroxylase accessory protein
RA 3,014,287 C→T *257* (TAG→TAA)  yqeC ← putative selenium‑dependent hydroxylase accessory protein
RA 3,015,738 G→A *193* (TAG→TAA)  mocA → CTP:molybdopterin cytidylyltransferase
RA 3,032,032 G→A S222S (TCG→TCA)  uacT → uric acid permease
RA 3,036,373 C→T *578* (TAG→TAA)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,056,273 G→A P11P (CCG→CCA)  fau → 5‑formyltetrahydrofolate cyclo‑ligase family protein
RA 3,059,293 T→C G11G (GGA→GGG)  rpiA ← ribose 5‑phosphate isomerase, constitutive
RA 3,061,202 A→G N118S (AAC→AGC)  scpA → methylmalonyl‑CoA mutase
RA 3,068,173 C→T *212* (TAG→TAA)  argO ← arginine transporter
RA 3,073,474 T→C D73G (GAC→GGC)  epd ← D‑erythrose 4‑phosphate dehydrogenase
RA 3,082,038 T→C D42D (GAT→GAC)  loiP → Phe‑Phe periplasmic metalloprotease, OM lipoprotein, low salt‑inducible, Era‑binding heat shock protein
RA 3,083,620 G→A R60C (CGT→TGT)  speB ← agmatinase
RA 3,085,461 A→G S151P (TCC→CCC)  speA ← biosynthetic arginine decarboxylase, PLP‑binding
RA 3,094,234 T→C T283A (ACA→GCA)  yggR ← putative PilT family AAA+ ATPase
RA 3,096,673 G→A *97* (TAG→TAA)  yggU → UPF0235 family protein
RA 3,101,039 (C)7→8 coding (585/720 nt) yggN ← DUF2884 family putative periplasmic protein
RA 3,104,065 G→A *351* (TAG→TAA)  mutY → adenine DNA glycosylase
RA 3,129,036 G→A *255* (TAG→TAA)  glcC → glycolate‑inducible glc operon transcriptional repressor, autorepressor
RA 3,131,341 C→T *356* (TAG→TAA)  yghQ ← putative inner membrane polysaccharide flippase
RA 3,134,811 Δ1 bp coding (681/693 nt) yghT → putative ATP‑binding protein
RA 3,134,823 G→A *231* (TAG→TAA)  yghT → putative ATP‑binding protein
RA 3,140,294 T→C S9G (AGC→GGC)  hybF ← protein involved with the maturation of hydrogenases 1 and 2
RA 3,162,308 G→A S121L (TCG→TTG)  ftsP ← septal ring component that protects the divisome from stress, multicopy suppressor of ftsI(Ts)
RA 3,171,879 C→T *111* (TAG→TAA)  ygiZ ← inner membrane protein
RA 3,176,721 G→A T38I (ACC→ATC)  cpdA ← 3',5' cAMP phosphodiesterase
RA 3,176,858 C→T *141* (TAG→TAA)  yqiB ← DUF1249 protein YqiB
RA 3,178,015 G→A intergenic (‑105/‑100) nudF ← / → tolC ADP‑ribose pyrophosphatase/transport channel
RA 3,183,006 G→A G153S (GGT→AGT)  zupT → zinc transporter
RA 3,187,415 G→A *302* (TAG→TAA)  insD1 → IS2 transposase TnpB
RA 3,187,588 G→A pseudogene (162/2439 nt) yqiG → pseudogene, fimbrial export usher family,putative membrane, Not classified, putative membrane protein
RA 3,191,696 G→A *355* (TAG→TAA)  yqiI → fimbrial protein
RA 3,199,429 T→C A71A (GCA→GCG)  glnE ← fused deadenylyltransferase/adenylyltransferase for glutamine synthetase
RA 3,205,324 C→T *311* (TAG→TAA)  ttdR ← transcriptional activator of ttdABT
RA 3,218,365 C→T E238K (GAG→AAG)  aer ← fused signal transducer for aerotaxis sensory component/methyl accepting chemotaxis component
RA 3,220,190 G→A A233T (GCT→ACT)  patA → putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent
RA 3,238,562 (T)7→6 intergenic (+265/‑18) ygjR → / → alx putative NAD(P)‑dependent dehydrogenase/putative membrane‑bound redox modulator
RA 3,240,587 A→G Y215C (TAC→TGC)  sstT → sodium:serine/threonine symporter
RA 3,240,984 (G)7→9 coding (1041/1245 nt) sstT → sodium:serine/threonine symporter
RA 3,248,939 T→C intergenic (+117/‑30) mzrA → / → yqjC modulator of EnvZ/OmpR regulon/DUF1090 family putative periplasmic protein
RA 3,255,020 G→A *234* (TAG→TAA)  yhaK → redox‑sensitive bicupin
RA 3,257,675 G→A G112G (GGC→GGT)  yhaO ← putative transporter
RA 3,266,127 C→T *313* (TAG→TAA)  tdcA ← tdc operon transcriptional activator
RA 3,269,012 A→G S200G (AGT→GGT)  yhaC → pentapetide repeats‑related protein
RA 3,269,602 G→A *396* (TAG→TAA)  yhaC → pentapetide repeats‑related protein
RA 3,271,932 T→C T274A (ACG→GCG)  garR ← tartronate semialdehyde reductase
RA 3,277,726 C→T F130F (TTC→TTT)  yhaV → toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system
RA 3,277,867 C→T V267I (GTC→ATC)  agaR ← transcriptional repressor of the aga regulon
RA 3,296,984 G→A *192* (TAG→TAA)  yraP → outer membrane lipoprotein
RA 3,298,035 T→C E35G (GAA→GGA)  yraQ ← putative inner membrane permease
RA 3,299,438 A→G T155T (ACA→ACG)  yhbO → stress‑resistance protein
RA 3,299,999 G→A A12T (GCC→ACC)  yhbQ → GIY‑YIG nuclease superfamily protein
RA 3,301,599 G→A G39S (GGC→AGC)  yhbU → U32 peptidase family protein
RA 3,303,529 C→T H28Y (CAC→TAC)  yhbW → putative luciferase‑like monooxygenase
RA 3,304,455 G→A *336* (TAG→TAA)  yhbW → putative luciferase‑like monooxygenase
RA 3,308,040 C→T *295* (TAG→TAA)  nlpI ← lipoprotein involved in osmotic sensitivity and filamentation
RA 3,308,868 G→A C19C (TGC→TGT)  nlpI ← lipoprotein involved in osmotic sensitivity and filamentation
RA 3,309,006 (C)6→5 intergenic (‑82/+27) nlpI ← / ← pnp lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA 3,309,007 G→A intergenic (‑83/+26) nlpI ← / ← pnp lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA 3,320,333 T→C E427E (GAA→GAG)  yhbX ← putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA 3,330,357 +T coding (1395/1434 nt) dacB → D‑alanyl‑D‑alanine carboxypeptidase
RA 3,330,396 G→A *478* (TAG→TAA)  dacB → D‑alanyl‑D‑alanine carboxypeptidase
RA 3,340,588 T→C L105S (TTA→TCA)  yrbG → putative calcium/sodium:proton antiporter
RA 3,347,069 G→A *164* (TAG→TAA)  ptsN → sugar‑specific enzyme IIA component of PTS
RA 3,353,121 C→T *310* (TAG→TAA)  yhcC ← putative Fe‑S oxidoreductase, Radical SAM superfamily protein
RA 3,360,769 G→A intergenic (+153/‑407) gltD → / → gltF glutamate synthase, 4Fe‑4S protein, small subunit/periplasmic protein
RA 3,365,664 G→A intergenic (+113/+38) yhcE → / ← insH1 pseudogene fragment, interrupted by IS5/IS5 transposase and trans‑activator
RA 3,366,953 G→A G10R (GGA→AGA)  yhcF → putative transcriptional regulator
RA 3,372,254 G→A G107G (GGC→GGT)  nanT ← sialic acid transporter
RA 3,385,857 C→T *91* (TAG→TAA)  yhcO ← putative barnase inhibitor
RA 3,398,875 C→T M1M (GTG→ATG) †
*368* (TAG→TAA) 
mreD ←
mreC ←
cell wall structural complex MreBCD transmembrane component MreD
cell wall structural complex MreBCD transmembrane component MreC
RA 3,400,773 A→G R105R (CGT→CGC)  mreB ← cell wall structural complex MreBCD, actin‑like component MreB
RA 3,410,406 T→C S43P (TCT→CCT)  dusB → tRNA‑dihydrouridine synthase B
RA 3,418,548 T→C A53A (GCT→GCC)  yhdV → putative outer membrane protein
RA 3,432,994 (C)6→7 coding (567/1125 nt) smf ← DNA recombination‑mediator A family protein
RA 3,434,577 G→A A122T (GCA→ACA)  fmt → 10‑formyltetrahydrofolate:L‑methionyl‑tRNA(fMet) N‑formyltransferase
RA 3,439,141 C→T *123* (TAG→TAA)  yhdN ← DUF1992 family protein
RA 3,440,950 G→A T27I (ACC→ATC)  rpoA ← RNA polymerase, alpha subunit
RA 3,457,616 G→A A414T (GCC→ACC)  gspD → general secretory pathway component, cryptic
RA 3,466,313 A→G L138P (CTT→CCT)  bfr ← bacterioferritin, iron storage and detoxification protein
RA 3,478,592 C→T *67* (TAG→TAA)  yheV ← DUF2387 family putative metal‑binding protein
RA 3,478,802 C→T *602* (TAG→TAA)  kefB ← potassium:proton antiporter
RA 3,482,967 T→C L560P (CTG→CCG)  yheS → ABC‑F family protein predicted regulatory ATPase
RA 3,503,952 G→A *262* (TAG→TAA)  frlD → fructoselysine 6‑kinase
RA 3,507,942 A→G Y217H (TAC→CAC)  php ← phosphotriesterase homology protein
RA 3,508,454 Δ1 bp coding (137/879 nt) php ← phosphotriesterase homology protein
RA 3,515,726 T→C Y63C (TAT→TGT)  dam ← DNA adenine methyltransferase
RA 3,516,104 T→C K401K (AAA→AAG)  damX ← cell division protein that binds to the septal ring
RA 3,531,605 T→C T279A (ACA→GCA)  yhgE ← DUF4153 family putative inner membrane protein
RA 3,534,656 C→T G405R (GGG→AGG)  envZ ← sensory histidine kinase in two‑component regulatory system with OmpR
RA 3,544,074 C→T *257* (TAG→TAA)  bioH ← pimeloyl‑ACP methyl ester carboxylesterase
RA 3,545,565 G→A *228* (TAG→TAA)  gntX → DNA catabolic protein
RA 3,547,986 C→T *695* (TAG→TAA)  malQ ← 4‑alpha‑glucanotransferase (amylomaltase)
RA 3,556,033 A→G Y273H (TAC→CAC)  rtcA ← RNA 3'‑terminal phosphate cyclase
RA 3,560,455 +G intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon
RA 3,566,600 C→T *478* (TAG→TAA)  glgA ← glycogen synthase
RA 3,567,251 C→T L261L (TTG→TTA)  glgA ← glycogen synthase
RA 3,583,454 G→A intergenic (+36/‑29) yrhA → / → insA pseudogene, interrupted by IS1E/IS1 repressor TnpA
RA 3,587,370 C→T T143I (ACT→ATT) 
*248* (TAG→TAA) 
yhhA →
ugpQ ←
DUF2756 family protein
glycerophosphodiester phosphodiesterase, cytosolic
RA 3,587,389 G→A P242L (CCG→CTG)  ugpQ ← glycerophosphodiester phosphodiesterase, cytosolic
RA 3,589,820 T→C S70G (AGC→GGC)  ugpE ← sn‑glycerol‑3‑phosphate ABC transporter permease
RA 3,598,557 A→G *368Q (TAA→CAA)  livJ ← branched‑chain amino acid ABC transporter periplasmic binding protein
RA 3,614,092 T→C I142I (ATT→ATC)  nikA → nickel/heme ABC transporter periplasmic binding protein
RA 3,643,899 G→A G428G (GGC→GGT)  prlC ← oligopeptidase A
RA 3,652,144 G→A intergenic (+113/+38) yhiS → / ← insH1 pseudogene/IS5 transposase and trans‑activator
RA 3,658,893 G→A *176* (TAG→TAA)  gadE → gad regulon transcriptional activator
RA 3,664,363 (G)6→7 coding (256/729 nt) gadW ← transcriptional activator of gadA and gadBC, repressor of gadX
RA 3,664,986 C→T *275* (TAG→TAA)  gadX ← acid resistance regulon transcriptional activator, autoactivator
RA 3,683,630 C→T *663* (TAG→TAA)  yhjK ← cyclic‑di‑GMP phosphodiesterase
RA 3,694,840 G→A H133Y (CAT→TAT)  bcsA ← cellulose synthase, catalytic subunit
RA 3,695,997 C→T *63* (TAG→TAA)  yhjR ← DUF2629 family protein
RA 3,709,561 (C)6→7 coding (915/1692 nt) eptB ← KDO phosphoethanolamine transferase, Ca(2+)‑inducible
RA 3,719,768 G→A *97* (TAG→TAA)  yiaG → HTH_CROC1 family putative transcriptional regulator
RA 3,731,980 G→A G284S (GGT→AGT)  xylF → D‑xylose transporter subunit
RA 3,732,319 G→A G40E (GGG→GAG)  xylG → D‑xylose ABC transporter dual domain ATPase
RA 3,736,157 G→A *393* (TAG→TAA)  xylR → xylose divergent operon transcriptional activator
RA 3,736,160 +A intergenic (+3/+193) xylR → / ← bax xylose divergent operon transcriptional activator/putative glucosaminidase
RA 3,742,599 Δ1 bp intergenic (‑67/‑134) yiaJ ← / → yiaK transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
RA 3,750,092 G→A *287* (TAG→TAA) 
E3K (GAG→AAG) 
sgbU →
sgbE →
putative L‑xylulose 5‑phosphate 3‑epimerase
L‑ribulose‑5‑phosphate 4‑epimerase
RA 3,761,850 C→T A36T (GCG→ACG)  yibF ← glutathione S‑transferase homolog
RA 3,766,316 G→A *1378* (TAG→TAA)  rhsA → Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor
RA 3,767,179 G→A *281* (TAG→TAA)  yibA → putative immunity protein for polymorphic toxin RhsA, HEAT‑domain protein, lethality reduction protein
RA 3,773,602 T→C V441A (GTT→GCT)  mtlA → mannitol‑specific PTS enzyme: IIA, IIB and IIC components
RA 3,781,017 G→A *397* (TAG→TAA)  lldD → L‑lactate dehydrogenase, FMN‑linked
RA 3,781,688 G→A *158* (TAG→TAA)  trmL → tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent
RA 3,783,086 G→A G192G (GGC→GGT)  gpsA ← glycerol‑3‑phosphate dehydrogenase (NAD+)
RA 3,789,047 C→T A316V (GCT→GTT) 
*345* (TAG→TAA) 
yibQ →
waaH ←
putative polysaccharide deacetylase
LPS(HepIII)‑glucuronic acid glycosyltransferase
RA 3,789,352 G→A R244C (CGC→TGC)  waaH ← LPS(HepIII)‑glucuronic acid glycosyltransferase
RA 3,789,683 C→T W133* (TGG→TGA)  waaH ← LPS(HepIII)‑glucuronic acid glycosyltransferase
RA 3,789,913 C→T A57T (GCA→ACA)  waaH ← LPS(HepIII)‑glucuronic acid glycosyltransferase
RA 3,792,826 C→T *286* (TAG→TAA)  yibB ← YibB family protein, function unknown
RA 3,804,410 C→G R236P (CGT→CCT)  waaS ← lipopolysaccharide rhamnose:KdoIII transferase, lipopolysaccharide core biosynthesis protein
RA 3,810,304 G→A *160* (TAG→TAA)  coaD → pantetheine‑phosphate adenylyltransferase
RA 3,815,811 C→T intergenic (‑43/+23) pyrE ← / ← rph orotate phosphoribosyltransferase/ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH
RA 3,815,863 C→T pseudogene (19/48 nt) rph ← ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH
RA 3,818,584 G→A *275* (TAG→TAA)  dinD → DNA damage‑inducible protein
RA 3,819,488 C→T H205H (CAC→CAT) 
*561* (TAG→TAA) 
yicG →
ligB ←
UPF0126 family inner membrane protein
DNA ligase, NAD(+)‑dependent
RA 3,838,137 G→A *395* (TAG→TAA)  setC → putative arabinose efflux transporter
RA 3,842,455 C→T *445* (TAG→TAA)  adeQ ← adenine permease, high affinity, adenine:H+ symporter
RA 3,852,890 C→T *33* (TAG→TAA)  ivbL ← ilvB operon leader peptide
RA 3,855,960 C→T S4N (AGC→AAC) 
*116* (TAG→TAA) 
yidG ←
yidH ←
inner membrane protein
DUF202 family inner membrane protein
RA 3,862,497 C→T pseudogene (1107/1617 nt) glvC ← pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
RA 3,862,518 Δ1 bp pseudogene (1086/1617 nt) glvC ← pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
JC 3,862,524 Δ3 bp pseudogene (1078‑1080/1617 nt) glvC ← pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
RA 3,870,441 G→A *355* (TAG→TAA) 
G430G (GGC→GGT) 
cbrA →
dgoT ←
colicin M resistance protein, FAD‑binding protein, putative oxidoreductase
D‑galactonate transporter
RA 3,892,455 G→A A281T (GCG→ACG)  mdtL → multidrug efflux system protein
RA 3,897,050 +G coding (277/666 nt) yieH → phosphoenolpyruvate and 6‑phosphogluconate phosphatase
RA 3,897,439 G→A *222* (TAG→TAA)  yieH → phosphoenolpyruvate and 6‑phosphogluconate phosphatase
RA 3,898,609 G→A *196* (TAG→TAA)  cbrC → UPF0167 family protein
RA 3,908,514 A→G intergenic (‑148/+35) pstB ← / ← pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA 3,920,950 C→T *80* (TAG→TAA)  atpE ← F0 sector of membrane‑bound ATP synthase, subunit c
RA 3,921,515 C→T T179T (ACG→ACA)  atpB ← F0 sector of membrane‑bound ATP synthase, subunit a
RA 3,923,070 G→A A204V (GCA→GTA)  rsmG ← 16S rRNA m(7)G527 methyltransferase, SAM‑dependent, glucose‑inhibited cell‑division protein
RA 3,937,168 G→A *297* (TAG→TAA)  rbsB → D‑ribose ABC transporter periplasmic binding protein, ribose chemotaxis receptor
RA 3,939,219 G→A *331* (TAG→TAA) 
S465F (TCT→TTT) 
rbsR →
hsrA ←
transcriptional repressor of ribose metabolism
putative multidrug or homocysteine efflux system
RA 3,948,805 (G)6→7 coding (1165/1521 nt) yifB ← magnesium chelatase family protein and putative transcriptional regulator
RA 3,950,420 G→A *33* (TAG→TAA)  ilvL → ilvG operon leader peptide
RA 3,956,875 G→A *515* (TAG→TAA)  ilvA → l‑threonine dehydratase, biosynthetic, also known as threonine deaminase
RA 3,963,829 C→T R134H (CGC→CAC)  gpp ← guanosine pentaphosphatase/exopolyphosphatase
RA 3,965,088 C→T W181* (TGG→TGA)  rhlB ← ATP‑dependent RNA helicase
RA 3,970,015 T→C W329R (TGG→CGG)  wzzE → Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA 3,970,032 (G)6→8 coding (1002/1047 nt) wzzE → Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA 3,970,077 G→A *349* (TAG→TAA)  wzzE → Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA 3,976,605 T→C F110L (TTT→CTT)  wzxE → O‑antigen translocase
RA 3,980,957 (G)6→7 coding (71/1386 nt) yifK → putative APC family amino acid transporter
RA 3,984,193 G→A *412* (TAG→TAA)  aslB → putative AslA‑specific sulfatase‑maturating enzyme
RA 3,986,686 C→T *399* (TAG→TAA)  hemY ← putative protoheme IX synthesis protein
RA 3,992,054 C→T P301L (CCA→CTA)  cyaA → adenylate cyclase
RA 4,002,813 C→T *127* (TAG→TAA)  yigG ← PRK11371 family inner membrane protein
RA 4,007,693 G→A *610* (TAG→TAA)  recQ → ATP‑dependent DNA helicase
RA 4,018,760 G→A *476* (TAG→TAA)  rmuC → DNA recombination protein
RA 4,024,336 G→A *261* (TAG→TAA) 
L162L (CTC→CTT) 
tatD →
rfaH ←
quality control of Tat‑exported FeS proteins, Mg‑dependent cytoplasmic DNase
transcription antitermination protein
RA 4,054,439 A→G T280T (ACT→ACC)  glnG ← fused DNA‑binding response regulator in two‑component regulatory system with GlnL: response regulator/sigma54 interaction protein
RA 4,061,157 G→A *237* (TAG→TAA)  yihL → putative DNA‑binding transcriptional regulator
RA 4,075,454 G→A *262* (TAG→TAA)  yihW → putative transcriptional regulator for sulphoquinovose utilization
RA 4,077,469 G→A L7L (TTG→TTA)  yiiD → GNAT family putative N‑acetyltransferase
RA 4,078,438 G→A *330* (TAG→TAA)  yiiD → GNAT family putative N‑acetyltransferase
RA 4,106,320 G→A *167* (TAG→TAA)  cpxP → inhibitor of the cpx response, periplasmic adaptor protein
RA 4,112,787 C→T intergenic (+32/‑180) yiiR → / → yiiS DUF805 family putative inner membrane protein/UPF0381 family protein
RA 4,117,123 G→A R34C (CGC→TGC)  glpK ← glycerol kinase
RA 4,137,229 A→G S143S (AGT→AGC)  yijF ← DUF1287 family protein
RA 4,147,479 G→A *114* (TAG→TAA) 
T280I (ACT→ATT) 
frwD →
yijO ←
putative enzyme IIB component of PTS
AraC family putative transcriptional activator
RA 4,148,681 C→T G529S (GGC→AGC)  eptC ← LPS heptose I phosphoethanolamine transferase
RA 4,204,645 G→A *442* (TAG→TAA) 
N429N (AAC→AAT) 
zraR →
purD ←
fused DNA‑binding response regulator in two‑component regulatory system with ZraS: response regulator/sigma54 interaction protein
phosphoribosylglycinamide synthetase phosphoribosylamine‑glycine ligase
RA 4,213,680 C→T *148* (TAG→TAA)  yjaB ← GNAT‑family putative N‑acetyltransferase, acetyl coenzyme A‑binding protein
RA 4,218,815 A→G T74A (ACG→GCG)  aceK → isocitrate dehydrogenase kinase/phosphatase
RA 4,232,752 G→A A161V (GCG→GTG)  lysC ← lysine‑sensitive aspartokinase 3
RA 4,268,487 (T)7→8 intergenic (+180/+322) tyrB → / ← yjbS tyrosine aminotransferase, tyrosine‑repressible, PLP‑dependent/uncharacterized protein
RA 4,268,809 C→T *68* (TAG→TAA)  yjbS ← uncharacterized protein
RA 4,279,849 A→G intergenic (+21/‑131) ghxP → / → yjcE guanine/hypoxanthine permease, high affinity, guanine/hypoxanthine:H+ symporter/putative cation/proton antiporter
RA 4,296,381 +GC intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,297,668 C→T D567N (GAC→AAC)  fdhF ← formate dehydrogenase‑H, selenopolypeptide subunit
RA 4,302,240 A→G I280T (ATC→ACC)  mdtO ← membrane translocase (MDR) of MdtNOP efflux pump, PET family
RA 4,317,409 C→T G163S (GGC→AGC)  phnL ← ribophosphonate triphosphate synthase subunit, putative ABC transporter‑related ATPase
RA 4,324,876 A→G L97P (CTG→CCG)  phnC ← phosphonate ABC transporter ATPase
RA 4,325,152 A→G I5T (ATC→ACC)  phnC ← phosphonate ABC transporter ATPase
RA 4,331,634 C→T A378V (GCG→GTG)  proP → proline/glycine betaine transporter
RA 4,336,405 A→G S209S (AGT→AGC)  adiC ← arginine:agmatine antiporter
RA 4,346,086 A→G I414T (ATC→ACC)  fumB ← anaerobic class I fumarate hydratase (fumarase B)
RA 4,352,880 G→A *99* (TAG→TAA)  ghoS → antitoxin of GhoTS toxin‑antitoxin pair, endonuclease for ghoT mRNA
RA 4,353,081 G→A *58* (TAG→TAA)  ghoT → toxin of GhoTS toxin‑antitoxin pair, membrane‑lytic protein, stimulator of persister cell formation
RA 4,377,189 C→T H105H (CAC→CAT) 
*178* (TAG→TAA) 
sugE →
blc ←
multidrug efflux system protein
outer membrane lipoprotein cell division and growth lipocalin
RA 4,386,872 C→T A833A (GCG→GCA)  mscM ← mechanosensitive channel protein, miniconductance
RA 4,389,934 A→G Y143H (TAC→CAC)  psd ← phosphatidylserine decarboxylase
RA 4,395,058 C→T G331G (GGC→GGT)  nnr → bifunctional NAD(P)H‑hydrate repair enzyme, C‑terminal domain ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase and N‑terminal domain NAD(P)H‑hydrate epimerase
RA 4,422,793 C→T A203V (GCC→GTC)  ulaD → 3‑keto‑L‑gulonate 6‑phosphate decarboxylase
RA 4,424,386 G→A *229* (TAG→TAA)  ulaF → L‑ribulose 5‑phosphate 4‑epimerase
RA 4,424,516 C→T *92* (TAG→TAA)  yjfY ← YhcN family protein, periplasmic
RA 4,424,543 Δ1 bp coding (249/276 nt) yjfY ← YhcN family protein, periplasmic
RA 4,425,834 G→A *105* (TAG→TAA)  priB → primosomal protein N
RA 4,428,079 C→T pseudogene (386/402 nt)
*213* (TAG→TAA) 
ytfA →
ytfB ←
pseudogene, related to transcriptional regulators
OapA family protein
RA 4,433,164 C→T *287* (TAG→TAA)  qorB ← NAD(P)H:quinone oxidoreductase
RA 4,441,538 C→T *213* (TAG→TAA)  msrA ← methionine sulfoxide reductase A
RA 4,442,007 T→C E57G (GAG→GGG)  msrA ← methionine sulfoxide reductase A
RA 4,447,869 Δ1 bp coding (3758/3780 nt) tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,447,891 G→A *1260* (TAG→TAA)  tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,474,138 (A)6→7 coding (15/594 nt) bdcR → transcriptional repressor for divergent bdcA
RA 4,474,391 G→A G90S (GGC→AGC)  bdcR → transcriptional repressor for divergent bdcA
RA 4,475,562 (G)6→7 coding (126/1815 nt) yjgL → SopA‑central‑domain‑like hexapeptide repeat protein
MC JC 4,490,116 Δ11 bp intergenic (‑53/+15) yjgR ← / ← idnR DUF853 family protein with NTPase fold/transcriptional repressor, 5‑gluconate‑binding
RA 4,490,141 C→T *333* (TAG→TAA)  idnR ← transcriptional repressor, 5‑gluconate‑binding
RA 4,490,375 C→T A255A (GCG→GCA)  idnR ← transcriptional repressor, 5‑gluconate‑binding
RA 4,499,500 G→A *302* (TAG→TAA)  insD1 → IS2 transposase TnpB
RA 4,499,640 C→T pseudogene (895/942 nt) yjgX ← pseudogene fragment
RA 4,500,043 C→T pseudogene (492/942 nt) yjgX ← pseudogene fragment
RA 4,500,060 C→T pseudogene (475/942 nt) yjgX ← pseudogene fragment
RA 4,504,006 G→A intergenic (‑575/‑52) insG ← / → yjhB IS4 transposase/putative MFS transporter, membrane protein
RA 4,507,463 G→A intergenic (+12/+3) insO → / ← insI1 pseudogene, IS911 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related/IS30 transposase
RA 4,510,188 A→G intergenic (+55/+502) yjhV → / ← fecE pseudogene, KpLE2 phage‑like element/ferric citrate ABC transporter ATPase
RA 4,510,690 C→T *256* (TAG→TAA)  fecE ← ferric citrate ABC transporter ATPase
RA 4,511,146 C→T W104* (TGG→TGA)  fecE ← ferric citrate ABC transporter ATPase
RA 4,515,284 C→T G465D (GGC→GAC)  fecA ← TonB‑dependent outer membrane ferric citrate transporter and signal transducer, ferric citrate extracelluar receptor, FecR‑interacting protein
RA 4,519,014 G→A pseudogene (294/504 nt) insB1 → IS1 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA 4,535,441 C→T pseudogene (439/1029 nt) yjhR → pseudogene, helicase family, putative frameshift suppressor
RA 4,538,785 C→T *239* (TAG→TAA)  nanC ← N‑acetylnuraminic acid outer membrane channel protein
RA 4,541,559 G→A *201* (TAG→TAA)  fimB → tyrosine recombinase/inversion of on/off regulator of fimA
JC 4,543,180 (TCCCTCAGTTCTACAGCGGCTCTG)1→2 coding (66/549 nt) fimA → major type 1 subunit fimbrin (pilin)
RA 4,549,037 T→C V77A (GTC→GCC)  fimH → minor component of type 1 fimbriae
RA 4,565,464 C→A L129F (TTG→TTT)  yjiM ← putative 2‑hydroxyglutaryl‑CoA dehydratase
RA 4,565,966 C→T *427* (TAG→TAA)  yjiN ← zinc‑type alcohol dehydrogenase‑like protein
RA 4,569,309 G→A pseudogene (312/921 nt) yjiP → pseudogene, transposase_31 family protein
RA 4,577,958 C→T M1M (GTG→ATG) †
*460* (TAG→TAA) 
mcrC ←
mcrB ←
5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrC
5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrB
RA 4,581,621 G→A A476A (GCC→GCT)  hsdM ← DNA methyltransferase M
RA 4,599,234 C→T G70S (GGT→AGT)  opgB ← OPG periplasmic biosynthetic phosphoglycerol transferases I (membrane‑bound) and II (soluble)
RA 4,600,589 G→A S129S (TCC→TCT)  dnaC ← DNA biosynthesis protein
RA 4,604,202 G→A *242* (TAG→TAA) 
E15K (GAA→AAA) 
yjjQ →
bglJ →
putative transcriptional regulator
bgl operon transcriptional activator
RA 4,606,215 (G)8→7 noncoding (72/87 nt) leuP ← tRNA‑Leu
RA 4,606,239 A→G noncoding (48/87 nt) leuP ← tRNA‑Leu
RA 4,609,336 (C)7→8 intergenic (+13/‑78) yjjG → / → prfC dUMP phosphatase/peptide chain release factor RF‑3
RA 4,612,289 G→A *54* (TAG→TAA)  ytjA → uncharacterized protein
RA 4,614,260 G→A *260* (TAG→TAA)  yjjV → putative DNase
MC JC 4,619,478 Δ9 bp coding (1250‑1258/1323 nt) deoA → thymidine phosphorylase
RA 4,619,913 A→G E104G (GAA→GGA)  deoB → phosphopentomutase
RA 4,623,101 C→T *339* (TAG→TAA)  lplA ← lipoate‑protein ligase A
RA 4,631,593 G→A W287* (TGG→TGA)  slt → lytic murein transglycosylase, soluble
RA 4,634,581 A→G Y244H (TAC→CAC)  rob ← right oriC‑binding transcriptional activator, AraC family
RA 4,638,120 G→A *475* (TAG→TAA)  creC → sensory histidine kinase in two‑component regulatory system with CreB or PhoB

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 66626 66746 121 21 [19] [19] 20 araD/araA L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase
* * ÷ NC_000913 225825–226021 226880–226606 586–1056 20 [18] [18] 20 rrlH 23S ribosomal RNA of rrnH operon
* * ÷ NC_000913 583489 583618 130 22 [18] [15] 22 tfaX/appY pseudogene, DLP12 prophage,Phage or Prophage Related/global transcriptional activator, DLP12 prophage
* * ÷ NC_000913 789973 789980 8 25 [16] [0] 64 [galK] [galK]
* * ÷ NC_000913 807293 810371 3079 21 [17] [19] 23 ybhB–[bioB] ybhB, bioA, [bioB]
* * ÷ NC_000913 1427848 1428215–1428086 239–368 20 [17] [19] 22 insH1 IS5 transposase and trans‑activator
* * ÷ NC_000913 1432743–1433198 1434028–1433668 471–1286 20 [18] [16] 22 [tfaR]–[ynaE] [tfaR], pinR, [ynaE]
* * ÷ NC_000913 1958272 1958350 79 21 [19] [17] 20 torY/cutC TMAO reductase III (TorYZ), cytochrome c‑type subunit/copper homeostasis protein
* * ÷ NC_000913 2033822 2033975 154 20 [15] [14] 20 rseX/yedS sRNA antisense regulator of ompA and ompC translation, Hfq‑dependent/pseudogene, outer membrane protein homology, putative outer membrane protein
* * ÷ NC_000913 2469329 2469518 190 21 [16] [17] 24 gtrS serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
* * ÷ NC_000913 2699942 2700036 95 22 [17] [16] 20 yfhL/shoB putative 4Fe‑4S cluster‑containing protein/toxic membrane protein
* * ÷ NC_000913 3423748–3424234 3424559–3424242 9–812 21 [18] [16] 23 [rrfD]–[rrlD] [rrfD], [rrlD]
* * ÷ NC_000913 3762331–3764072 3765243–3764076 5–2913 20 [18] [19] 20 rhsA Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor
* * ÷ NC_000913 3769655 3769917 263 21 [15] [17] 22 [yibV]–yibV [yibV], yibV
* * ÷ NC_000913 3793676 3793756 81 23 [19] [16] 26 [yibB] [yibB]
* * ÷ NC_000913 4037911–4038688 4039313–4038730 43–1403 22 [19] [19] 21 rrlA 23S ribosomal RNA of rrnA operon
* * ÷ NC_000913 4410063 4410121 59 20 [19] [17] 21 rlmB/yjfI 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 7888310 (0.000)64 (0.960) 51/200 0.1 100% coding (7/1041 nt)
coding (1149/1149 nt)
galM
galK
aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase
galactokinase
?NC_000913 789981 = 0 (0.000)intergenic (‑2/+2) galK/galT galactokinase/galactose‑1‑phosphate uridylyltransferase
* ? NC_000913 788831 =0 (0.000)107 (1.570) 57/204 0.1 97.3% coding (7/1041 nt)
coding (1149/1149 nt)
galM
galK
aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase
galactokinase
?NC_000913 3742633 = 6 (0.090)intergenic (‑101/‑100) yiaJ/yiaK transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
* ? NC_000913 1207790 =20 (0.290)53 (0.920) 39/172 0.3 72.2% coding (290/630 nt) stfP e14 prophage, uncharacterized protein
?NC_000913 1209619 = 24 (0.420)pseudogene (1/501 nt) stfE pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related
* ? NC_000913 = 120780520 (0.290)31 (0.540) 21/172 1.6 60.3% coding (305/630 nt) stfP e14 prophage, uncharacterized protein
?NC_000913 = 1209602 24 (0.420)pseudogene (18/501 nt) stfE pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related
* ? NC_000913 1286708 =80 (1.170)36 (0.670) 21/162 1.4 50.2% intergenic (+182/+358) narI/rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
?NC_000913 = 1287241 8 (0.150)intergenic (‑5/+3) rttR/tyrV rtT sRNA, processed from tyrT transcript/tRNA‑Tyr
* ? NC_000913 = 12870846 (0.090)34 (0.620) 17/164 2.0 54.5% noncoding (153/171 nt) rttR rtT sRNA, processed from tyrT transcript
?NC_000913 1287557 = 52 (0.950)noncoding (66/85 nt) tyrT tRNA‑Tyr
* ? NC_000913 = 12994980 (0.000)27 (0.410) 19/196 2.3 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein