breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 9,907 A→C 10.1% intergenic (+14/+21) mog → / ← satP molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter
RA 9,908 G→T 10.1% intergenic (+15/+20) mog → / ← satP molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter
RA 11,127 C→G 5.4% S77T (AGT→ACT)  yaaW ← UPF0174 family protein
RA 25,773 A→G 16.2% intergenic (+72/‑53) lspA → / → fkpB prolipoprotein signal peptidase (signal peptidase II)/FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase)
RA 25,774 A→C 16.1% intergenic (+73/‑52) lspA → / → fkpB prolipoprotein signal peptidase (signal peptidase II)/FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase)
RA 53,376 G→A 8.0% P14L (CCC→CTC)  pdxA ← 4‑hydroxy‑L‑threonine phosphate dehydrogenase, NAD‑dependent
RA 53,379 T→C 7.9% E13G (GAG→GGG)  pdxA ← 4‑hydroxy‑L‑threonine phosphate dehydrogenase, NAD‑dependent
RA 72,198 A→G 5.3% intergenic (+83/+31) yabI → / ← thiQ DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase
RA 72,199 A→C 5.3% intergenic (+84/+30) yabI → / ← thiQ DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase
RA 72,205 T→G 5.4% intergenic (+90/+24) yabI → / ← thiQ DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase
RA 72,206 C→A 5.3% intergenic (+91/+23) yabI → / ← thiQ DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase
RA 83,587 A→C 37.5% intergenic (‑58/+35) leuA ← / ← leuL 2‑isopropylmalate synthase/leu operon leader peptide
RA 83,590 G→T 38.5% intergenic (‑61/+32) leuA ← / ← leuL 2‑isopropylmalate synthase/leu operon leader peptide
RA 85,337 G→T 6.9% intergenic (+25/‑293) leuO → / → ilvI global transcription factor/acetolactate synthase 3 large subunit
RA 85,338 A→C 7.2% intergenic (+26/‑292) leuO → / → ilvI global transcription factor/acetolactate synthase 3 large subunit
RA 93,800 T→A 5.2% L212H (CTT→CAT)  murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase
RA 93,805 T→A 5.2% Y214N (TAT→AAT)  murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase
RA 93,810 T→A 5.3% H215Q (CAT→CAA)  murE → UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase
RA 106,831 T→A 5.5% I92N (ATT→AAT)  lpxC → UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase
RA 111,013 G→A 12.5% intergenic (+29/‑31) secA → / → mutT preprotein translocase subunit, ATPase/dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase
RA 111,016 T→C 13.5% intergenic (+32/‑28) secA → / → mutT preprotein translocase subunit, ATPase/dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase
RA 120,154 Δ1 bp 22.4% intergenic (+19/+24) ampE → / ← aroP ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter
RA 120,158:1 +A 23.0% intergenic (+23/+20) ampE → / ← aroP ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter
RA 125,226 G→T 6.5% R737L (CGT→CTT)  aceE → pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
RA 125,232 T→G 7.5% V739G (GTC→GGC) ‡ aceE → pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
RA 125,233 C→A 7.5% V739V (GTC→GTA) ‡ aceE → pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
RA 127,789:1 +T 6.2% intergenic (+202/‑123) aceF → / → lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
RA 127,790 A→T 6.2% intergenic (+203/‑122) aceF → / → lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
RA 127,791 A→C 6.2% intergenic (+204/‑121) aceF → / → lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
RA 127,792 G→A 6.1% intergenic (+205/‑120) aceF → / → lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
RA 136,530 C→T 6.1% intergenic (‑66/+40) speE ← / ← yacC spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein
RA 136,532 G→C 6.1% intergenic (‑68/+38) speE ← / ← yacC spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein
RA 136,535 G→C 6.1% intergenic (‑71/+35) speE ← / ← yacC spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein
RA 136,537 A→G 6.1% intergenic (‑73/+33) speE ← / ← yacC spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein
RA 137,018 G→C 6.8% intergenic (‑101/‑65) yacC ← / → cueO PulS_OutS family protein/multicopper oxidase (laccase)
RA 137,020 A→T 6.7% intergenic (‑103/‑63) yacC ← / → cueO PulS_OutS family protein/multicopper oxidase (laccase)
RA 137,022 G→C 7.0% intergenic (‑105/‑61) yacC ← / → cueO PulS_OutS family protein/multicopper oxidase (laccase)
RA 151,519 A→C 7.7% I27M (ATT→ATG)  yadK ← putative fimbrial‑like adhesin protein
RA 151,522 G→T 7.8% A26A (GCC→GCA)  yadK ← putative fimbrial‑like adhesin protein
RA 164,556 T→A 8.4% intergenic (+22/‑174) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 164,557 G→C 8.1% intergenic (+23/‑173) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 164,558 T→A 8.1% intergenic (+24/‑172) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 164,620 C→T 5.8% intergenic (+86/‑110) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 164,621 A→G 6.1% intergenic (+87/‑109) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 169,748 T→A 10.0% intergenic (+21/‑30) fhuA → / → fhuC ferrichrome outer membrane transporter/iron(3+)‑hydroxamate import ABC transporter ATPase
RA 169,749 T→A 10.0% intergenic (+22/‑29) fhuA → / → fhuC ferrichrome outer membrane transporter/iron(3+)‑hydroxamate import ABC transporter ATPase
RA 175,144 Δ1 bp 8.9% coding (38/1422 nt) clcA → H(+)/Cl(‑) exchange transporter
RA 175,149:1 +G 9.0% coding (43/1422 nt) clcA → H(+)/Cl(‑) exchange transporter
RA 175,157 A→G 6.4% R17R (CGA→CGG)  clcA → H(+)/Cl(‑) exchange transporter
RA 201,032 G→A 6.2% G21D (GGC→GAC)  lpxD → UDP‑3‑O‑(3‑hydroxymyristoyl)‑glucosamine N‑acyltransferase
RA 208,552 T→A 10.0% L1143I (TTA→ATA)  dnaE → DNA polymerase III alpha subunit
RA 217,030 C→T 5.9% intergenic (‑27/+27) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 217,037 A→T 6.1% intergenic (‑34/+20) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 217,044 A→G 5.8% intergenic (‑41/+13) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 242,344 C→G 6.7% P320P (CCG→CCC)  fadE ← acyl coenzyme A dehydrogenase
RA 248,868 C→G 6.7% pseudogene (1203/1713 nt) lfhA ← pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA 253,282 A→G 6.1% intergenic (+121/‑197) yafP → / → ykfJ GNAT family putative N‑acetyltransferase/pseudogene
RA 254,223 A→T 9.8% intergenic (+21/+36) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 254,228 A→T 7.4% intergenic (+26/+31) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 254,233 A→T 7.8% intergenic (+31/+26) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 256,449 T→C 14.5% intergenic (+14/‑78) gpt → / → frsA xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
RA 256,454 C→G 15.7% intergenic (+19/‑73) gpt → / → frsA xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
RA 256,459 G→A 16.0% intergenic (+24/‑68) gpt → / → frsA xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
MC JC 257,908 Δ776 bp 100% [crl] [crl]
RA 272,330:1 +G 5.7% intergenic (+141/‑250) insN → / → eyeA pseudogene, IS911 transposase A;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related/novel sRNA, function unknown, CP4‑6 propahge
RA 282,513 T→C 7.9% L79P (CTG→CCG)  yagE → 2‑keto‑3‑deoxy gluconate (KDG) aldolase; CP4‑6 prophage
RA 285,882 T→G 7.3% I163S (ATC→AGC)  yagG → CP4‑6 prophage; putative sugar transporter
RA 285,887 C→A 7.5% L165M (CTG→ATG)  yagG → CP4‑6 prophage; putative sugar transporter
RA 288,399 A→C 5.1% *537Y (TAA→TAC)  yagH → CP4‑6 prophage; putative xylosidase/arabinosidase
RA 289,255 T→A 9.7% intergenic (‑93/+46) yagI ← / ← argF CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage
RA 289,256 G→C 12.9% intergenic (‑94/+45) yagI ← / ← argF CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage
RA 289,257 T→A 12.9% intergenic (‑95/+44) yagI ← / ← argF CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage
RA 292,302 C→G 5.3% intergenic (+71/+20) yagJ → / ← yagK CP4‑6 prophage; uncharacterized protein;Phage or Prophage Related/CP4‑6 prophage; conserved protein
RA 314,255 T→C 17.7% intergenic (‑450/‑102) ykgP ← / → eaeH pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified
RA 314,258 G→A 18.1% intergenic (‑453/‑99) ykgP ← / → eaeH pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified
RA 344,704 A→T 5.9% K177* (AAA→TAA) ‡ yahL → uncharacterized protein
RA 344,705 A→T 5.9% K177I (AAA→ATA) ‡ yahL → uncharacterized protein
RA 373,332 C→G 6.0% P138A (CCA→GCA) ‡ mhpF → acetaldehyde‑CoA dehydrogenase II, NAD‑binding
RA 373,333 C→G 6.0% P138R (CCA→CGA) ‡ mhpF → acetaldehyde‑CoA dehydrogenase II, NAD‑binding
RA 374,682 C→T 6.5% P272L (CCG→CTG) ‡ mhpE → 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I
RA 374,683 G→C 6.4% P272P (CCG→CCC) ‡ mhpE → 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I
RA 374,688 G→C 6.6% R274P (CGA→CCA) ‡ mhpE → 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I
RA 374,689 A→G 7.1% R274R (CGA→CGG) ‡ mhpE → 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I
RA 380,091 G→T 5.7% A251D (GCC→GAC)  yaiO ← outer membrane protein
RA 383,897 C→T 10.0% M13I (ATG→ATA) ‡ yaiP ← putative family 2 glycosyltransferase
RA 383,898 A→G 10.0% M13T (ATG→ACG) ‡ yaiP ← putative family 2 glycosyltransferase
RA 403,178 T→C 8.1% intergenic (+16/‑103) phoA → / → psiF bacterial alkaline phosphatase/PsiF family protein
RA 403,182 T→A 7.0% intergenic (+20/‑99) phoA → / → psiF bacterial alkaline phosphatase/PsiF family protein
RA 403,183 T→A 7.0% intergenic (+21/‑98) phoA → / → psiF bacterial alkaline phosphatase/PsiF family protein
RA 403,187 G→A 7.0% intergenic (+25/‑94) phoA → / → psiF bacterial alkaline phosphatase/PsiF family protein
RA 423,989 A→C 5.0% N491T (AAC→ACC)  malZ → maltodextrin glucosidase
RA 423,995 C→G 5.1% P493R (CCG→CGG)  malZ → maltodextrin glucosidase
RA 435,390 T→A 5.6% L85Q (CTG→CAG)  nusB → transcription antitermination protein
RA 435,396 T→A 5.5% I87N (ATT→AAT)  nusB → transcription antitermination protein
RA 435,402 T→A 5.1% L89Q (CTG→CAG)  nusB → transcription antitermination protein
RA 443,022 G→A 10.8% intergenic (+25/+29) thiI → / ← yajL tRNA s(4)U8 sulfurtransferase/oxidative‑stress‑resistance chaperone
RA 443,023 T→C 11.1% intergenic (+26/+28) thiI → / ← yajL tRNA s(4)U8 sulfurtransferase/oxidative‑stress‑resistance chaperone
RA 454,853 T→C 13.0% intergenic (+64/‑280) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 454,856 G→A 12.3% intergenic (+67/‑277) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 464,354 C→A 6.0% intergenic (+46/‑48) ybaV → / → fadM putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III
RA 464,356 A→T 5.8% intergenic (+48/‑46) ybaV → / → fadM putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III
RA 464,358 T→G 6.2% intergenic (+50/‑44) ybaV → / → fadM putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III
RA 475,971 C→G 15.6% intergenic (+20/+11) ybaY → / ← ybaZ outer membrane lipoprotein/excision repair protein, alkyltransferase‑like protein ATL
RA 475,972 C→G 15.6% intergenic (+21/+10) ybaY → / ← ybaZ outer membrane lipoprotein/excision repair protein, alkyltransferase‑like protein ATL
RA 481,225 T→G 43.7% intergenic (‑517/+29) tomB ← / ← acrB Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein
RA 481,228 C→A 31.6% intergenic (‑520/+26) tomB ← / ← acrB Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein
RA 484,877 G→A 5.6% T248I (ACC→ATC)  acrA ← multidrug efflux system
RA 484,879 G→C 5.6% I247M (ATC→ATG) ‡ acrA ← multidrug efflux system
RA 484,881 T→C 5.5% I247V (ATC→GTC) ‡ acrA ← multidrug efflux system
RA 543,091 G→C 18.5% intergenic (+58/+170) glxK → / ← allE glycerate kinase II/S‑ureidoglycine aminohydrolase
RA 543,094 G→C 15.4% intergenic (+61/+167) glxK → / ← allE glycerate kinase II/S‑ureidoglycine aminohydrolase
RA 543,207 A→T 7.0% intergenic (+174/+54) glxK → / ← allE glycerate kinase II/S‑ureidoglycine aminohydrolase
RA 543,210 A→T 6.8% intergenic (+177/+51) glxK → / ← allE glycerate kinase II/S‑ureidoglycine aminohydrolase
RA 553,885 G→A 5.2% T19I (ACC→ATC)  lpxH ← UDP‑2,3‑diacylglucosamine pyrophosphohydrolase
RA 553,889 T→C 5.0% I18V (ATC→GTC)  lpxH ← UDP‑2,3‑diacylglucosamine pyrophosphohydrolase
RA 569,160 G→T 12.3% D87Y (GAC→TAC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 569,161 A→C 11.5% D87A (GAC→GCC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 577,260:1 +T 6.0% intergenic (‑435/‑138) nmpC ← / → essD DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein
RA 577,263 T→A 5.6% intergenic (‑438/‑135) nmpC ← / → essD DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein
RA 577,266 Δ1 bp 5.7% intergenic (‑441/‑132) nmpC ← / → essD DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein
RA 585,863 T→C 10.7% intergenic (‑230/‑194) ompT ← / → pauD DLP12 prophage; outer membrane protease VII; outer membrane protein 3b/tRNA‑OTHER
RA 585,866 G→A 10.6% intergenic (‑233/‑191) ompT ← / → pauD DLP12 prophage; outer membrane protease VII; outer membrane protein 3b/tRNA‑OTHER
RA 594,946 C→A 8.1% Q166H (CAG→CAT) ‡ cusR ← response regulator in two‑component regulatory system with CusS
RA 594,948 G→C 7.7% Q166E (CAG→GAG) ‡ cusR ← response regulator in two‑component regulatory system with CusS
RA 594,950 T→G 7.9% H165P (CAT→CCT)  cusR ← response regulator in two‑component regulatory system with CusS
RA 595,519 T→A 6.2% intergenic (‑76/‑81) cusR ← / → cusC response regulator in two‑component regulatory system with CusS/copper/silver efflux system, outer membrane component
RA 595,520 T→A 6.2% intergenic (‑77/‑80) cusR ← / → cusC response regulator in two‑component regulatory system with CusS/copper/silver efflux system, outer membrane component
RA 603,391 C→G 30.1% intergenic (+56/+25) pheP → / ← ybdG phenylalanine transporter/mechanosensitive channel protein, miniconductance
RA 603,393 T→A 30.5% intergenic (+58/+23) pheP → / ← ybdG phenylalanine transporter/mechanosensitive channel protein, miniconductance
RA 603,395 C→G 28.2% intergenic (+60/+21) pheP → / ← ybdG phenylalanine transporter/mechanosensitive channel protein, miniconductance
RA 610,202 C→T 7.4% intergenic (‑123/+52) entD ← / ← fepA phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter
RA 610,207 C→G 7.6% intergenic (‑128/+47) entD ← / ← fepA phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter
RA 610,210 C→G 6.7% intergenic (‑131/+44) entD ← / ← fepA phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter
RA 610,215 A→G 6.2% intergenic (‑136/+39) entD ← / ← fepA phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter
RA 644,030 A→G 8.3% intergenic (‑63/+167) rnk ← / ← rna regulator of nucleoside diphosphate kinase/ribonuclease I
RA 644,034 T→C 8.4% intergenic (‑67/+163) rnk ← / ← rna regulator of nucleoside diphosphate kinase/ribonuclease I
RA 644,036 A→T 8.5% intergenic (‑69/+161) rnk ← / ← rna regulator of nucleoside diphosphate kinase/ribonuclease I
RA 644,038 G→A 9.0% intergenic (‑71/+159) rnk ← / ← rna regulator of nucleoside diphosphate kinase/ribonuclease I
RA 644,042 C→T 8.9% intergenic (‑75/+155) rnk ← / ← rna regulator of nucleoside diphosphate kinase/ribonuclease I
RA 645,062 G→A 23.5% intergenic (‑59/+55) rna ← / ← citT ribonuclease I/citrate/succinate antiporter; citrate carrier
RA 645,065 A→T 19.1% intergenic (‑62/+52) rna ← / ← citT ribonuclease I/citrate/succinate antiporter; citrate carrier
RA 645,068 T→C 20.0% intergenic (‑65/+49) rna ← / ← citT ribonuclease I/citrate/succinate antiporter; citrate carrier
RA 650,529 G→A 5.1% R85R (CGC→CGT)  citD ← citrate lyase, acyl carrier (gamma) subunit
RA 654,560 A→C 7.7% intergenic (+18/+23) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 654,563 C→G 7.5% intergenic (+21/+20) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 654,566 G→T 5.9% intergenic (+24/+17) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 657,531 T→G 7.2% intergenic (+30/+24) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 657,533 A→T 7.3% intergenic (+32/+22) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 657,535 C→A 7.2% intergenic (+34/+20) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 672,110 G→A 5.4% T26I (ACC→ATC)  lptE ← LPS assembly OM complex LptDE, lipoprotein component
RA 672,113 T→C 5.3% D25G (GAT→GGT)  lptE ← LPS assembly OM complex LptDE, lipoprotein component
RA 681,694 A→G 19.1% intergenic (+31/+29) djlC → / ← hscC J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor
RA 681,699 T→A 20.0% intergenic (+36/+24) djlC → / ← hscC J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor
RA 681,700 T→A 20.0% intergenic (+37/+23) djlC → / ← hscC J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor
RA 681,705 C→T 13.2% intergenic (+42/+18) djlC → / ← hscC J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor
RA 696,318 A→G 8.0% intergenic (+42/+112) ubiF → / ← glnX 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln
RA 696,319 A→C 8.0% intergenic (+43/+111) ubiF → / ← glnX 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln
RA 696,325 G→T 11.7% intergenic (+49/+105) ubiF → / ← glnX 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln
RA 696,328 A→C 12.5% intergenic (+52/+102) ubiF → / ← glnX 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln
RA 699,424 T→C 6.8% intergenic (‑247/+150) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,429 G→C 6.8% intergenic (‑252/+145) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,432 G→C 7.3% intergenic (‑255/+142) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,437 G→A 7.1% intergenic (‑260/+137) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,439 G→T 6.6% intergenic (‑262/+135) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,440 A→C 7.1% intergenic (‑263/+134) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,446 T→G 7.7% intergenic (‑269/+128) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,447 T→C 7.7% intergenic (‑270/+127) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,556 C→T 14.3% intergenic (‑379/+18) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 699,559 A→G 13.7% intergenic (‑382/+15) asnB ← / ← umpH asparagine synthetase B/UMP phosphatase
RA 705,916 T→C 11.8% intergenic (+26/‑177) nagE → / → glnS N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase
RA 705,917 G→A 11.9% intergenic (+27/‑176) nagE → / → glnS N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase
RA 710,170 C→T 16.7% intergenic (+54/+30) chiQ → / ← fur chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA 710,173 A→G 16.3% intergenic (+57/+27) chiQ → / ← fur chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA 713,195 G→A 5.1% R70H (CGC→CAC)  seqA → negative modulator of initiation of replication
RA 713,200 A→T 5.1% M72L (ATG→TTG)  seqA → negative modulator of initiation of replication
RA 713,205 T→C 6.0% R73R (CGT→CGC)  seqA → negative modulator of initiation of replication
RA 747,895 C→G 9.7% intergenic (‑126/+26) abrB ← / ← ybgO regulator of aidB expression; inner membrane protein/putative fimbrial protein
RA 747,897 G→C 9.9% intergenic (‑128/+24) abrB ← / ← ybgO regulator of aidB expression; inner membrane protein/putative fimbrial protein
RA 747,900 G→C 9.9% intergenic (‑131/+21) abrB ← / ← ybgO regulator of aidB expression; inner membrane protein/putative fimbrial protein
RA 747,902 C→G 10.0% intergenic (‑133/+19) abrB ← / ← ybgO regulator of aidB expression; inner membrane protein/putative fimbrial protein
RA 770,679 G→T 14.9% intergenic (+68/‑779) mngB → / → cydA alpha‑mannosidase/cytochrome d terminal oxidase, subunit I
RA 770,682 A→C 14.8% intergenic (+71/‑776) mngB → / → cydA alpha‑mannosidase/cytochrome d terminal oxidase, subunit I
RA 770,805 G→A 14.4% intergenic (+194/‑653) mngB → / → cydA alpha‑mannosidase/cytochrome d terminal oxidase, subunit I
RA 770,810 T→C 19.0% intergenic (+199/‑648) mngB → / → cydA alpha‑mannosidase/cytochrome d terminal oxidase, subunit I
RA 781,326 A→T 9.5% intergenic (+104/‑43) lysY → / → lysZ tRNA‑Lys/tRNA‑Lys
RA 781,845 T→C 8.3% intergenic (+193/‑240) lysQ → / → nadA tRNA‑Lys/quinolinate synthase, subunit A
RA 782,999 T→G 5.7% L305L (CTT→CTG)  nadA → quinolinate synthase, subunit A
RA 783,000 C→A 5.5% Q306K (CAG→AAG)  nadA → quinolinate synthase, subunit A
RA 784,012 T→A 5.8% Q271L (CAG→CTG)  zitB ← zinc efflux system
RA 805,312 G→T 6.4% E604* (GAG→TAG) ‡ ybhJ → aconitase family protein
RA 805,313 A→C 6.5% E604A (GAG→GCG) ‡ ybhJ → aconitase family protein
RA 813,570:1 +T 5.1% coding (45/2022 nt) uvrB → exision nuclease of nucleotide excision repair, DNA damage recognition component
RA 813,575 Δ1 bp 5.3% coding (50/2022 nt) uvrB → exision nuclease of nucleotide excision repair, DNA damage recognition component
RA 824,572 T→A 5.7% intergenic (‑75/‑58) ybhP ← / → ybhQ endo/exonuclease/phosphatase family protein/inner membrane protein
RA 824,573 T→A 5.6% intergenic (‑76/‑57) ybhP ← / → ybhQ endo/exonuclease/phosphatase family protein/inner membrane protein
RA 837,642 A→T 8.4% intergenic (+206/+23) ybiC → / ← ybiJ putative dehydrogenase/DUF1471 family putative periplasmic protein
RA 837,643 A→T 8.4% intergenic (+207/+22) ybiC → / ← ybiJ putative dehydrogenase/DUF1471 family putative periplasmic protein
RA 837,649 T→G 7.8% intergenic (+213/+16) ybiC → / ← ybiJ putative dehydrogenase/DUF1471 family putative periplasmic protein
RA 837,650 T→C 7.5% intergenic (+214/+15) ybiC → / ← ybiJ putative dehydrogenase/DUF1471 family putative periplasmic protein
RA 843,338 C→G 5.4% A715P (GCG→CCG)  ybiO ← mechanosensitive channel protein, intermediate conductance
RA 843,342 A→T 5.2% V713V (GTT→GTA) ‡ ybiO ← mechanosensitive channel protein, intermediate conductance
RA 843,343 A→T 5.2% V713D (GTT→GAT) ‡ ybiO ← mechanosensitive channel protein, intermediate conductance
RA 843,347 C→G 5.3% G712R (GGC→CGC)  ybiO ← mechanosensitive channel protein, intermediate conductance
RA 847,213 A→T 7.4% intergenic (‑94/+45) glnP ← / ← glnH glutamine transporter subunit/glutamine transporter subunit
RA 847,214 T→A 8.3% intergenic (‑95/+44) glnP ← / ← glnH glutamine transporter subunit/glutamine transporter subunit
RA 847,215 A→T 7.7% intergenic (‑96/+43) glnP ← / ← glnH glutamine transporter subunit/glutamine transporter subunit
RA 857,576 T→C 21.3% intergenic (+21/+220) ybiT → / ← ybiU ABC‑F family putative regulatory ATPase/DUF1479 family protein
RA 857,578 C→G 21.3% intergenic (+23/+218) ybiT → / ← ybiU ABC‑F family putative regulatory ATPase/DUF1479 family protein
RA 857,580 G→A 22.0% intergenic (+25/+216) ybiT → / ← ybiU ABC‑F family putative regulatory ATPase/DUF1479 family protein
RA 860,178 A→G 5.8% L810P (CTG→CCG)  ybiW ← putative pyruvate formate lyase
RA 874,623 Δ1 bp 5.5% coding (1645/2349 nt) yliE → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 874,628:1 +G 5.5% coding (1650/2349 nt) yliE → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 876,568 A→T 5.6% N412Y (AAT→TAT) ‡ yliF → putative membrane‑anchored diguanylate cyclase
RA 876,569 A→T 5.6% N412I (AAT→ATT) ‡ yliF → putative membrane‑anchored diguanylate cyclase
RA 887,392 T→A 7.4% intergenic (‑53/‑31) ybjJ ← / → rcdA putative drug efflux MFS transporter, inner membrane protein/transcriptional regulator of csgD and ybiJI; autoregulator
RA 887,393 T→A 7.4% intergenic (‑54/‑30) ybjJ ← / → rcdA putative drug efflux MFS transporter, inner membrane protein/transcriptional regulator of csgD and ybiJI; autoregulator
RA 892,455 G→C 8.0% V163V (GTG→GTC)  rimK → ribosomal protein S6 modification protein
RA 892,457 T→A 8.2% I164N (ATT→AAT)  rimK → ribosomal protein S6 modification protein
RA 892,459 G→C 8.2% D165H (GAC→CAC)  rimK → ribosomal protein S6 modification protein
RA 894,952 T→A 6.0% intergenic (+56/‑39) potF → / → potG putrescine ABC transporter periplasmic binding protein/putrescine ABC transporter ATPase
RA 899,656 T→C 6.1% intergenic (+11/+188) rlmC → / ← artJ 23S rRNA m(5)U747 methyltransferase, SAM‑dependent/arginine ABC transporter periplasmic binding protein
RA 899,657 G→A 6.1% intergenic (+12/+187) rlmC → / ← artJ 23S rRNA m(5)U747 methyltransferase, SAM‑dependent/arginine ABC transporter periplasmic binding protein
RA 915,080 G→C 10.8% intergenic (‑223/+272) ybjE ← / ← aqpZ putative transporter/aquaporin Z
RA 915,081 G→C 10.8% intergenic (‑224/+271) ybjE ← / ← aqpZ putative transporter/aquaporin Z
RA 922,314:1 +C 10.9% intergenic (+21/+52) macB → / ← cspD macrolide ABC transporter peremase/ATPase/inhibitor of DNA replication, cold shock protein homolog
RA 926,168 C→T 6.4% intergenic (‑197/+57) serW ← / ← infA tRNA‑Ser/translation initiation factor IF‑1
RA 926,174 A→T 5.4% intergenic (‑203/+51) serW ← / ← infA tRNA‑Ser/translation initiation factor IF‑1
RA 926,180 A→G 5.2% intergenic (‑209/+45) serW ← / ← infA tRNA‑Ser/translation initiation factor IF‑1
RA 940,751 T→C 42.1% intergenic (+31/‑208) serS → / → dmsA seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A
RA 940,754 G→A 38.9% intergenic (+34/‑205) serS → / → dmsA seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A
RA 958,769 C→G 13.3% intergenic (+28/‑43) serC → / → aroA 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase
RA 958,771 A→T 13.2% intergenic (+30/‑41) serC → / → aroA 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase
RA 958,773 C→G 13.3% intergenic (+32/‑39) serC → / → aroA 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase
RA 964,148 T→C 19.1% intergenic (+36/‑172) ihfB → / → ycaI integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein
RA 964,150 T→A 18.6% intergenic (+38/‑170) ihfB → / → ycaI integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein
RA 964,152 G→A 20.2% intergenic (+40/‑168) ihfB → / → ycaI integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein
RA 1,004,741 T→G 6.4% intergenic (+84/‑27) ycbF → / → pyrD putative periplasmic pilin chaperone/dihydro‑orotate oxidase, FMN‑linked
RA 1,004,746 C→A 6.4% intergenic (+89/‑22) ycbF → / → pyrD putative periplasmic pilin chaperone/dihydro‑orotate oxidase, FMN‑linked
RA 1,015,912 T→A 20.9% intergenic (+30/+40) rmf → / ← fabA ribosome modulation factor/beta‑hydroxydecanoyl thioester dehydrase
RA 1,018,983 A→T 55.6% intergenic (+46/+30) matP → / ← ompA Ter macrodomain organizer matS‑binding protein/outer membrane protein A (3a;II*;G;d)
RA 1,018,986 A→T 55.6% intergenic (+49/+27) matP → / ← ompA Ter macrodomain organizer matS‑binding protein/outer membrane protein A (3a;II*;G;d)
RA 1,041,937 T→G 8.0% intergenic (+22/+93) appA → / ← etk phosphoanhydride phosphorylase/tyrosine‑protein kinase, role in O‑antigen capsule formation
RA 1,041,940 C→A 7.9% intergenic (+25/+90) appA → / ← etk phosphoanhydride phosphorylase/tyrosine‑protein kinase, role in O‑antigen capsule formation
RA 1,052,257 C→T 7.9% intergenic (+17/+32) gnsA → / ← yccM putative phosphatidylethanolamine synthesis regulator/putative 4Fe‑4S membrane protein
RA 1,064,160 T→C 18.6% L42P (CTG→CCG) ‡ yccE → uncharacterized protein
RA 1,064,161 G→A 17.8% L42L (CTG→CTA) ‡ yccE → uncharacterized protein
RA 1,074,894 G→T 9.2% intergenic (+14/+26) rutR → / ← putA rut operon transcriptional repressor for/fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase
RA 1,075,515 G→T 5.2% A1123E (GCG→GAG)  putA ← fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase
RA 1,075,518 A→C 5.2% L1122R (CTC→CGC)  putA ← fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase
RA 1,100,789 G→T 12.5% intergenic (+2/+62) ycdZ → / ← csgG DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein
RA 1,100,791 G→C 12.5% intergenic (+4/+60) ycdZ → / ← csgG DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein
RA 1,100,793 A→C 12.0% intergenic (+6/+58) ycdZ → / ← csgG DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein
RA 1,113,544 G→A 13.0% intergenic (+138/‑35) opgH → / → yceK OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein
RA 1,113,546 T→A 13.3% intergenic (+140/‑33) opgH → / → yceK OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein
RA 1,113,548 T→C 13.3% intergenic (+142/‑31) opgH → / → yceK OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein
RA 1,131,310 A→T 6.2% N98I (AAT→ATT)  flgB → flagellar component of cell‑proximal portion of basal‑body rod
RA 1,134,661 A→G 5.4% intergenic (+104/‑68) flgF → / → flgG flagellar component of cell‑proximal portion of basal‑body rod/flagellar component of cell‑distal portion of basal‑body rod
RA 1,134,662 A→C 5.4% intergenic (+105/‑67) flgF → / → flgG flagellar component of cell‑proximal portion of basal‑body rod/flagellar component of cell‑distal portion of basal‑body rod
RA 1,147,980 G→T 11.0% K120N (AAG→AAT)  plsX → putative phosphate acyltransferase
RA 1,147,986 G→C 9.2% L122L (CTG→CTC)  plsX → putative phosphate acyltransferase
RA 1,147,987 G→C 9.8% E123Q (GAG→CAG)  plsX → putative phosphate acyltransferase
RA 1,147,993 A→C 10.3% I125L (ATT→CTT)  plsX → putative phosphate acyltransferase
RA 1,153,208 T→C 6.1% intergenic (+28/‑92) fabF → / → pabC 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA 1,153,213 T→A 6.4% intergenic (+33/‑87) fabF → / → pabC 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA 1,153,214 T→A 6.4% intergenic (+34/‑86) fabF → / → pabC 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA 1,153,219 G→A 6.4% intergenic (+39/‑81) fabF → / → pabC 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA 1,159,335 G→T 8.3% intergenic (+33/+27) ptsG → / ← fhuE fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter
RA 1,159,336 A→C 8.3% intergenic (+34/+26) ptsG → / ← fhuE fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter
RA 1,169,380 T→C 22.2% intergenic (+50/+32) bhsA → / ← ldtC biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein
RA 1,169,382 C→G 21.6% intergenic (+52/+30) bhsA → / ← ldtC biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein
RA 1,169,384 G→A 21.0% intergenic (+54/+28) bhsA → / ← ldtC biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein
RA 1,174,077 G→A 10.3% intergenic (‑113/+15) mfd ← / ← ycfT transcription‑repair coupling factor/inner membrane protein
RA 1,174,080 T→C 10.3% intergenic (‑116/+12) mfd ← / ← ycfT transcription‑repair coupling factor/inner membrane protein
RA 1,174,501 A→T 6.6% L222Q (CTG→CAG)  ycfT ← inner membrane protein
RA 1,174,504 A→T 6.6% L221Q (CTG→CAG)  ycfT ← inner membrane protein
RA 1,177,646 T→G 5.0% N109K (AAT→AAG)  lolE → lipoprotein‑releasing system transmembrane protein
RA 1,177,647 C→A 5.0% L110I (CTT→ATT)  lolE → lipoprotein‑releasing system transmembrane protein
RA 1,187,090 G→C 16.0% intergenic (+20/+29) pepT → / ← roxA peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase
RA 1,187,091 T→A 16.0% intergenic (+21/+28) pepT → / ← roxA peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase
RA 1,187,092 G→C 16.0% intergenic (+22/+27) pepT → / ← roxA peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase
RA 1,194,650 G→A 5.2% P101L (CCG→CTG)  rluE ← 23S rRNA pseudouridine(2457) synthase
RA 1,194,653 T→C 5.2% Q100R (CAG→CGG)  rluE ← 23S rRNA pseudouridine(2457) synthase
RA 1,194,657 Δ1 bp 5.4% coding (295/654 nt) rluE ← 23S rRNA pseudouridine(2457) synthase
RA 1,196,408 A→T 16.0% intergenic (+35/+459) icd → / ← ymfD isocitrate dehydrogenase; e14 prophage attachment site; tellurite reductase/e14 prophage; putative SAM‑dependent methyltransferase
RA 1,202,957 G→T 5.9% intergenic (‑24/‑67) cohE ← / → croE e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator
RA 1,202,959 T→A 5.7% intergenic (‑26/‑65) cohE ← / → croE e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator
RA 1,202,961 A→C 6.0% intergenic (‑28/‑63) cohE ← / → croE e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator
RA 1,217,099 T→C 7.2% intergenic (+103/‑229) ymgC → / → ycgG Blue light, low temperature and stress induced protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 1,224,239 A→T 8.9% intergenic (+332/+40) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,224,242 A→T 8.8% intergenic (+335/+37) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,233,154 T→A 8.4% intergenic (‑124/+22) dsbB ← / ← nhaB oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter
RA 1,233,157 T→A 9.4% intergenic (‑127/+19) dsbB ← / ← nhaB oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter
RA 1,248,064 T→A 5.1% K351* (AAA→TAA)  dhaM ← putative dihydroxyacetone‑specific PTS enzymes: HPr, EI components
RA 1,256,416 A→T 100% intergenic (‑464/+305) ycgV ← / ← ychF putative adhesin/catalase inhibitor protein; ATPase, K+‑dependent, ribosome‑associated
RA 1,260,901 C→T 12.5% intergenic (‑98/+27) dauA ← / ← prs C4‑dicarboxylic acid transporter/phosphoribosylpyrophosphate synthase
RA 1,260,904 A→G 11.4% intergenic (‑101/+24) dauA ← / ← prs C4‑dicarboxylic acid transporter/phosphoribosylpyrophosphate synthase
RA 1,285,190 T→A 5.8% L18I (TTA→ATA)  narJ → molybdenum‑cofactor‑assembly chaperone delta subunit of nitrate reductase 1
RA 1,285,193 T→A 6.1% W19R (TGG→AGG)  narJ → molybdenum‑cofactor‑assembly chaperone delta subunit of nitrate reductase 1
RA 1,287,458 A→C 9.5% intergenic (‑130/+80) tyrV ← / ← tyrT tRNA‑Tyr/tRNA‑Tyr
RA 1,287,460 T→A 9.8% intergenic (‑132/+78) tyrV ← / ← tyrT tRNA‑Tyr/tRNA‑Tyr
RA 1,287,462 G→T 9.8% intergenic (‑134/+76) tyrV ← / ← tyrT tRNA‑Tyr/tRNA‑Tyr
RA 1,287,572 G→T 5.2% noncoding (51/85 nt) tyrT ← tRNA‑Tyr
RA 1,287,573 A→G 5.1% noncoding (50/85 nt) tyrT ← tRNA‑Tyr
RA 1,292,472 G→A 40.0% intergenic (+107/+37) galU → / ← hns glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS
RA 1,292,473 C→G 40.0% intergenic (+108/+36) galU → / ← hns glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS
RA 1,292,474 T→C 33.2% intergenic (+109/+35) galU → / ← hns glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS
RA 1,304,469 C→G 5.2% R212R (CGC→CGG)  oppC → oligopeptide ABC transporter permease
RA 1,304,474 T→A 5.4% I214N (ATT→AAT)  oppC → oligopeptide ABC transporter permease
RA 1,304,479 C→G 5.6% P216A (CCG→GCG)  oppC → oligopeptide ABC transporter permease
RA 1,306,787 G→A 13.3% intergenic (+19/+34) oppF → / ← yciU oligopeptide ABC transporter ATPase/UPF0263 family protein
RA 1,306,788 T→C 14.3% intergenic (+20/+33) oppF → / ← yciU oligopeptide ABC transporter ATPase/UPF0263 family protein
RA 1,311,830 A→G 34.6% intergenic (+22/+18) tonB → / ← yciA membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase
RA 1,311,831 C→T 39.1% intergenic (+23/+17) tonB → / ← yciA membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase
RA 1,318,469 T→C 9.7% A440A (GCA→GCG) ‡ trpC ← indole‑3‑glycerolphosphate synthetase and N‑(5‑phosphoribosyl)anthranilate isomerase
RA 1,318,470 G→A 8.5% A440V (GCA→GTA) ‡ trpC ← indole‑3‑glycerolphosphate synthetase and N‑(5‑phosphoribosyl)anthranilate isomerase
RA 1,322,394 C→G 6.2% D185H (GAC→CAC)  trpE ← component I of anthranilate synthase
RA 1,322,396 A→T 6.3% I184N (ATT→AAT)  trpE ← component I of anthranilate synthase
RA 1,322,398 C→G 6.1% V183V (GTG→GTC)  trpE ← component I of anthranilate synthase
RA 1,324,836:1 +C 6.6% coding (91/1896 nt) yciQ → enhancer of membrane protein expression; putative inner membrane protein
RA 1,324,837 A→C 9.4% Y31S (TAT→TCT) ‡ yciQ → enhancer of membrane protein expression; putative inner membrane protein
RA 1,324,838 T→A 9.4% Y31* (TAT→TAA) ‡ yciQ → enhancer of membrane protein expression; putative inner membrane protein
RA 1,324,839 G→T 10.7% E32* (GAA→TAA)  yciQ → enhancer of membrane protein expression; putative inner membrane protein
RA 1,327,213 C→T 5.6% T121I (ACC→ATC)  rluB → 23S rRNA pseudouridine(2605) synthase
RA 1,327,216 A→G 5.1% D122G (GAT→GGT)  rluB → 23S rRNA pseudouridine(2605) synthase
RA 1,346,764 A→C 7.0% intergenic (‑22/‑32) gmr ← / → ymiB cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein
RA 1,346,770 G→C 8.2% intergenic (‑28/‑26) gmr ← / → ymiB cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein
RA 1,346,776 G→T 8.6% intergenic (‑34/‑20) gmr ← / → ymiB cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein
RA 1,351,222 T→G 6.2% intergenic (‑183/+185) fabI ← / ← ycjD enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/DUF559 family endonuclease‑related protein
RA 1,359,877 C→A 5.4% Q344H (CAG→CAT) ‡ puuA ← glutamate‑‑putrescine ligase
RA 1,359,878 T→G 5.2% Q344P (CAG→CCG) ‡ puuA ← glutamate‑‑putrescine ligase
RA 1,388,283 C→T 26.1% intergenic (+22/+22) tyrR → / ← tpx aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase
RA 1,388,284 A→T 26.6% intergenic (+23/+21) tyrR → / ← tpx aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase
RA 1,388,285 A→G 27.0% intergenic (+24/+20) tyrR → / ← tpx aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase
RA 1,410,986 A→G 10.8% intergenic (+102/+27) dbpA → / ← ttcA ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein
RA 1,410,990 T→A 10.4% intergenic (+106/+23) dbpA → / ← ttcA ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein
RA 1,410,991 T→A 10.5% intergenic (+107/+22) dbpA → / ← ttcA ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein
RA 1,410,995 C→T 10.5% intergenic (+111/+18) dbpA → / ← ttcA ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein
RA 1,413,029 G→C 6.1% S69R (AGC→AGG) ‡ intR ← Rac prophage; integrase
RA 1,413,031 T→A 6.1% S69C (AGC→TGC) ‡ intR ← Rac prophage; integrase
RA 1,413,033 G→C 6.0% S68C (TCC→TGC)  intR ← Rac prophage; integrase
RA 1,426,178 A→T 5.0% intergenic (+96/‑276) ydaY → / → tmpR pseudogene, Rac prophage;Phage or Prophage Related/Rac prophage; pseudogene, tail protein family;Phage or Prophage Related; putative alpha helix protein
RA 1,445,616 G→C 6.3% A856P (GCA→CCA)  ydbH → putative membrane‑anchored protein, function unknown
RA 1,445,621 G→C 6.5% W857C (TGG→TGC)  ydbH → putative membrane‑anchored protein, function unknown
RA 1,449,050 T→A 25.0% intergenic (+32/+26) feaB → / ← tynA phenylacetaldehyde dehydrogenase/tyramine oxidase, copper‑requiring
RA 1,462,028 G→A 5.0% G379D (GGT→GAT)  paaJ → 3‑oxoadipyl‑CoA/3‑oxo‑5,6‑dehydrosuberyl‑CoA thiolase
RA 1,517,481 C→G 8.9% R31R (CGC→CGG)  ydcX → DUF2566 family protein
RA 1,517,484 C→G 9.0% I32M (ATC→ATG)  ydcX → DUF2566 family protein
RA 1,530,490 T→C 7.3% intergenic (+86/‑96) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,530,496 G→T 7.3% intergenic (+92/‑90) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,530,499 A→C 7.3% intergenic (+95/‑87) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,552,388 T→C 5.3% intergenic (+397/+10) fdnI → / ← yddM formate dehydrogenase‑N, cytochrome B556 (gamma) subunit, nitrate‑inducible/putative DNA‑binding transcriptional regulator
RA 1,579,563 G→T 5.2% intergenic (‑221/+70) yddA ← / ← ydeM putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme
RA 1,579,564 G→A 5.3% intergenic (‑222/+69) yddA ← / ← ydeM putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme
RA 1,579,569 T→C 5.3% intergenic (‑227/+64) yddA ← / ← ydeM putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme
RA 1,585,149 Δ1 bp 7.0% coding (1338/2280 nt) ydeP ← putative oxidoreductase
RA 1,585,156:1 +C 6.8% coding (1331/2280 nt) ydeP ← putative oxidoreductase
RA 1,597,272 T→A 5.9% pseudogene (716/3861 nt) yneO ← pseudogene, AidA homolog
RA 1,603,724 A→C 6.1% T236P (ACC→CCC)  lsrC → autoinducer 2 import system permease protein
RA 1,603,735 G→T 5.7% G239G (GGG→GGT)  lsrC → autoinducer 2 import system permease protein
RA 1,609,555 Δ1 bp 9.2% coding (1126/1452 nt) uxaB ← altronate oxidoreductase, NAD‑dependent
RA 1,609,561:1 +C 8.6% coding (1120/1452 nt) uxaB ← altronate oxidoreductase, NAD‑dependent
RA 1,647,873 C→T 5.2% intergenic (‑23/‑61) dicC ← / → dicA Qin prophage; DNA‑binding transcriptional regulator for DicB/Qin prophage; putative regulator for DicB
RA 1,648,343 Δ1 bp 5.6% intergenic (+2/‑165) dicA → / → ydfA Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein
RA 1,648,348 C→T 5.5% intergenic (+7/‑160) dicA → / → ydfA Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein
RA 1,648,349 A→G 5.3% intergenic (+8/‑159) dicA → / → ydfA Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein
RA 1,657,895 A→T 5.6% intergenic (+25/‑174) ynfD → / → ynfE DUF1161 family periplasmic protein/putative selenate reductase, periplasmic
RA 1,660,194 A→C 8.5% K709T (AAG→ACG)  ynfE → putative selenate reductase, periplasmic
RA 1,660,198 T→A 8.4% A710A (GCT→GCA)  ynfE → putative selenate reductase, periplasmic
RA 1,660,200 C→G 8.5% A711G (GCC→GGC)  ynfE → putative selenate reductase, periplasmic
RA 1,660,202 T→A 8.5% C712S (TGC→AGC)  ynfE → putative selenate reductase, periplasmic
RA 1,660,206 G→T 8.0% R713L (CGT→CTT)  ynfE → putative selenate reductase, periplasmic
RA 1,660,438 A→G 5.6% S790S (TCA→TCG)  ynfE → putative selenate reductase, periplasmic
RA 1,660,442 C→G 5.6% L792V (CTG→GTG)  ynfE → putative selenate reductase, periplasmic
RA 1,660,446 C→T 5.3% A793V (GCG→GTG)  ynfE → putative selenate reductase, periplasmic
RA 1,664,584 Δ1 bp 14.6% coding (79/615 nt) dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,664,591 A→C 11.5% E29A (GAA→GCA) ‡ dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,664,592 A→T 11.5% E29D (GAA→GAT) ‡ dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,664,593 G→T 11.6% A30S (GCC→TCC)  dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,664,599:1 +T 9.2% coding (94/615 nt) dmsD → twin‑argninine leader‑binding protein for DmsA and TorA
RA 1,666,466 T→G 5.2% Y384* (TAT→TAG)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,666,468 A→T 5.4% Q385L (CAG→CTG)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,666,470 C→A 5.1% L386I (CTA→ATA)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,674,955 A→T 12.7% intergenic (+8/+17) tqsA → / ← pntB pheromone AI‑2 transporter/pyridine nucleotide transhydrogenase, beta subunit
RA 1,674,958 A→T 13.3% intergenic (+11/+14) tqsA → / ← pntB pheromone AI‑2 transporter/pyridine nucleotide transhydrogenase, beta subunit
RA 1,681,622 T→A 5.6% L216Q (CTG→CAG)  folM → dihydromonapterin reductase, NADPH‑dependent; dihydrofolate reductase isozyme
RA 1,698,585 T→G 8.3% E199A (GAA→GCA)  malI ← transcriptional repressor of Mal regulon
RA 1,698,587 T→A 8.4% A198A (GCA→GCT) ‡ malI ← transcriptional repressor of Mal regulon
RA 1,698,589 C→A 8.5% A198S (GCA→TCA) ‡ malI ← transcriptional repressor of Mal regulon
RA 1,702,495 C→G 5.1% A88G (GCC→GGC)  add → adenosine deaminase
RA 1,703,191 C→T 5.3% A320V (GCT→GTT)  add → adenosine deaminase
RA 1,703,251 A→T 47.1% intergenic (+17/+17) add → / ← ydgJ adenosine deaminase/putative oxidoreductase
RA 1,703,252 A→T 47.1% intergenic (+18/+16) add → / ← ydgJ adenosine deaminase/putative oxidoreductase
RA 1,703,593 A→G 5.8% I239T (ATC→ACC)  ydgJ ← putative oxidoreductase
RA 1,703,598 C→T 7.8% R237R (CGG→CGA)  ydgJ ← putative oxidoreductase
RA 1,707,226 T→A 5.0% L103* (TTA→TAA)  rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,707,755 T→A 5.1% A279A (GCT→GCA)  rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,736,097 T→A 7.4% intergenic (+138/+24) sodB → / ← ydhP superoxide dismutase, Fe/putative MFS transporter, inner membrane protein
RA 1,736,100 T→A 7.6% intergenic (+141/+21) sodB → / ← ydhP superoxide dismutase, Fe/putative MFS transporter, inner membrane protein
RA 1,764,687 T→C 13.8% intergenic (‑301/+26) sufA ← / ← rydB Fe‑S cluster assembly protein/novel sRNA, function unknown
RA 1,764,693 C→T 11.8% intergenic (‑307/+20) sufA ← / ← rydB Fe‑S cluster assembly protein/novel sRNA, function unknown
RA 1,764,694 G→C 11.8% intergenic (‑308/+19) sufA ← / ← rydB Fe‑S cluster assembly protein/novel sRNA, function unknown
RA 1,764,695 A→G 12.1% intergenic (‑309/+18) sufA ← / ← rydB Fe‑S cluster assembly protein/novel sRNA, function unknown
RA 1,764,701 G→A 13.5% intergenic (‑315/+12) sufA ← / ← rydB Fe‑S cluster assembly protein/novel sRNA, function unknown
RA 1,776,959 T→G 7.9% L458R (CTC→CGC)  ydiF → putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA 1,789,082 G→T 7.1% Q216H (CAG→CAT)  aroH → 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible
RA 1,789,083 A→C 7.6% M217L (ATG→CTG)  aroH → 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible
RA 1,792,240 T→A 26.5% intergenic (‑220/+27) ydiV ← / ← nlpC anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein
RA 1,792,241 A→T 36.4% intergenic (‑221/+26) ydiV ← / ← nlpC anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein
RA 1,792,242 T→A 36.4% intergenic (‑222/+25) ydiV ← / ← nlpC anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein
RA 1,797,388 G→T 9.3% P186Q (CCG→CAG)  pheT ← phenylalanine tRNA synthetase, beta subunit
RA 1,797,391 A→C 9.4% L185R (CTG→CGG)  pheT ← phenylalanine tRNA synthetase, beta subunit
RA 1,810,062 T→C 7.7% intergenic (+14/‑149) yniC → / → ydjM 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA
RA 1,823,338 G→C 14.7% intergenic (+53/‑177) nadE → / → cho NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair
RA 1,825,113 G→C 12.2% intergenic (‑176/+27) ves ← / ← spy cold‑ and stress‑inducible protein/periplasmic ATP‑independent protein refolding chaperone, stress‑induced
RA 1,827,811 T→G 7.9% K150T (AAA→ACA)  astB ← succinylarginine dihydrolase
RA 1,827,816 C→A 8.9% L148L (CTG→CTT)  astB ← succinylarginine dihydrolase
RA 1,850,715 Δ1 bp 18.2% intergenic (+22/‑145) sppA → / → ansA protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA 1,850,719:1 +T 18.2% intergenic (+26/‑141) sppA → / → ansA protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA 1,856,333 T→G 6.8% E199A (GAG→GCG) ‡ ydjH ← putative kinase
RA 1,856,334 C→A 6.5% E199* (GAG→TAG) ‡ ydjH ← putative kinase
RA 1,864,758 G→A 25.8% intergenic (+24/+24) yeaD → / ← yeaE D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent
RA 1,864,763 A→T 32.2% intergenic (+29/+19) yeaD → / ← yeaE D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent
RA 1,864,768 T→C 26.7% intergenic (+34/+14) yeaD → / ← yeaE D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent
RA 1,865,682 G→C 13.8% intergenic (‑46/+44) yeaE ← / ← mipA aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent/scaffolding protein for murein synthesizing machinery
RA 1,868,859 Δ1 bp 5.9% intergenic (+17/‑96) yeaG → / → yeaH protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein
RA 1,880,851 T→A 6.0% intergenic (‑92/+35) leuE ← / ← dmlR leucine efflux protein/transcriptional activator of dmlA
RA 1,880,852 T→A 6.1% intergenic (‑93/+34) leuE ← / ← dmlR leucine efflux protein/transcriptional activator of dmlA
RA 1,881,358 T→A 5.4% D151V (GAC→GTC)  dmlR ← transcriptional activator of dmlA
RA 1,890,943 T→C 100% T109A (ACC→GCC)  tsaB ← tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein; binding partner and protease for TsaD
RA 1,912,748 T→G 5.4% intergenic (‑172/+20) htpX ← / ← prc putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,912,749 T→A 5.7% intergenic (‑173/+19) htpX ← / ← prc putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,912,750 T→A 5.5% intergenic (‑174/+18) htpX ← / ← prc putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3
RA 1,914,846 A→T 8.0% L230Q (CTG→CAG)  proQ ← RNA chaperone, putative ProP translation regulator
RA 1,950,292 C→G 13.0% A77A (GCG→GCC)  aspS ← aspartyl‑tRNA synthetase
RA 1,950,295:1 +C 12.8% coding (228/1773 nt) aspS ← aspartyl‑tRNA synthetase
RA 1,950,301 Δ1 bp 12.8% coding (222/1773 nt) aspS ← aspartyl‑tRNA synthetase
RA 1,950,306 C→G 14.5% G73R (GGC→CGC)  aspS ← aspartyl‑tRNA synthetase
RA 1,954,256 T→A 7.9% I272N (ATT→AAT)  cmoB → tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent
RA 1,954,436 G→A 5.8% intergenic (+23/+142) cmoB → / ← torZ tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,954,437 C→A 5.8% intergenic (+24/+141) cmoB → / ← torZ tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent/trimethylamine N‑oxide reductase system III, catalytic subunit
MC JC 1,978,503 Δ776 bp 100% insB1–insA insB1, insA
RA 1,981,814 T→A 6.2% T192S (ACG→TCG)  otsB ← trehalose‑6‑phosphate phosphatase, biosynthetic
RA 1,981,815 T→A 6.2% R191R (CGA→CGT)  otsB ← trehalose‑6‑phosphate phosphatase, biosynthetic
RA 1,985,112 C→G 12.7% intergenic (‑43/+27) araG ← / ← araF L‑arabinose ABC transporter ATPase/L‑arabinose ABC transporter periplasmic binding protein
RA 1,988,048 A→T 5.4% intergenic (‑89/‑174) azuC ← / → yecR acid‑inducible small membrane‑associated protein/lipoprotein, function unknown
RA 1,988,049 C→T 5.4% intergenic (‑90/‑173) azuC ← / → yecR acid‑inducible small membrane‑associated protein/lipoprotein, function unknown
RA 1,988,050 A→G 5.9% intergenic (‑91/‑172) azuC ← / → yecR acid‑inducible small membrane‑associated protein/lipoprotein, function unknown
RA 1,988,051 A→T 5.9% intergenic (‑92/‑171) azuC ← / → yecR acid‑inducible small membrane‑associated protein/lipoprotein, function unknown
RA 1,991,866 T→A 10.2% noncoding (36/87 nt) leuZ ← tRNA‑Leu
RA 1,992,083 G→C 6.8% noncoding (35/76 nt) glyW ← tRNA‑Gly
RA 2,009,731 A→G 6.1% intergenic (+19/‑90) yedF → / → yedK putative TusA family sulfurtransferase/DUF159 family protein
RA 2,009,732 C→G 6.1% intergenic (+20/‑89) yedF → / → yedK putative TusA family sulfurtransferase/DUF159 family protein
RA 2,009,733 C→T 6.2% intergenic (+21/‑88) yedF → / → yedK putative TusA family sulfurtransferase/DUF159 family protein
RA 2,025,578 G→A 5.3% S23N (AGT→AAT) ‡ yedP → putative mannosyl‑3‑phosphoglycerate phosphatase
RA 2,025,579 T→C 5.2% S23S (AGT→AGC) ‡ yedP → putative mannosyl‑3‑phosphoglycerate phosphatase
RA 2,028,158 G→C 6.2% intergenic (‑141/+30) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,028,159 T→A 6.2% intergenic (‑142/+29) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,028,160 G→C 6.2% intergenic (‑143/+28) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,041,166 G→T 5.9% intergenic (+48/‑209) yedZ → / → zinT inner membrane heme subunit for periplasmic YedYZ reductase/zinc and cadmium binding protein, periplasmic
RA 2,041,167 A→C 5.9% intergenic (+49/‑208) yedZ → / → zinT inner membrane heme subunit for periplasmic YedYZ reductase/zinc and cadmium binding protein, periplasmic
RA 2,044,721 G→A 7.3% intergenic (+97/‑217) asnT → / → yeeJ tRNA‑Asn/putative adhesin
RA 2,050,006 C→G 5.8% T1690S (ACT→AGT)  yeeJ → putative adhesin
RA 2,057,595 T→C 22.2% intergenic (+21/+432) yeeN → / ← asnW UPF0082 family protein/tRNA‑Asn
RA 2,057,597 T→G 22.2% intergenic (+23/+430) yeeN → / ← asnW UPF0082 family protein/tRNA‑Asn
RA 2,057,599 T→A 22.2% intergenic (+25/+428) yeeN → / ← asnW UPF0082 family protein/tRNA‑Asn
RA 2,057,601 C→A 30.8% intergenic (+27/+426) yeeN → / ← asnW UPF0082 family protein/tRNA‑Asn
RA 2,057,603 G→A 30.8% intergenic (+29/+424) yeeN → / ← asnW UPF0082 family protein/tRNA‑Asn
RA 2,074,691 C→G 12.1% intergenic (+33/‑88) flu → / → yeeR CP4‑44 prophage; antigen 43 (Ag43) phase‑variable biofilm formation autotransporter/CP4‑44 prophage; putative membrane protein
RA 2,079,004 G→C 29.3% intergenic (+73/+28) yoeF → / ← yeeX pseudogene, CP4‑44 putative prophage remnant;Phage or Prophage Related/UPF0265 family protein
RA 2,089,854 A→T 10.6% intergenic (‑141/‑142) yefM ← / → hisL antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide
RA 2,090,122 A→G 26.3% intergenic (+76/‑70) hisL → / → hisG his operon leader peptide/ATP phosphoribosyltransferase
RA 2,090,124 C→G 24.4% intergenic (+78/‑68) hisL → / → hisG his operon leader peptide/ATP phosphoribosyltransferase
RA 2,090,126 C→T 25.6% intergenic (+80/‑66) hisL → / → hisG his operon leader peptide/ATP phosphoribosyltransferase
RA 2,103,105 C→A 11.1% pseudogene (285/446 nt) wbbL ← pseudogene, lipopolysaccharide biosynthesis protein
RA 2,103,106 T→A 11.3% pseudogene (284/446 nt) wbbL ← pseudogene, lipopolysaccharide biosynthesis protein
RA 2,103,107 T→G 11.3% pseudogene (283/446 nt) wbbL ← pseudogene, lipopolysaccharide biosynthesis protein
RA 2,115,839 A→C 6.8% F20V (TTC→GTC)  wcaM ← colanic acid biosynthesis protein
RA 2,115,847 G→T 8.7% A17E (GCG→GAG)  wcaM ← colanic acid biosynthesis protein
RA 2,115,849 C→G 8.7% S16S (TCG→TCC) ‡ wcaM ← colanic acid biosynthesis protein
RA 2,115,851 A→C 9.1% S16A (TCG→GCG) ‡ wcaM ← colanic acid biosynthesis protein
RA 2,115,859 G→T 7.0% T13K (ACG→AAG)  wcaM ← colanic acid biosynthesis protein
RA 2,141,796 G→C 5.3% Y140* (TAC→TAG)  dcd ← deoxycytidine triphosphate deaminase; dCTP deaminase
RA 2,141,799 G→C 5.3% F139L (TTC→TTG)  dcd ← deoxycytidine triphosphate deaminase; dCTP deaminase
RA 2,155,254 A→G 5.2% A413A (GCA→GCG)  mdtA → multidrug efflux system, subunit A
RA 2,155,255 C→T 5.2% R414C (CGC→TGC)  mdtA → multidrug efflux system, subunit A
RA 2,165,143 C→T 5.1% intergenic (+145/‑46) baeR → / → yegP response regulator in two‑component regulatory system with BaeS/UPF0339 family protein
RA 2,165,146 T→A 5.1% intergenic (+148/‑43) baeR → / → yegP response regulator in two‑component regulatory system with BaeS/UPF0339 family protein
RA 2,165,147 T→A 5.1% intergenic (+149/‑42) baeR → / → yegP response regulator in two‑component regulatory system with BaeS/UPF0339 family protein
RA 2,165,626 T→C 9.0% intergenic (+105/‑42) yegP → / → yegQ UPF0339 family protein/putative peptidase
RA 2,165,628 A→T 9.7% intergenic (+107/‑40) yegP → / → yegQ UPF0339 family protein/putative peptidase
RA 2,165,630 G→A 8.8% intergenic (+109/‑38) yegP → / → yegQ UPF0339 family protein/putative peptidase
RA 2,168,420 A→T 5.0% intergenic (‑114/‑292) yegR ← / → yegS uncharacterized protein/phosphatidylglycerol kinase, metal‑dependent
RA 2,168,423 A→T 7.6% intergenic (‑117/‑289) yegR ← / → yegS uncharacterized protein/phosphatidylglycerol kinase, metal‑dependent
RA 2,169,664 A→T 6.0% intergenic (+53/+29) yegS → / ← gatR phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted
RA 2,169,665 A→T 5.9% intergenic (+54/+28) yegS → / ← gatR phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted
RA 2,169,671 T→G 5.8% intergenic (+60/+22) yegS → / ← gatR phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted
RA 2,169,672 T→C 5.8% intergenic (+61/+21) yegS → / ← gatR phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted
RA 2,171,904 C→G 7.3% E324Q (GAA→CAA)  gatD ← galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding
RA 2,172,350 A→T 6.1% L175Q (CTG→CAG)  gatD ← galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding
RA 2,172,353 A→T 6.1% L174Q (CTG→CAG)  gatD ← galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding
RA 2,173,361 Δ2 bp 100% pseudogene (1‑2/442 nt) gatC ← pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,177,332 C→T 9.1% intergenic (‑128/+180) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,177,337 G→T 11.4% intergenic (‑133/+175) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,177,340 A→C 11.4% intergenic (‑136/+172) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,177,345 A→G 10.8% intergenic (‑141/+167) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,180,043 C→T 100% T408M (ACG→ATG)  yegT → nucleoside transporter, low affinity
RA 2,187,314 C→G 5.1% intergenic (+16/+66) rcnB → / ← yehA periplasmic modulator of Ni and Co efflux/putative fimbrial‑like adhesin protein
RA 2,252,810 T→G 7.0% intergenic (+22/+85) yeiI → / ← nupX putative kinase/nucleoside permease
RA 2,252,812 A→T 7.0% intergenic (+24/+83) yeiI → / ← nupX putative kinase/nucleoside permease
RA 2,252,814 C→A 7.6% intergenic (+26/+81) yeiI → / ← nupX putative kinase/nucleoside permease
RA 2,252,820 T→G 6.1% intergenic (+32/+75) yeiI → / ← nupX putative kinase/nucleoside permease
RA 2,252,821 T→C 6.1% intergenic (+33/+74) yeiI → / ← nupX putative kinase/nucleoside permease
RA 2,279,419 C→T 5.4% A114A (GCG→GCA)  bcr ← bicyclomycin/cysteine/sulfonamide efflux transporter
RA 2,279,422 A→G 5.4% A113A (GCT→GCC)  bcr ← bicyclomycin/cysteine/sulfonamide efflux transporter
RA 2,279,425 C→T 5.4% A112A (GCG→GCA)  bcr ← bicyclomycin/cysteine/sulfonamide efflux transporter
RA 2,286,139 A→T 8.6% intergenic (+3/‑72) yejM → / → proL essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro
RA 2,286,142 T→A 8.8% intergenic (+6/‑69) yejM → / → proL essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro
RA 2,286,145 A→T 7.8% intergenic (+9/‑66) yejM → / → proL essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro
RA 2,286,311 C→G 21.9% intergenic (+24/+79) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,286,313 T→A 21.3% intergenic (+26/+77) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,286,315 C→G 21.6% intergenic (+28/+75) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,304,522 G→T 9.0% intergenic (+129/+586) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,304,523 G→C 9.2% intergenic (+130/+585) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,305,013 A→G 6.5% intergenic (+620/+95) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,305,019 T→C 7.3% intergenic (+626/+89) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,305,085 A→G 30.5% intergenic (+692/+23) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,305,086 C→G 33.3% intergenic (+693/+22) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,305,087 C→T 33.3% intergenic (+694/+21) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,314,800 A→C 9.9% Q438P (CAG→CCG) ‡ rcsD → phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA 2,314,801 G→T 10.1% Q438H (CAG→CAT) ‡ rcsD → phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA 2,336,763 A→C 6.4% intergenic (‑119/+30) yfaA ← / ← gyrA DUF2138 family protein, putative host defense protein/DNA gyrase (type II topoisomerase), subunit A
RA 2,336,766 G→T 6.3% intergenic (‑122/+27) yfaA ← / ← gyrA DUF2138 family protein, putative host defense protein/DNA gyrase (type II topoisomerase), subunit A
RA 2,340,372 A→G 10.3% intergenic (+83/+45) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 2,340,373 A→C 10.6% intergenic (+84/+44) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 2,340,379 T→A 10.1% intergenic (+90/+38) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 2,340,380 T→A 10.1% intergenic (+91/+37) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 2,375,483 A→T 9.2% L160L (CTT→CTA) ‡ menC ← O‑succinylbenzoyl‑CoA synthase
RA 2,375,484 A→T 9.3% L160H (CTT→CAT) ‡ menC ← O‑succinylbenzoyl‑CoA synthase
RA 2,383,956 A→T 22.9% intergenic (+32/+39) elaD → / ← yfbK protease, capable of cleaving an AMC‑ubiquitin model substrate/Von Willebrand factor domain putative lipoprotein
RA 2,383,959 A→T 23.5% intergenic (+35/+36) elaD → / ← yfbK protease, capable of cleaving an AMC‑ubiquitin model substrate/Von Willebrand factor domain putative lipoprotein
RA 2,390,012 Δ1 bp 9.1% intergenic (+48/+36) yfbP → / ← nuoN TPR‑like repeats‑containing protein/NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,390,016:1 +C 9.2% intergenic (+52/+32) yfbP → / ← nuoN TPR‑like repeats‑containing protein/NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,391,414 C→G 5.4% R31P (CGA→CCA)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,391,417 C→G 5.2% W30S (TGG→TCG)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,416,941 A→G 7.6% intergenic (+50/‑140) pta → / → yfcC phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein
RA 2,416,943 C→G 7.3% intergenic (+52/‑138) pta → / → yfcC phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein
RA 2,416,945 C→T 7.6% intergenic (+54/‑136) pta → / → yfcC phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein
RA 2,425,968 T→G 7.0% intergenic (‑52/+38) hisQ ← / ← hisJ histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein
RA 2,425,971 C→A 7.3% intergenic (‑55/+35) hisQ ← / ← hisJ histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein
RA 2,425,975 A→G 7.1% intergenic (‑59/+31) hisQ ← / ← hisJ histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein
RA 2,432,985 A→G 7.1% intergenic (‑43/+27) folC ← / ← accD bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit
RA 2,432,990 G→C 7.0% intergenic (‑48/+22) folC ← / ← accD bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit
RA 2,432,995 C→T 8.8% intergenic (‑53/+17) folC ← / ← accD bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit
RA 2,449,162 T→A 6.2% intergenic (+5/+66) smrB → / ← yfcO putative DNA endonuclease/DUF2544 family putative outer membrane protein
RA 2,462,677 A→T 10.6% intergenic (+31/‑335) fadL → / → yfdF long‑chain fatty acid outer membrane transporter/uncharacterized protein
RA 2,462,678 T→A 10.9% intergenic (+32/‑334) fadL → / → yfdF long‑chain fatty acid outer membrane transporter/uncharacterized protein
RA 2,462,679 A→T 10.0% intergenic (+33/‑333) fadL → / → yfdF long‑chain fatty acid outer membrane transporter/uncharacterized protein
RA 2,474,878 T→C 7.7% intergenic (+22/‑106) yfdQ → / → yfdR CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein
RA 2,474,881 G→A 8.3% intergenic (+25/‑103) yfdQ → / → yfdR CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein
RA 2,483,900 T→A 5.5% V49D (GTC→GAC)  evgA → response regulator in two‑component regulatory system with EvgS
RA 2,493,562 T→A 9.7% intergenic (‑308/+205) frc ← / ← yfdX formyl‑CoA transferase, NAD(P)‑binding/uncharacterized protein
RA 2,493,563 T→A 9.7% intergenic (‑309/+204) frc ← / ← yfdX formyl‑CoA transferase, NAD(P)‑binding/uncharacterized protein
RA 2,504,200 T→C 5.4% T96A (ACG→GCG)  fryA ← putative PTS enzyme: Hpr, enzyme I and IIA components
RA 2,518,082 C→G 6.5% noncoding (35/76 nt) alaX ← tRNA‑Ala
RA 2,518,197 C→G 5.6% noncoding (35/76 nt) alaW ← tRNA‑Ala
RA 2,519,222 T→G 7.0% intergenic (+17/+35) yfeD → / ← gltX DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase
RA 2,519,225 T→A 7.0% intergenic (+20/+32) yfeD → / ← gltX DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase
RA 2,519,228 C→A 6.9% intergenic (+23/+29) yfeD → / ← gltX DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase
RA 2,521,344 C→T 37.5% intergenic (+16/+249) lysV → / ← xapR tRNA‑Lys/transcriptional activator of xapAB
RA 2,521,346 A→T 50.0% intergenic (+18/+247) lysV → / ← xapR tRNA‑Lys/transcriptional activator of xapAB
RA 2,521,348 A→G 50.0% intergenic (+20/+245) lysV → / ← xapR tRNA‑Lys/transcriptional activator of xapAB
RA 2,525,907 G→A 5.7% intergenic (+16/+23) yfeN → / ← yfeR putative outer membrane protein/transcriptional regulator of yefH
RA 2,525,908 C→G 5.5% intergenic (+17/+22) yfeN → / ← yfeR putative outer membrane protein/transcriptional regulator of yefH
RA 2,532,268 T→C 6.6% intergenic (+44/‑141) cysZ → / → cysK sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
RA 2,532,272 T→A 6.4% intergenic (+48/‑137) cysZ → / → cysK sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
RA 2,532,275 T→A 6.6% intergenic (+51/‑134) cysZ → / → cysK sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
RA 2,532,279 G→A 6.8% intergenic (+55/‑130) cysZ → / → cysK sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit
RA 2,549,533 G→C 7.4% intergenic (+127/+113) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,541 A→G 14.5% intergenic (+135/+105) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,542 A→C 14.5% intergenic (+136/+104) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,548 T→G 16.2% intergenic (+142/+98) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,549 C→A 15.9% intergenic (+143/+97) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,555 G→T 11.1% intergenic (+149/+91) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,556 C→T 11.8% intergenic (+150/+90) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,601 T→G 6.7% intergenic (+195/+45) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,608 T→C 7.7% intergenic (+202/+38) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,609 G→A 7.7% intergenic (+203/+37) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,549,616 C→A 8.0% intergenic (+210/+30) yfeW → / ← yfeX penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic
RA 2,550,574 C→G 8.2% intergenic (‑29/+67) yfeX ← / ← yfeY porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein
RA 2,550,576 A→T 8.2% intergenic (‑31/+65) yfeX ← / ← yfeY porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein
RA 2,550,578 C→G 8.7% intergenic (‑33/+63) yfeX ← / ← yfeY porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein
RA 2,555,201 T→C 5.3% intergenic (‑19/+27) eutR ← / ← eutK eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein
RA 2,555,202 G→C 5.6% intergenic (‑20/+26) eutR ← / ← eutK eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein
RA 2,555,205 G→C 5.1% intergenic (‑23/+23) eutR ← / ← eutK eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein
RA 2,555,206 G→A 5.1% intergenic (‑24/+22) eutR ← / ← eutK eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein
RA 2,560,317 A→C 8.5% N21H (AAT→CAT)  yffL → CPZ‑55 prophage; uncharacterized protein
RA 2,560,321 C→T 8.8% A22V (GCT→GTT)  yffL → CPZ‑55 prophage; uncharacterized protein
RA 2,560,326 A→G 6.6% T24A (ACA→GCA)  yffL → CPZ‑55 prophage; uncharacterized protein
RA 2,560,330 G→T 6.1% C25F (TGC→TTC)  yffL → CPZ‑55 prophage; uncharacterized protein
RA 2,561,205 A→T 5.6% intergenic (+307/‑163) yffL → / → yffM CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA 2,561,206 A→T 5.6% intergenic (+308/‑162) yffL → / → yffM CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA 2,566,266 C→A 7.3% G207C (GGC→TGC)  eutA ← reactivating factor for ethanolamine ammonia lyase
RA 2,566,267 T→G 7.5% A206A (GCA→GCC)  eutA ← reactivating factor for ethanolamine ammonia lyase
RA 2,566,490 C→T 8.4% G132D (GGT→GAT)  eutA ← reactivating factor for ethanolamine ammonia lyase
RA 2,566,493 G→C 8.3% A131G (GCC→GGC)  eutA ← reactivating factor for ethanolamine ammonia lyase
RA 2,566,496 A→G 8.5% I130T (ATC→ACC)  eutA ← reactivating factor for ethanolamine ammonia lyase
RA 2,568,191 T→C 13.9% intergenic (‑84/+133) eutH ← / ← eutG ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase
RA 2,568,199 A→G 12.6% intergenic (‑92/+125) eutH ← / ← eutG ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase
RA 2,568,204 G→T 13.1% intergenic (‑97/+120) eutH ← / ← eutG ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase
RA 2,579,154 A→C 9.8% A163A (GCA→GCC)  talA → transaldolase A
RA 2,579,157 G→T 10.1% R164R (CGG→CGT)  talA → transaldolase A
RA 2,581,762 G→A 14.7% A339V (GCC→GTC)  ypfG ← DUF1176 family protein
RA 2,581,765 T→C 15.0% D338G (GAC→GGC)  ypfG ← DUF1176 family protein
RA 2,589,122 G→A 5.7% G510S (GGC→AGC)  acrD → aminoglycoside/multidrug efflux system
RA 2,589,125 T→C 5.3% F511L (TTT→CTT)  acrD → aminoglycoside/multidrug efflux system
RA 2,590,767 T→C 9.0% intergenic (+59/+40) acrD → / ← ypfM aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein
RA 2,590,771 C→G 8.3% intergenic (+63/+36) acrD → / ← ypfM aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein
RA 2,590,775 G→A 8.3% intergenic (+67/+32) acrD → / ← ypfM aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein
RA 2,596,873 Δ1 bp 8.0% intergenic (‑136/+32) ypfJ ← / ← purC putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase
RA 2,596,878:1 +G 8.3% intergenic (‑141/+27) ypfJ ← / ← purC putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase
RA 2,620,216 C→T 21.0% intergenic (‑56/+30) uraA ← / ← upp uracil permease/uracil phosphoribosyltransferase
RA 2,620,218 T→A 21.1% intergenic (‑58/+28) uraA ← / ← upp uracil permease/uracil phosphoribosyltransferase
RA 2,620,220 A→G 25.0% intergenic (‑60/+26) uraA ← / ← upp uracil permease/uracil phosphoribosyltransferase
RA 2,622,348:1 +A 6.0% coding (115/639 nt) purN → phosphoribosylglycinamide formyltransferase 1
RA 2,622,354 Δ1 bp 6.0% coding (121/639 nt) purN → phosphoribosylglycinamide formyltransferase 1
RA 2,632,584 A→T 6.1% intergenic (‑49/+20) guaA ← / ← guaB GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase
RA 2,632,586 G→C 5.8% intergenic (‑51/+18) guaA ← / ← guaB GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase
RA 2,632,588 A→T 6.2% intergenic (‑53/+16) guaA ← / ← guaB GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase
RA 2,637,433 C→T 25.0% intergenic (‑77/+41) der ← / ← bamB GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein
RA 2,637,438 T→G 23.6% intergenic (‑82/+36) der ← / ← bamB GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein
RA 2,637,439 C→A 23.6% intergenic (‑83/+35) der ← / ← bamB GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein
RA 2,637,444 A→G 24.3% intergenic (‑88/+30) der ← / ← bamB GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein
RA 2,638,584 A→T 6.3% F23L (TTT→TTA)  bamB ← BamABCDE complex OM biogenesis lipoprotein
RA 2,652,131 G→T 6.4% P53T (CCG→ACG)  yfhM ← bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA 2,652,132 C→G 5.6% V52V (GTG→GTC) ‡ yfhM ← bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA 2,652,133 A→C 5.9% V52G (GTG→GGG) ‡ yfhM ← bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA 2,653,104 G→C 7.0% W204S (TGG→TCG) ‡ sseA → 3‑mercaptopyruvate sulfurtransferase
RA 2,653,105 G→C 6.9% W204C (TGG→TGC) ‡ sseA → 3‑mercaptopyruvate sulfurtransferase
RA 2,653,367 G→A 48.4% intergenic (+28/‑488) sseA → / → ryfA 3‑mercaptopyruvate sulfurtransferase/novel sRNA, function unknown
RA 2,653,372 T→C 42.4% intergenic (+33/‑483) sseA → / → ryfA 3‑mercaptopyruvate sulfurtransferase/novel sRNA, function unknown
RA 2,660,612 T→A 5.0% Y307F (TAC→TTC) ‡ iscS ← cysteine desulfurase (tRNA sulfurtransferase), PLP‑dependent
RA 2,660,613 A→C 5.2% Y307D (TAC→GAC) ‡ iscS ← cysteine desulfurase (tRNA sulfurtransferase), PLP‑dependent
RA 2,663,466 G→T 7.4% V9L (GTG→TTG)  suhB → inositol monophosphatase
RA 2,663,474 A→T 7.6% A11A (GCA→GCT)  suhB → inositol monophosphatase
RA 2,673,783 G→A 9.2% intergenic (+15/+33) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,673,784 C→A 9.3% intergenic (+16/+32) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,673,790 G→T 8.2% intergenic (+22/+26) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,673,791 A→C 8.2% intergenic (+23/+25) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,673,797 T→G 8.6% intergenic (+29/+19) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,673,798 T→C 8.6% intergenic (+30/+18) yphA → / ← yphB DoxX family inner membrane protein/mutarotase superfamily protein, YphB family
RA 2,691,169 A→T 8.9% noncoding (172/184 nt) glmY ← sRNA activator of glmS mRNA, glmZ processing antagonist
RA 2,691,171 T→A 9.0% noncoding (170/184 nt) glmY ← sRNA activator of glmS mRNA, glmZ processing antagonist
RA 2,691,173 A→T 9.3% noncoding (168/184 nt) glmY ← sRNA activator of glmS mRNA, glmZ processing antagonist
RA 2,704,304 A→G 27.6% intergenic (‑241/+31) rnc ← / ← lepB RNase III/leader peptidase (signal peptidase I)
RA 2,704,306 A→T 25.0% intergenic (‑243/+29) rnc ← / ← lepB RNase III/leader peptidase (signal peptidase I)
RA 2,704,308 C→T 23.5% intergenic (‑245/+27) rnc ← / ← lepB RNase III/leader peptidase (signal peptidase I)
RA 2,706,121:1 +T 10.1% coding (1004/1800 nt) lepA ← back‑translocating elongation factor EF4, GTPase
RA 2,706,134 Δ1 bp 9.9% coding (991/1800 nt) lepA ← back‑translocating elongation factor EF4, GTPase
RA 2,707,320 A→T 7.0% intergenic (‑196/+2) lepA ← / ← rseC back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component
RA 2,707,321 A→T 7.0% intergenic (‑197/+1) lepA ← / ← rseC back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component
RA 2,715,258 A→G 5.3% A21A (GCT→GCC) ‡ yfiE ← putative DNA‑binding transcriptional regulator
RA 2,715,259 G→C 5.3% A21G (GCT→GGT) ‡ yfiE ← putative DNA‑binding transcriptional regulator
RA 2,715,260 C→T 5.3% A21T (GCT→ACT) ‡ yfiE ← putative DNA‑binding transcriptional regulator
RA 2,716,030 T→G 14.1% intergenic (+20/+36) eamB → / ← grcA cysteine and O‑acetylserine exporter/autonomous glycyl radical cofactor
RA 2,716,033 C→A 16.9% intergenic (+23/+33) eamB → / ← grcA cysteine and O‑acetylserine exporter/autonomous glycyl radical cofactor
RA 2,720,209 T→C 9.5% L86P (CTG→CCG) ‡ pka → protein lysine acetyltransferase
RA 2,720,210 G→A 8.6% L86L (CTG→CTA) ‡ pka → protein lysine acetyltransferase
RA 2,724,095 C→A 6.2% intergenic (+13/‑33) pssA → / → yfiM phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein
RA 2,724,097 T→A 6.2% intergenic (+15/‑31) pssA → / → yfiM phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein
RA 2,724,099 T→G 6.2% intergenic (+17/‑29) pssA → / → yfiM phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein
RA 2,731,073 A→T 5.9% noncoding (85/1542 nt) rrsG ← 16S ribosomal RNA of rrnG operon
RA 2,731,074 A→T 5.8% noncoding (84/1542 nt) rrsG ← 16S ribosomal RNA of rrnG operon
RA 2,737,703 A→G 6.5% intergenic (+57/‑42) pheL → / → pheA pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein
RA 2,737,705 A→T 6.5% intergenic (+59/‑40) pheL → / → pheA pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein
RA 2,737,707 C→T 6.2% intergenic (+61/‑38) pheL → / → pheA pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein
RA 2,737,711 G→A 7.2% intergenic (+65/‑34) pheL → / → pheA pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein
RA 2,743,187 A→G 5.4% T269A (ACG→GCG) ‡ yfiN → putative membrane‑anchored diguanylate cyclase
RA 2,743,188 C→T 5.6% T269M (ACG→ATG) ‡ yfiN → putative membrane‑anchored diguanylate cyclase
RA 2,750,073 G→T 14.5% intergenic (+13/+42) yfjD → / ← grpE UPF0053 family inner membrane protein/heat shock protein
RA 2,750,078 T→G 16.3% intergenic (+18/+37) yfjD → / ← grpE UPF0053 family inner membrane protein/heat shock protein
RA 2,750,081 C→A 16.9% intergenic (+21/+34) yfjD → / ← grpE UPF0053 family inner membrane protein/heat shock protein
RA 2,750,086 A→C 16.2% intergenic (+26/+29) yfjD → / ← grpE UPF0053 family inner membrane protein/heat shock protein
RA 2,753,986 A→T 12.9% intergenic (+40/+22) bamE → / ← ratB lipoprotein component of BamABCDE OM biogenesis complex/UPF0125 family protein
RA 2,761,620 T→G 12.0% K641Q (AAG→CAG)  yfjK ← radiation resistance protein; DEAD/H helicase‑like protein; CP4‑57 putative defective prophage
RA 2,761,623 C→A 11.8% V640L (GTA→TTA)  yfjK ← radiation resistance protein; DEAD/H helicase‑like protein; CP4‑57 putative defective prophage
RA 2,767,667 T→G 28.6% intergenic (+312/‑43) rnlB → / → yfjP CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; 50S ribosome‑binding GTPase family protein
RA 2,767,670 C→A 30.0% intergenic (+315/‑40) rnlB → / → yfjP CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; 50S ribosome‑binding GTPase family protein
RA 2,768,609 T→C 8.0% intergenic (+36/‑56) yfjP → / → yfjQ CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein
RA 2,768,614 A→C 7.8% intergenic (+41/‑51) yfjP → / → yfjQ CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein
RA 2,768,615 G→T 7.8% intergenic (+42/‑50) yfjP → / → yfjQ CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein
RA 2,768,620 G→A 8.1% intergenic (+47/‑45) yfjP → / → yfjQ CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein
RA 2,775,085 T→C 5.3% intergenic (+64/‑460) yfjW → / → ypjI CP4‑57 prophage; putative inner membrane protein/pseudogene, CP4‑57 putative prophage remnant;Phage or Prophage Related
RA 2,775,089 T→A 5.2% intergenic (+68/‑456) yfjW → / → ypjI CP4‑57 prophage; putative inner membrane protein/pseudogene, CP4‑57 putative prophage remnant;Phage or Prophage Related
RA 2,777,571 A→G 6.1% D40G (GAC→GGC)  ypjF → CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system
RA 2,777,573 A→G 6.2% T41A (ACG→GCG) ‡ ypjF → CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system
RA 2,777,574 C→T 6.2% T41M (ACG→ATG) ‡ ypjF → CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system
RA 2,777,576 C→T 6.1% P42S (CCG→TCG)  ypjF → CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system
RA 2,798,703 G→C 6.5% intergenic (‑208/‑461) stpA ← / → alaE DNA binding protein, nucleoid‑associated/alanine exporter, alanine‑inducible, stress‑responsive
RA 2,800,515 C→A 6.8% intergenic (+40/‑208) ygaM → / → nrdH putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein
RA 2,800,517 T→A 6.5% intergenic (+42/‑206) ygaM → / → nrdH putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein
RA 2,800,519 T→G 6.2% intergenic (+44/‑204) ygaM → / → nrdH putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein
RA 2,801,056 A→T 12.8% N31I (AAT→ATT)  nrdI → NrdEF cluster assembly flavodoxin
RA 2,810,872 C→T 8.1% H35Y (CAC→TAC) ‡ mprA → transcriptional repressor of microcin B17 synthesis and multidrug efflux
RA 2,810,873 A→G 8.1% H35R (CAC→CGC) ‡ mprA → transcriptional repressor of microcin B17 synthesis and multidrug efflux
RA 2,814,174 T→A 6.7% intergenic (+20/+44) emrB → / ← luxS multidrug efflux system protein/S‑ribosylhomocysteine lyase
RA 2,814,175 T→A 6.7% intergenic (+21/+43) emrB → / ← luxS multidrug efflux system protein/S‑ribosylhomocysteine lyase
RA 2,814,829 C→T 5.2% noncoding (28/78 nt) micA → sRNA antisense regulator of ompA, lamB, ompX, and phoP; Hfq‑dependent
RA 2,814,840 A→G 8.6% noncoding (39/78 nt) micA → sRNA antisense regulator of ompA, lamB, ompX, and phoP; Hfq‑dependent
RA 2,822,673 C→T 11.7% intergenic (‑34/+35) recX ← / ← recA regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor
RA 2,822,678 G→T 10.8% intergenic (‑39/+30) recX ← / ← recA regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor
RA 2,822,679 A→C 10.9% intergenic (‑40/+29) recX ← / ← recA regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor
RA 2,822,684 A→G 10.6% intergenic (‑45/+24) recX ← / ← recA regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor
RA 2,823,838 C→A 7.4% intergenic (‑69/+11) recA ← / ← pncC DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor/nicotinamide‑nucleotide amidohydrolase; NMN amidohydrolase
RA 2,823,839 T→G 7.4% intergenic (‑70/+10) recA ← / ← pncC DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor/nicotinamide‑nucleotide amidohydrolase; NMN amidohydrolase
RA 2,838,222 A→T 5.7% intergenic (‑117/+32) hydN ← / ← ascG formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor
RA 2,859,332 T→G 6.7% L747R (CTC→CGC) ‡ mutS → methyl‑directed mismatch repair protein
RA 2,859,333 C→A 6.7% L747L (CTC→CTA) ‡ mutS → methyl‑directed mismatch repair protein
RA 2,866,487 G→C 24.2% intergenic (+22/+72) ygbN → / ← rpoS putative transporter/RNA polymerase, sigma S (sigma 38) factor
RA 2,866,488 G→C 24.2% intergenic (+23/+71) ygbN → / ← rpoS putative transporter/RNA polymerase, sigma S (sigma 38) factor
RA 2,873,915 A→G 8.4% H26H (CAT→CAC) ‡ cysC ← adenosine 5'‑phosphosulfate kinase
RA 2,873,917 G→C 8.2% H26D (CAT→GAT) ‡ cysC ← adenosine 5'‑phosphosulfate kinase
RA 2,873,919 C→T 8.3% G25D (GGT→GAT)  cysC ← adenosine 5'‑phosphosulfate kinase
RA 2,888,301 G→T 5.3% L4L (CTC→CTA)  cysH ← phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent
RA 2,888,820 T→C 6.1% Q427R (CAG→CGG)  cysI ← sulfite reductase, beta subunit, NAD(P)‑binding, heme‑binding
RA 2,888,823 G→A 6.4% P426L (CCG→CTG)  cysI ← sulfite reductase, beta subunit, NAD(P)‑binding, heme‑binding
RA 2,892,550 A→G 5.5% T113A (ACC→GCC) ‡ queD → 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS)
RA 2,892,551 C→G 5.2% T113S (ACC→AGC) ‡ queD → 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS)
RA 2,892,552 C→T 5.2% T113T (ACC→ACT) ‡ queD → 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS)
RA 2,906,502 T→A 9.0% G264G (GGT→GGA)  ygcG → TPM domain protein, putative phosphatase
RA 2,906,503 T→A 9.0% S265T (TCC→ACC)  ygcG → TPM domain protein, putative phosphatase
RA 2,908,486 G→C 7.7% A394G (GCC→GGC)  pyrG ← CTP synthetase
RA 2,917,895 G→A 5.3% intergenic (+82/+150) barA → / ← gudD hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1
RA 2,917,896 C→A 5.3% intergenic (+83/+149) barA → / ← gudD hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1
RA 2,917,909 T→G 11.8% intergenic (+96/+136) barA → / ← gudD hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1
RA 2,917,910 T→C 12.3% intergenic (+97/+135) barA → / ← gudD hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1
RA 2,933,401 A→C 5.1% V96V (GTT→GTG)  fucA ← L‑fuculose‑1‑phosphate aldolase
RA 2,937,044 Δ1 bp 6.0% coding (1461/1776 nt) fucI → L‑fucose isomerase
RA 2,937,048:1 +C 6.2% coding (1465/1776 nt) fucI → L‑fucose isomerase
RA 2,939,331 A→G 6.2% intergenic (+21/‑37) fucU → / → fucR L‑fucose mutarotase/l‑fucose operon activator
RA 2,939,333 G→C 6.1% intergenic (+23/‑35) fucU → / → fucR L‑fucose mutarotase/l‑fucose operon activator
RA 2,939,335 C→T 6.2% intergenic (+25/‑33) fucU → / → fucR L‑fucose mutarotase/l‑fucose operon activator
RA 2,971,146 T→C 6.9% intergenic (+13/‑125) ygdQ → / → ygdR UPF0053 family inner membrane protein/DUF903 family verified lipoprotein
RA 2,971,151 T→C 7.2% intergenic (+18/‑120) ygdQ → / → ygdR UPF0053 family inner membrane protein/DUF903 family verified lipoprotein
RA 2,971,154 G→A 7.0% intergenic (+21/‑117) ygdQ → / → ygdR UPF0053 family inner membrane protein/DUF903 family verified lipoprotein
RA 2,971,159 G→A 5.6% intergenic (+26/‑112) ygdQ → / → ygdR UPF0053 family inner membrane protein/DUF903 family verified lipoprotein
RA 2,976,320 T→G 5.5% noncoding (66/82 nt) omrB ← sRNA antisense regulator downregulates OM proteins and curli; positively regulated by OmpR/EnvZ, Hfq‑dependent
RA 2,976,321 C→A 5.6% noncoding (65/82 nt) omrB ← sRNA antisense regulator downregulates OM proteins and curli; positively regulated by OmpR/EnvZ, Hfq‑dependent
RA 2,980,742 A→G 30.0% intergenic (‑107/+22) ygeA ← / ← araE Asp/Glu_racemase family protein/arabinose transporter
RA 2,980,744 A→T 36.4% intergenic (‑109/+20) ygeA ← / ← araE Asp/Glu_racemase family protein/arabinose transporter
RA 2,980,746 C→T 36.4% intergenic (‑111/+18) ygeA ← / ← araE Asp/Glu_racemase family protein/arabinose transporter
RA 2,987,103 C→T 6.8% intergenic (+27/‑433) yqeG → / → yqeH putative transporter/putative LuxR family transcriptional regulator
RA 2,987,104 T→A 6.7% intergenic (+28/‑432) yqeG → / → yqeH putative transporter/putative LuxR family transcriptional regulator
RA 2,987,105 A→G 6.5% intergenic (+29/‑431) yqeG → / → yqeH putative transporter/putative LuxR family transcriptional regulator
RA 3,007,368 C→G 8.2% A369A (GCC→GCG)  ygeW → putative carbamoyltransferase
RA 3,007,466 T→C 10.7% intergenic (+14/‑44) ygeW → / → ygeX putative carbamoyltransferase/2,3‑diaminopropionate ammonia lyase, PLP‑dependent
RA 3,007,473 G→A 5.1% intergenic (+21/‑37) ygeW → / → ygeX putative carbamoyltransferase/2,3‑diaminopropionate ammonia lyase, PLP‑dependent
RA 3,020,510 G→T 13.3% intergenic (+21/‑30) ssnA → / → ygfM putative chlorohydrolase/aminohydrolase/putative oxidoreductase
RA 3,020,511 C→G 14.0% intergenic (+22/‑29) ssnA → / → ygfM putative chlorohydrolase/aminohydrolase/putative oxidoreductase
RA 3,020,512 A→C 14.3% intergenic (+23/‑28) ssnA → / → ygfM putative chlorohydrolase/aminohydrolase/putative oxidoreductase
RA 3,033,624 A→G 6.3% intergenic (+11/+33) idi → / ← lysS isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive
RA 3,033,627 T→A 6.4% intergenic (+14/+30) idi → / ← lysS isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive
RA 3,033,628 T→A 6.4% intergenic (+15/+29) idi → / ← lysS isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive
RA 3,033,631 C→T 6.4% intergenic (+18/+26) idi → / ← lysS isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive
RA 3,037,956 A→C 7.0% W51G (TGG→GGG)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,037,957 G→T 5.6% P50P (CCC→CCA)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,057,140 A→G 5.3% intergenic (+152/+38) sibC → / ← serA sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,145 G→C 5.3% intergenic (+157/+33) sibC → / ← serA sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,150 C→T 5.2% intergenic (+162/+28) sibC → / ← serA sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,059,703 A→T 5.9% intergenic (‑2/‑50) yqfE ← / → argP pseudogene, LysR family/transcriptional regulator for arginine transport and DNA replication genes; replication initiation inhibitor
RA 3,059,704 A→T 5.9% intergenic (‑3/‑49) yqfE ← / → argP pseudogene, LysR family/transcriptional regulator for arginine transport and DNA replication genes; replication initiation inhibitor
RA 3,061,817 G→C 5.7% W323S (TGG→TCG) ‡ scpA → methylmalonyl‑CoA mutase
RA 3,061,818 G→C 5.7% W323C (TGG→TGC) ‡ scpA → methylmalonyl‑CoA mutase
RA 3,066,293 T→C 6.1% D294G (GAC→GGC)  ygfI ← putative DNA‑binding transcriptional regulator
RA 3,066,299:1 +G 5.9% coding (875/897 nt) ygfI ← putative DNA‑binding transcriptional regulator
RA 3,066,319 Δ1 bp 6.7% coding (855/897 nt) ygfI ← putative DNA‑binding transcriptional regulator
RA 3,072,800 C→T 5.1% D298N (GAT→AAT)  epd ← D‑erythrose 4‑phosphate dehydrogenase
RA 3,072,802 A→T 5.1% V297D (GTC→GAC)  epd ← D‑erythrose 4‑phosphate dehydrogenase
RA 3,072,804 A→G 5.1% I296I (ATT→ATC)  epd ← D‑erythrose 4‑phosphate dehydrogenase
RA 3,090,226 T→C 5.7% C158R (TGC→CGC)  yggI → Zn‑dependent metalloprotease‑related protein
RA 3,090,229 G→A 5.8% G159S (GGT→AGT)  yggI → Zn‑dependent metalloprotease‑related protein
RA 3,095,151 T→C 5.1% A18A (GCT→GCC)  yggS → UPF0001 family protein, PLP‑binding
RA 3,095,164 G→A 5.0% G23S (GGC→AGC)  yggS → UPF0001 family protein, PLP‑binding
RA 3,101,541 G→C 6.3% P28R (CCG→CGG)  yggN ← DUF2884 family putative periplasmic protein
RA 3,156,590 C→A 14.7% intergenic (+72/‑33) yqhD → / → dkgA aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A
RA 3,156,591 T→G 14.2% intergenic (+73/‑32) yqhD → / → dkgA aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A
RA 3,166,154 T→C 5.1% Q522R (CAG→CGG) ‡ ygiS ← putative ABC transporter permease
RA 3,166,155 G→C 5.0% Q522E (CAG→GAG) ‡ ygiS ← putative ABC transporter permease
RA 3,169,260 Δ1 bp 5.8% intergenic (‑29/+24) ygiV ← / ← ygiW transcriptional repressor for mcbR biofilm gene/hydrogen peroxide and cadmium resistance periplasmic protein; stress‑induced OB‑fold protein
RA 3,171,852 C→T 7.4% intergenic (+19/+27) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,857 A→T 7.5% intergenic (+24/+22) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,858 A→T 7.5% intergenic (+25/+21) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,863 A→G 6.4% intergenic (+30/+16) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,172,436 T→G 5.1% intergenic (‑225/‑94) ygiZ ← / → mdaB inner membrane protein/NADPH quinone reductase
RA 3,180,497 Δ1 bp 10.6% coding (77/1161 nt) ygiC → ATP‑Grasp family ATPase
RA 3,180,505 G→T 12.2% E29* (GAG→TAG) ‡ ygiC → ATP‑Grasp family ATPase
RA 3,180,506 A→C 12.1% E29A (GAG→GCG) ‡ ygiC → ATP‑Grasp family ATPase
RA 3,180,513:1 +A 7.0% coding (93/1161 nt) ygiC → ATP‑Grasp family ATPase
RA 3,183,345:1 +T 15.7% intergenic (+22/+468) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,183,350 Δ1 bp 14.5% intergenic (+27/+463) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,183,768 A→G 5.7% intergenic (+445/+45) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,202,685 A→G 6.6% E265E (GAA→GAG)  cca → fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase
RA 3,202,686 C→T 7.0% L266F (CTC→TTC)  cca → fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase
RA 3,202,693 C→G 8.7% P268R (CCG→CGG)  cca → fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase
RA 3,239,609 T→G 5.7% intergenic (+64/‑335) alx → / → sstT putative membrane‑bound redox modulator/sodium:serine/threonine symporter
RA 3,239,610 C→G 5.6% intergenic (+65/‑334) alx → / → sstT putative membrane‑bound redox modulator/sodium:serine/threonine symporter
RA 3,239,611 C→A 5.6% intergenic (+66/‑333) alx → / → sstT putative membrane‑bound redox modulator/sodium:serine/threonine symporter
RA 3,256,441 T→G 5.2% T71P (ACG→CCG)  yhaM ← putative L‑serine dehydratase alpha chain
RA 3,256,442 G→C 5.7% G70G (GGC→GGG) ‡ yhaM ← putative L‑serine dehydratase alpha chain
RA 3,256,443 C→A 5.6% G70V (GGC→GTC) ‡ yhaM ← putative L‑serine dehydratase alpha chain
RA 3,256,450 C→T 6.4% V68I (GTT→ATT)  yhaM ← putative L‑serine dehydratase alpha chain
RA 3,258,251 T→A 6.9% intergenic (‑241/+34) yhaO ← / ← tdcG putative transporter/L‑serine dehydratase 3, anaerobic
RA 3,258,252 T→A 6.9% intergenic (‑242/+33) yhaO ← / ← tdcG putative transporter/L‑serine dehydratase 3, anaerobic
RA 3,269,815 C→G 5.8% intergenic (+213/+401) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,269,820 A→G 5.8% intergenic (+218/+396) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,270,080 C→T 6.5% intergenic (+478/+136) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,270,081 G→T 6.5% intergenic (+479/+135) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,270,082 A→C 6.1% intergenic (+480/+134) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,270,083 A→G 6.0% intergenic (+481/+133) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,271,825 T→A 7.8% intergenic (‑55/+42) garK ← / ← garR glycerate kinase I/tartronate semialdehyde reductase
RA 3,276,886 C→A 8.7% intergenic (+33/‑116) garD → / → prlF D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system
RA 3,276,887 T→C 8.6% intergenic (+34/‑115) garD → / → prlF D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system
RA 3,276,890 G→A 8.7% intergenic (+37/‑112) garD → / → prlF D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system
RA 3,276,891 T→G 8.8% intergenic (+38/‑111) garD → / → prlF D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system
RA 3,282,929 C→T 5.1% I318I (ATC→ATT)  agaS → tagatose‑6‑phosphate ketose/aldose isomerase
RA 3,288,032 C→A 17.4% intergenic (+22/‑58) yraH → / → yraI putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone
RA 3,288,033 T→G 16.0% intergenic (+23/‑57) yraH → / → yraI putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone
RA 3,309,004 C→T 7.1% intergenic (‑80/+29) nlpI ← / ← pnp lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA 3,309,009 C→T 6.6% intergenic (‑85/+24) nlpI ← / ← pnp lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA 3,309,012 A→G 7.3% intergenic (‑88/+21) nlpI ← / ← pnp lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA 3,318,079 A→T 7.8% intergenic (‑73/+134) rimP ← / ← metY ribosome maturation factor for 30S subunits/tRNA‑Met
RA 3,318,080 A→T 7.8% intergenic (‑74/+133) rimP ← / ← metY ribosome maturation factor for 30S subunits/tRNA‑Met
RA 3,318,088 C→T 5.9% intergenic (‑82/+125) rimP ← / ← metY ribosome maturation factor for 30S subunits/tRNA‑Met
RA 3,324,952 A→G 8.8% intergenic (‑41/+49) folP ← / ← ftsH 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo
RA 3,324,955 A→G 8.9% intergenic (‑44/+46) folP ← / ← ftsH 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo
RA 3,324,956 C→T 9.0% intergenic (‑45/+45) folP ← / ← ftsH 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo
RA 3,324,959 C→T 8.4% intergenic (‑48/+42) folP ← / ← ftsH 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo
RA 3,330,415 Δ1 bp 10.0% intergenic (+19/+167) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 3,330,419:1 +T 9.5% intergenic (+23/+163) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 3,332,822 G→A 50.0% intergenic (‑87/+40) yhbE ← / ← rpmA EamA family inner membrane putative transporter/50S ribosomal subunit protein L27
RA 3,332,823 T→C 50.0% intergenic (‑88/+39) yhbE ← / ← rpmA EamA family inner membrane putative transporter/50S ribosomal subunit protein L27
RA 3,333,057 C→T 5.7% L21L (CTG→CTA) ‡ rpmA ← 50S ribosomal subunit protein L27
RA 3,333,058 A→G 5.6% L21P (CTG→CCG) ‡ rpmA ← 50S ribosomal subunit protein L27
RA 3,334,703 A→G 8.9% intergenic (+22/‑206) ispB → / → sfsB octaprenyl diphosphate synthase/malPQ operon transcriptional activator
RA 3,334,704 G→C 9.2% intergenic (+23/‑205) ispB → / → sfsB octaprenyl diphosphate synthase/malPQ operon transcriptional activator
RA 3,334,705 C→T 8.5% intergenic (+24/‑204) ispB → / → sfsB octaprenyl diphosphate synthase/malPQ operon transcriptional activator
RA 3,354,537 C→G 9.9% intergenic (‑487/‑188) yhcC ← / → gltB putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit
RA 3,368,134 A→G 9.5% H103R (CAC→CGC)  yhcG → DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily
RA 3,368,142 A→T 13.3% M106L (ATG→TTG)  yhcG → DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily
RA 3,368,150 C→T 8.4% G108G (GGC→GGT)  yhcG → DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily
RA 3,368,982 G→C 11.2% intergenic (+28/+32) yhcG → / ← yhcH DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily/DUF386 family protein, cupin superfamily
RA 3,400,846 A→T 6.0% I81N (ATC→AAC)  mreB ← cell wall structural complex MreBCD, actin‑like component MreB
RA 3,400,849 A→T 5.9% V80D (GTT→GAT)  mreB ← cell wall structural complex MreBCD, actin‑like component MreB
RA 3,400,855 T→A 5.1% D78V (GAC→GTC)  mreB ← cell wall structural complex MreBCD, actin‑like component MreB
RA 3,407,293 T→A 19.6% intergenic (+27/‑82) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,407,294 T→A 19.6% intergenic (+28/‑81) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,407,295 T→A 19.6% intergenic (+29/‑80) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,423,620 A→G 5.7% noncoding (36/76 nt) thrV ← tRNA‑Thr
RA 3,423,621 C→G 5.8% noncoding (35/76 nt) thrV ← tRNA‑Thr
RA 3,423,622 C→T 5.8% noncoding (34/76 nt) thrV ← tRNA‑Thr
RA 3,439,588 G→C 61.1% intergenic (‑79/+28) yhdN ← / ← rplQ DUF1992 family protein/50S ribosomal subunit protein L17
RA 3,439,589 G→C 56.4% intergenic (‑80/+27) yhdN ← / ← rplQ DUF1992 family protein/50S ribosomal subunit protein L17
RA 3,441,060 T→C 10.9% K206E (AAG→GAG)  rpsD ← 30S ribosomal subunit protein S4
RA 3,441,061 G→C 10.6% S205S (TCC→TCG) ‡ rpsD ← 30S ribosomal subunit protein S4
RA 3,441,062 G→A 10.7% S205F (TCC→TTC) ‡ rpsD ← 30S ribosomal subunit protein S4
RA 3,448,050 C→A 5.3% G34C (GGC→TGC)  rplN ← 50S ribosomal subunit protein L14
RA 3,448,051 T→G 5.2% A33A (GCA→GCC)  rplN ← 50S ribosomal subunit protein L14
RA 3,451,404 T→G 5.9% D94A (GAC→GCC)  rplW ← 50S ribosomal subunit protein L23
RA 3,451,410 T→A 6.7% N92I (AAT→ATT)  rplW ← 50S ribosomal subunit protein L23
RA 3,471,357 C→T 11.2% intergenic (‑28/+43) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,471,361 T→G 9.0% intergenic (‑32/+39) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,471,362 C→A 8.5% intergenic (‑33/+38) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,471,366 A→G 8.5% intergenic (‑37/+34) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,477,878 T→A 13.8% intergenic (+20/+29) slyX → / ← slyD phi X174 lysis protein/FKBP‑type peptidyl prolyl cis‑trans isomerase (rotamase)
RA 3,560,455:1 +G 100% intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
RA 3,561,969 A→T 6.1% intergenic (‑146/‑44) glpE ← / → glpD thiosulfate:cyanide sulfurtransferase (rhodanese)/sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding
RA 3,561,972 A→T 6.1% intergenic (‑149/‑41) glpE ← / → glpD thiosulfate:cyanide sulfurtransferase (rhodanese)/sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding
RA 3,563,539 T→C 6.9% intergenic (+21/+248) glpD → / ← yzgL sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology
RA 3,563,546 T→G 7.7% intergenic (+28/+241) glpD → / ← yzgL sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology
RA 3,563,547 C→A 7.6% intergenic (+29/+240) glpD → / ← yzgL sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology
RA 3,563,554 G→A 5.6% intergenic (+36/+233) glpD → / ← yzgL sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology
RA 3,566,210 A→T 5.1% G124G (GGT→GGA) ‡ glgP ← glycogen phosphorylase
RA 3,566,212 C→G 5.1% G124R (GGT→CGT) ‡ glgP ← glycogen phosphorylase
RA 3,566,215 T→A 5.1% N123Y (AAC→TAC)  glgP ← glycogen phosphorylase
RA 3,566,218 C→G 5.1% G122R (GGT→CGT)  glgP ← glycogen phosphorylase
RA 3,566,220 A→T 5.6% L121H (CTC→CAC)  glgP ← glycogen phosphorylase
RA 3,569,431 A→G 6.3% I630T (ATT→ACT)  glgX ← glycogen debranching enzyme
RA 3,569,436 G→A 5.2% H628H (CAC→CAT)  glgX ← glycogen debranching enzyme
RA 3,577,657 A→G 5.6% intergenic (‑65/+74) gntK ← / ← gntR gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor
RA 3,577,660 C→T 5.7% intergenic (‑68/+71) gntK ← / ← gntR gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor
RA 3,594,071 T→C 5.4% T46A (ACG→GCG)  livG ← branched‑chain amino acid ABC transporter ATPase
RA 3,620,413 A→T 6.3% K408* (AAG→TAG) ‡ rhsB → Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
RA 3,620,414 A→C 6.1% K408T (AAG→ACG) ‡ rhsB → Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
RA 3,620,417 G→T 6.3% R409L (CGG→CTG)  rhsB → Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
RA 3,620,419 G→A 6.3% V410M (GTG→ATG)  rhsB → Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
RA 3,639,165 T→C 5.8% intergenic (+24/+220) pitA → / ← uspB phosphate transporter, low‑affinity; tellurite importer/universal stress (ethanol tolerance) protein B
RA 3,639,172 G→A 6.0% intergenic (+31/+213) pitA → / ← uspB phosphate transporter, low‑affinity; tellurite importer/universal stress (ethanol tolerance) protein B
RA 3,642,358 T→A 7.3% intergenic (+27/+22) dtpB → / ← rsmJ dipeptide and tripeptide permease B/16S rRNA m(2)G1516 methyltransferase, SAM‑dependent
RA 3,642,361 T→A 6.9% intergenic (+30/+19) dtpB → / ← rsmJ dipeptide and tripeptide permease B/16S rRNA m(2)G1516 methyltransferase, SAM‑dependent
RA 3,657,599 T→A 16.3% intergenic (+32/+387) hdeD → / ← arrS acid‑resistance membrane protein/antisense sRNA ArrS, function unknown
RA 3,657,601 G→C 16.4% intergenic (+34/+385) hdeD → / ← arrS acid‑resistance membrane protein/antisense sRNA ArrS, function unknown
RA 3,657,603 T→A 16.9% intergenic (+36/+383) hdeD → / ← arrS acid‑resistance membrane protein/antisense sRNA ArrS, function unknown
RA 3,676,195 A→G 5.3% intergenic (+87/+95) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,196 A→C 5.3% intergenic (+88/+94) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,202 T→G 5.3% intergenic (+94/+88) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,203 C→A 5.0% intergenic (+95/+87) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,209 G→T 5.5% intergenic (+101/+81) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,210 C→T 5.6% intergenic (+102/+80) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,676,271 A→T 6.4% intergenic (+163/+19) yhjE → / ← yhjG putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,702,835 G→A 7.6% L12L (CTG→TTG)  dppF ← dipeptide/heme ABC transporter ATPas
RA 3,702,837 G→C 7.6% P11R (CCG→CGG)  dppF ← dipeptide/heme ABC transporter ATPas
RA 3,702,839 T→C 8.0% Q10Q (CAA→CAG)  dppF ← dipeptide/heme ABC transporter ATPas
RA 3,704,135 A→T 5.3% I209I (ATT→ATA)  dppC ← dipeptide/heme ABC transporter permease
RA 3,704,138 A→T 5.4% F208L (TTT→TTA)  dppC ← dipeptide/heme ABC transporter permease
RA 3,708,595 G→A 23.1% intergenic (‑890/+21) dppA ← / ← proK dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro
RA 3,708,596 T→A 20.7% intergenic (‑891/+20) dppA ← / ← proK dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro
RA 3,708,597 T→C 20.7% intergenic (‑892/+19) dppA ← / ← proK dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro
RA 3,714,163:1 +T 11.1% coding (2232/2334 nt) bisC ← biotin sulfoxide reductase
RA 3,714,168 Δ1 bp 11.0% coding (2227/2334 nt) bisC ← biotin sulfoxide reductase
RA 3,720,294 T→C 6.0% intergenic (+33/+154) cspA → / ← hokA RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small
RA 3,720,299 T→A 6.5% intergenic (+38/+149) cspA → / ← hokA RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small
RA 3,720,300 T→A 6.5% intergenic (+39/+148) cspA → / ← hokA RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small
RA 3,720,305 G→A 6.2% intergenic (+44/+143) cspA → / ← hokA RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small
RA 3,729,405 C→G 5.3% intergenic (‑34/+38) xylB ← / ← xylA xylulokinase/D‑xylose isomerase
RA 3,729,408 C→G 5.5% intergenic (‑37/+35) xylB ← / ← xylA xylulokinase/D‑xylose isomerase
RA 3,732,139 G→T 5.0% intergenic (+16/‑62) xylF → / → xylG D‑xylose transporter subunit/D‑xylose ABC transporter dual domain ATPase
RA 3,736,322 G→T 6.0% intergenic (+165/+31) xylR → / ← bax xylose divergent operon transcriptional activator/putative glucosaminidase
RA 3,736,323 A→G 6.3% intergenic (+166/+30) xylR → / ← bax xylose divergent operon transcriptional activator/putative glucosaminidase
RA 3,736,324 C→T 6.2% intergenic (+167/+29) xylR → / ← bax xylose divergent operon transcriptional activator/putative glucosaminidase
RA 3,736,325 A→C 6.5% intergenic (+168/+28) xylR → / ← bax xylose divergent operon transcriptional activator/putative glucosaminidase
RA 3,747,168:1 +C 6.9% coding (85/1497 nt) lyxK → L‑xylulose kinase
RA 3,747,173 Δ1 bp 7.3% coding (90/1497 nt) lyxK → L‑xylulose kinase
RA 3,774,207 C→T 10.2% intergenic (+13/‑217) mtlA → / → mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
RA 3,774,214 C→T 10.0% intergenic (+20/‑210) mtlA → / → mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
RA 3,774,215 A→G 10.0% intergenic (+21/‑209) mtlA → / → mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
RA 3,774,222 A→G 9.5% intergenic (+28/‑202) mtlA → / → mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
RA 3,778,876 G→A 5.9% G493D (GGC→GAC)  lldP → L‑lactate permease
RA 3,778,879 T→C 5.7% V494A (GTC→GCC)  lldP → L‑lactate permease
RA 3,781,051 C→G 14.4% intergenic (+34/‑164) lldD → / → trmL L‑lactate dehydrogenase, FMN‑linked/tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent
RA 3,790,300 A→T 11.6% intergenic (‑219/+20) waaH ← / ← tdh LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,790,303 A→T 11.4% intergenic (‑222/+17) waaH ← / ← tdh LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,798,234 A→T 12.5% intergenic (+27/+5) waaL → / ← waaU O‑antigen ligase/lipopolysaccharide core biosynthesis
RA 3,798,235 A→T 12.5% intergenic (+28/+4) waaL → / ← waaU O‑antigen ligase/lipopolysaccharide core biosynthesis
RA 3,815,816 C→G 8.2% intergenic (‑48/+18) pyrE ← / ← rph orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH
RA 3,815,819 C→G 8.2% intergenic (‑51/+15) pyrE ← / ← rph orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH
RA 3,817,940 T→A 7.6% F61I (TTC→ATC)  dinD → DNA damage‑inducible protein
RA 3,817,948 G→T 8.1% E63D (GAG→GAT)  dinD → DNA damage‑inducible protein
RA 3,817,949 A→C 7.7% I64L (ATC→CTC)  dinD → DNA damage‑inducible protein
RA 3,817,957 T→A 5.9% D66E (GAT→GAA)  dinD → DNA damage‑inducible protein
RA 3,831,768 A→G 5.1% T438A (ACA→GCA)  yicH → putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,832,188 A→T 7.8% intergenic (+22/+31) yicH → / ← yicI putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase
RA 3,832,191 C→G 6.9% intergenic (+25/+28) yicH → / ← yicI putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase
RA 3,832,194 A→T 6.8% intergenic (+28/+25) yicH → / ← yicI putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase
RA 3,873,375 C→T 5.5% G80S (GGC→AGC)  dgoA ← 2‑oxo‑3‑deoxygalactonate 6‑phosphate aldolase
RA 3,877,558 G→C 60.0% intergenic (‑93/+147) yidB ← / ← gyrB DUF937 family protein/DNA gyrase, subunit B
RA 3,888,212 Δ1 bp 10.3% intergenic (+20/‑223) mnmE → / → tnaC tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide
RA 3,888,219 T→A 8.6% intergenic (+27/‑216) mnmE → / → tnaC tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide
RA 3,888,224:1 +A 6.0% intergenic (+32/‑211) mnmE → / → tnaC tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide
RA 3,891,502 C→G 11.3% intergenic (+19/‑113) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,504 T→A 10.2% intergenic (+21/‑111) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,506 C→G 5.4% intergenic (+23/‑109) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,908,435 T→G 5.3% intergenic (‑69/+114) pstB ← / ← pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA 3,908,436 C→A 5.3% intergenic (‑70/+113) pstB ← / ← pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA 3,908,442 G→T 5.0% intergenic (‑76/+107) pstB ← / ← pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA 3,908,443 C→G 5.0% intergenic (‑77/+106) pstB ← / ← pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA 3,923,717 G→A 7.0% intergenic (‑37/+27) rsmG ← / ← mnmG 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA 3,923,718 G→C 7.1% intergenic (‑38/+26) rsmG ← / ← mnmG 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA 3,923,719 G→C 7.1% intergenic (‑39/+25) rsmG ← / ← mnmG 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA 3,923,720 T→C 6.8% intergenic (‑40/+24) rsmG ← / ← mnmG 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA 3,938,255 T→A 5.9% L10Q (CTG→CAG)  rbsR → transcriptional repressor of ribose metabolism
RA 3,947,048 G→T 7.1% intergenic (+16/+80) trpT → / ← hdfR tRNA‑Trp/flhDC operon transcriptional repressor
RA 3,947,049 A→T 7.1% intergenic (+17/+79) trpT → / ← hdfR tRNA‑Trp/flhDC operon transcriptional repressor
RA 3,947,050 A→T 7.1% intergenic (+18/+78) trpT → / ← hdfR tRNA‑Trp/flhDC operon transcriptional repressor
RA 3,947,051 A→C 7.1% intergenic (+19/+77) trpT → / ← hdfR tRNA‑Trp/flhDC operon transcriptional repressor
RA 3,959,480 A→T 5.3% intergenic (+35/+52) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,959,481 C→G 5.3% intergenic (+36/+51) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,959,515 T→A 8.8% intergenic (+70/+17) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,959,924 A→T 10.5% intergenic (‑111/+88) ppiC ← / ← yifN peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene
RA 3,959,925 A→T 10.4% intergenic (‑112/+87) ppiC ← / ← yifN peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene
RA 3,959,926 A→T 10.5% intergenic (‑113/+86) ppiC ← / ← yifN peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene
RA 3,963,415 A→C 5.4% L272R (CTG→CGG) ‡ gpp ← guanosine pentaphosphatase/exopolyphosphatase
RA 3,963,416 G→T 5.3% L272M (CTG→ATG) ‡ gpp ← guanosine pentaphosphatase/exopolyphosphatase
RA 3,964,891 A→T 6.4% L247Q (CTG→CAG)  rhlB ← ATP‑dependent RNA helicase
RA 3,971,996 T→A 5.4% L246Q (CTG→CAG)  wecC → UDP‑N‑acetyl‑D‑mannosaminuronic acid dehydrogenase
RA 3,980,726 G→A 5.9% intergenic (+30/‑161) wecG → / → yifK UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter
RA 3,980,727 T→C 5.8% intergenic (+31/‑160) wecG → / → yifK UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter
RA 3,980,768 C→A 6.7% intergenic (+72/‑119) wecG → / → yifK UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter
RA 3,980,772 T→A 5.9% intergenic (+76/‑115) wecG → / → yifK UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter
RA 3,980,776 T→G 6.7% intergenic (+80/‑111) wecG → / → yifK UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter
RA 3,984,227 G→A 5.4% intergenic (+34/+125) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,984,228 C→A 5.4% intergenic (+35/+124) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,984,234 A→T 5.1% intergenic (+41/+118) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,984,235 A→T 5.1% intergenic (+42/+117) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,984,241 T→G 5.3% intergenic (+48/+111) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,984,242 T→C 5.3% intergenic (+49/+110) aslB → / ← aslA putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase
RA 3,991,334 T→A 5.6% I61N (ATT→AAT) ‡ cyaA → adenylate cyclase
RA 3,991,335 T→A 5.6% I61I (ATT→ATA) ‡ cyaA → adenylate cyclase
RA 4,000,230 A→G 7.5% intergenic (+85/+62) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,000,231 G→C 7.8% intergenic (+86/+61) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,000,237 T→A 7.8% intergenic (+92/+55) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,000,238 T→A 7.8% intergenic (+93/+54) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,000,244 G→C 5.3% intergenic (+99/+48) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,000,245 C→T 5.3% intergenic (+100/+47) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 4,015,333 A→T 5.4% intergenic (+19/+21) metE → / ← ysgA 5‑methyltetrahydropteroyltriglutamate‑ homocysteine S‑methyltransferase/putative carboxymethylenebutenolidase
RA 4,017,216:1 +A 14.9% intergenic (+24/‑117) udp → / → rmuC uridine phosphorylase/DNA recombination protein
RA 4,017,222 Δ1 bp 16.2% intergenic (+30/‑111) udp → / → rmuC uridine phosphorylase/DNA recombination protein
RA 4,040,661 G→A 17.6% intergenic (+25/+245) rrfA → / ← mobB 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,041,216 T→C 7.3% Q73R (CAG→CGG) ‡ mobB ← molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,041,217 G→A 7.3% Q73* (CAG→TAG) ‡ mobB ← molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,041,220 T→C 7.3% S72G (AGC→GGC)  mobB ← molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,041,221 G→A 7.2% A71A (GCC→GCT)  mobB ← molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,049,986 G→T 33.3% noncoding (88/109 nt) spf → Spot 42 sRNA antisense regulator of galK translation, Hfq‑dependent
RA 4,049,989 A→C 30.5% noncoding (91/109 nt) spf → Spot 42 sRNA antisense regulator of galK translation, Hfq‑dependent
RA 4,051,259 G→T 21.8% noncoding (224/245 nt) csrC → CsrC sRNA sequesters CsrA, a carbon flux regulator
RA 4,051,262 A→C 21.7% noncoding (227/245 nt) csrC → CsrC sRNA sequesters CsrA, a carbon flux regulator
RA 4,053,566:1 +A 10.0% intergenic (+148/+81) hemN → / ← yshB coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein
RA 4,053,569 A→C 9.5% intergenic (+151/+78) hemN → / ← yshB coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein
RA 4,053,570 G→T 9.3% intergenic (+152/+77) hemN → / ← yshB coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein
RA 4,053,573 Δ1 bp 8.7% intergenic (+155/+74) hemN → / ← yshB coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein
RA 4,060,261 G→T 20.8% intergenic (+31/‑186) typA → / → yihL GTP‑binding protein/putative DNA‑binding transcriptional regulator
RA 4,060,264 A→C 19.1% intergenic (+34/‑183) typA → / → yihL GTP‑binding protein/putative DNA‑binding transcriptional regulator
RA 4,062,371 A→T 7.2% N42I (AAT→ATT)  yihN → MFS transporter family protein
RA 4,062,811 C→A 6.7% L189M (CTG→ATG) ‡ yihN → MFS transporter family protein
RA 4,062,813 G→T 6.7% L189L (CTG→CTT) ‡ yihN → MFS transporter family protein
RA 4,062,814 A→C 6.9% N190H (AAT→CAT) ‡ yihN → MFS transporter family protein
RA 4,062,816 T→G 6.9% N190K (AAT→AAG) ‡ yihN → MFS transporter family protein
RA 4,070,410 C→A 12.7% intergenic (‑9/+105) yihR ← / ← yihS putative sulphoquinovose mutarotase/sulphoquinovose isomerase
RA 4,070,413 T→G 12.8% intergenic (‑12/+102) yihR ← / ← yihS putative sulphoquinovose mutarotase/sulphoquinovose isomerase
RA 4,071,615 T→C 5.7% T48A (ACC→GCC)  yihS ← sulphoquinovose isomerase
RA 4,071,616 G→A 5.7% G47G (GGC→GGT)  yihS ← sulphoquinovose isomerase
RA 4,088,091 G→C 14.6% intergenic (+34/+16) yiiG → / ← frvR DUF3829 family lipoprotein/putative frv operon regulator; contains a PTS EIIA domain
RA 4,095,838 C→A 5.1% E49* (GAA→TAA)  rhaA ← L‑rhamnose isomerase
RA 4,148,049 C→G 5.7% G90A (GGC→GCC)  yijO ← AraC family putative transcriptional activator
RA 4,168,349 A→G 8.8% intergenic (+149/‑23) rrsB → / → gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA 4,168,350 A→T 8.8% intergenic (+150/‑22) rrsB → / → gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA 4,168,351 C→T 8.7% intergenic (+151/‑21) rrsB → / → gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA 4,185,299 T→C 5.3% intergenic (+26/‑51) rpoB → / → rpoC RNA polymerase, beta subunit/RNA polymerase, beta prime subunit
RA 4,185,306 A→T 6.3% intergenic (+33/‑44) rpoB → / → rpoC RNA polymerase, beta subunit/RNA polymerase, beta prime subunit
RA 4,185,307 A→T 6.3% intergenic (+34/‑43) rpoB → / → rpoC RNA polymerase, beta subunit/RNA polymerase, beta prime subunit
RA 4,185,314 G→A 6.0% intergenic (+41/‑36) rpoB → / → rpoC RNA polymerase, beta subunit/RNA polymerase, beta prime subunit
RA 4,196,352 G→C 6.0% R153G (CGC→GGC)  rsd ← stationary phase protein, binds sigma 70 RNA polymerase subunit
RA 4,196,354 G→C 6.0% A152G (GCC→GGC)  rsd ← stationary phase protein, binds sigma 70 RNA polymerase subunit
RA 4,196,356 G→C 6.0% A151A (GCC→GCG)  rsd ← stationary phase protein, binds sigma 70 RNA polymerase subunit
RA 4,207,576 A→G 7.2% intergenic (‑44/‑571) purH ← / → rrsE IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase/16S ribosomal RNA of rrnE operon
RA 4,207,591 C→T 9.6% intergenic (‑59/‑556) purH ← / → rrsE IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase/16S ribosomal RNA of rrnE operon
RA 4,208,230 T→A 19.6% noncoding (84/1542 nt) rrsE → 16S ribosomal RNA of rrnE operon
RA 4,208,231 T→A 19.5% noncoding (85/1542 nt) rrsE → 16S ribosomal RNA of rrnE operon
RA 4,213,131 C→T 6.5% noncoding (92/120 nt) rrfE → 5S ribosomal RNA of rrnE operon
RA 4,218,447 A→G 8.1% intergenic (+34/‑149) aceA → / → aceK isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase
RA 4,218,448 A→C 7.9% intergenic (+35/‑148) aceA → / → aceK isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase
RA 4,218,454 T→G 8.3% intergenic (+41/‑142) aceA → / → aceK isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase
RA 4,218,455 C→A 8.2% intergenic (+42/‑141) aceA → / → aceK isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase
RA 4,223,855 G→A 5.2% A10T (GCG→ACG)  metH → homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,227,550 G→A 9.2% intergenic (+39/‑181) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,227,555 A→T 7.9% intergenic (+44/‑176) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,227,560 T→C 9.0% intergenic (+49/‑171) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,245,108 T→G 6.4% intergenic (‑33/+121) malF ← / ← malE maltose transporter subunit/maltose transporter subunit
RA 4,245,110 T→G 6.4% intergenic (‑35/+119) malF ← / ← malE maltose transporter subunit/maltose transporter subunit
RA 4,245,111 C→A 6.0% intergenic (‑36/+118) malF ← / ← malE maltose transporter subunit/maltose transporter subunit
RA 4,245,113 C→A 6.1% intergenic (‑38/+116) malF ← / ← malE maltose transporter subunit/maltose transporter subunit
RA 4,261,358 T→A 5.6% intergenic (+52/‑311) yjbM → / → dusA uncharacterized protein/tRNA‑dihydrouridine synthase A
RA 4,261,359 T→A 5.8% intergenic (+53/‑310) yjbM → / → dusA uncharacterized protein/tRNA‑dihydrouridine synthase A
RA 4,262,250 G→C 7.8% G194G (GGG→GGC)  dusA → tRNA‑dihydrouridine synthase A
RA 4,262,255 G→C 7.2% S196T (AGC→ACC)  dusA → tRNA‑dihydrouridine synthase A
RA 4,270,013 A→G 5.5% A200A (GCA→GCG)  aphA → acid phosphatase/phosphotransferase, class B, non‑specific
RA 4,274,740 G→A 13.4% intergenic (+79/+20) ssb → / ← yjcB single‑stranded DNA‑binding protein/putative inner membrane protein
RA 4,274,742 T→A 13.0% intergenic (+81/+18) ssb → / ← yjcB single‑stranded DNA‑binding protein/putative inner membrane protein
RA 4,274,744 T→C 13.0% intergenic (+83/+16) ssb → / ← yjcB single‑stranded DNA‑binding protein/putative inner membrane protein
RA 4,281,677 T→A 7.1% intergenic (+48/+106) yjcE → / ← yjcF putative cation/proton antiporter/pentapeptide repeats protein
RA 4,281,678 C→A 7.2% intergenic (+49/+105) yjcE → / ← yjcF putative cation/proton antiporter/pentapeptide repeats protein
RA 4,281,679 T→G 8.1% intergenic (+50/+104) yjcE → / ← yjcF putative cation/proton antiporter/pentapeptide repeats protein
RA 4,281,680 T→A 8.1% intergenic (+51/+103) yjcE → / ← yjcF putative cation/proton antiporter/pentapeptide repeats protein
RA 4,291,512 G→A 10.9% M1M (GTG→ATG) †‡ nrfE → heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE
RA 4,291,513 T→C 11.6% M1A (GTG→GCG) †‡ nrfE → heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE
RA 4,296,060 C→T 15.2% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,296,380:1 +CG 100% intergenic (+586/+56) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,307,294 A→T 8.8% L169Q (CTG→CAG)  alsK ← D‑allose kinase
RA 4,307,298 G→A 8.9% P168S (CCC→TCC)  alsK ← D‑allose kinase
RA 4,312,074 C→T 6.2% intergenic (‑32/+27) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,080 G→C 10.6% intergenic (‑38/+21) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,083 G→C 10.3% intergenic (‑41/+18) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,089 A→G 10.7% intergenic (‑47/+12) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,323,305 C→A 5.1% intergenic (‑75/+31) phnE ← / ← phnD defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein
RA 4,323,312 G→C 7.7% intergenic (‑82/+24) phnE ← / ← phnD defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein
RA 4,323,313 G→C 7.7% intergenic (‑83/+23) phnE ← / ← phnD defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein
RA 4,323,320 T→G 6.2% intergenic (‑90/+16) phnE ← / ← phnD defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein
RA 4,323,321 T→C 6.2% intergenic (‑91/+15) phnE ← / ← phnD defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein
RA 4,326,358 G→A 8.5% intergenic (‑617/+41) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,359 C→A 8.5% intergenic (‑618/+40) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,365 G→T 8.3% intergenic (‑624/+34) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,366 A→C 8.3% intergenic (‑625/+33) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,372 T→G 6.8% intergenic (‑631/+27) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,373 T→C 7.0% intergenic (‑632/+26) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,335,654 T→A 19.8% intergenic (‑64/+40) eptA ← / ← adiC lipid A phosphoethanolamine transferase/arginine:agmatine antiporter
RA 4,335,655 T→A 19.8% intergenic (‑65/+39) eptA ← / ← adiC lipid A phosphoethanolamine transferase/arginine:agmatine antiporter
RA 4,347,285 C→G 8.3% M14I (ATG→ATC)  fumB ← anaerobic class I fumarate hydratase (fumarase B)
RA 4,347,288 C→G 8.0% P13P (CCG→CCC)  fumB ← anaerobic class I fumarate hydratase (fumarase B)
RA 4,353,170 G→A 13.5% intergenic (+89/+30) ghoT → / ← lysU toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible
RA 4,353,171 C→G 17.0% intergenic (+90/+29) ghoT → / ← lysU toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible
RA 4,353,172 C→G 14.3% intergenic (+91/+28) ghoT → / ← lysU toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible
RA 4,353,173 T→C 15.0% intergenic (+92/+27) ghoT → / ← lysU toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible
RA 4,356,445 A→T 24.0% intergenic (‑34/+25) dtpC ← / ← cadA dipeptide and tripeptide permease/lysine decarboxylase, acid‑inducible
RA 4,356,446 A→T 24.0% intergenic (‑35/+24) dtpC ← / ← cadA dipeptide and tripeptide permease/lysine decarboxylase, acid‑inducible
RA 4,362,528 G→A 16.3% intergenic (‑175/+23) yjdQ ← / ← pheU pseudogene, P4‑like integrase remnant/tRNA‑Phe
RA 4,362,529 T→C 16.9% intergenic (‑176/+22) yjdQ ← / ← pheU pseudogene, P4‑like integrase remnant/tRNA‑Phe
RA 4,367,700 G→T 5.3% L210M (CTG→ATG)  aspA ← aspartate ammonia‑lyase
RA 4,367,701 G→C 5.1% I209M (ATC→ATG)  aspA ← aspartate ammonia‑lyase
RA 4,371,931 G→T 7.0% E303* (GAA→TAA) ‡ groL → Cpn60 chaperonin GroEL, large subunit of GroESL
RA 4,371,932 A→C 7.5% E303A (GAA→GCA) ‡ groL → Cpn60 chaperonin GroEL, large subunit of GroESL
RA 4,376,291 T→C 5.9% intergenic (+26/‑26) efp → / → ecnA polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B
RA 4,385,206 T→A 5.2% P456P (CCT→CCA)  yjeM → putative transporter
RA 4,385,207 G→C 5.2% V457L (GTG→CTG) ‡ yjeM → putative transporter
RA 4,385,208 T→A 5.2% V457E (GTG→GAG) ‡ yjeM → putative transporter
RA 4,398,563 T→C 5.1% S384S (AGT→AGC)  mutL → methyl‑directed mismatch repair protein
RA 4,398,566 T→G 5.1% R385R (CGT→CGG)  mutL → methyl‑directed mismatch repair protein
RA 4,398,567 C→A 5.0% P386T (CCG→ACG)  mutL → methyl‑directed mismatch repair protein
RA 4,408,758 T→C 9.0% L702P (CTG→CCG) ‡ rnr → exoribonuclease R, RNase R
RA 4,408,759 G→A 9.0% L702L (CTG→CTA) ‡ rnr → exoribonuclease R, RNase R
RA 4,409,402 Δ1 bp 6.3% coding (128/732 nt) rlmB → 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent
RA 4,409,407 T→A 9.2% S45T (TCT→ACT)  rlmB → 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent
RA 4,409,410:1 +A 8.7% coding (136/732 nt) rlmB → 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent
RA 4,422,895 C→G 5.5% A17G (GCC→GGC)  ulaE → L‑xylulose 5‑phosphate 3‑epimerase
RA 4,426,592 T→A 35.3% intergenic (+35/+36) rplI → / ← yjfZ 50S ribosomal subunit protein L9/uncharacterized protein
RA 4,439,845 T→A 14.5% intergenic (+52/+27) ytfK → / ← ytfL DUF1107 family protein/UPF0053 family inner membrane protein
RA 4,444,192 C→G 5.0% G27G (GGC→GGG)  tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,444,193 A→C 5.1% T28P (ACC→CCC)  tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,447,964 T→A 6.8% L24* (TTA→TAA)  ytfP → GGCT‑like protein
RA 4,470,951 A→C 11.4% intergenic (‑38/+35) ridA ← / ← pyrI enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit
RA 4,470,952 T→C 11.9% intergenic (‑39/+34) ridA ← / ← pyrI enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit
RA 4,470,957 G→A 12.1% intergenic (‑44/+29) ridA ← / ← pyrI enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit
RA 4,470,958 G→T 12.1% intergenic (‑45/+28) ridA ← / ← pyrI enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit
RA 4,479,012 A→T 13.6% intergenic (+123/+22) rraB → / ← yjgM protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase
RA 4,479,016 G→C 13.3% intergenic (+127/+18) rraB → / ← yjgM protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase
RA 4,479,020 A→T 13.6% intergenic (+131/+14) rraB → / ← yjgM protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase
RA 4,496,511 A→G 6.8% intergenic (+22/‑164) leuX → / → intB tRNA‑Leu/pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase
RA 4,496,512 C→T 6.8% intergenic (+23/‑163) leuX → / → intB tRNA‑Leu/pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase
RA 4,497,954 A→T 6.0% intergenic (+14/‑318) intB → / → insC1 pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA
RA 4,498,222 A→T 5.1% intergenic (+282/‑50) intB → / → insC1 pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA
RA 4,498,223 A→T 5.1% intergenic (+283/‑49) intB → / → insC1 pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA
RA 4,512,350:1 +G 9.1% coding (65/957 nt) fecD ← ferric citrate ABC transporter permease
RA 4,520,500 Δ1 bp 42.4% intergenic (‑176/+171) yjhU ← / ← yjhF putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter
RA 4,520,504:1 +T 42.4% intergenic (‑180/+167) yjhU ← / ← yjhF putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter
RA 4,532,534 G→C 6.9% A217G (GCC→GGC)  yjhP ← putative methyltransferase
RA 4,532,537 G→C 6.9% A216G (GCC→GGC)  yjhP ← putative methyltransferase
RA 4,548,914 G→C 9.5% G36A (GGT→GCT)  fimH → minor component of type 1 fimbriae
RA 4,548,917 G→C 9.9% G37A (GGC→GCC)  fimH → minor component of type 1 fimbriae
RA 4,548,920 G→C 10.4% S38T (AGC→ACC)  fimH → minor component of type 1 fimbriae
RA 4,549,932 T→A 11.0% intergenic (+222/+21) fimH → / ← gntP minor component of type 1 fimbriae/fructuronate transporter
RA 4,551,422 T→A 8.2% intergenic (‑126/‑214) gntP ← / → uxuA fructuronate transporter/mannonate hydrolase
RA 4,572,070 G→A 5.4% intergenic (+155/‑344) yjiS → / → yjiT DUF1127 family protein/pseudogene
RA 4,572,083:1 +G 5.2% intergenic (+168/‑331) yjiS → / → yjiT DUF1127 family protein/pseudogene
RA 4,572,086 T→C 5.3% intergenic (+171/‑328) yjiS → / → yjiT DUF1127 family protein/pseudogene
RA 4,573,188 G→A 5.4% pseudogene (775/1503 nt) yjiT → pseudogene
RA 4,612,329 A→G 15.8% intergenic (+40/‑82) ytjA → / → yjjU uncharacterized protein/putative patatin‑like family phospholipase
RA 4,612,330 G→C 15.1% intergenic (+41/‑81) ytjA → / → yjjU uncharacterized protein/putative patatin‑like family phospholipase
RA 4,612,331 C→T 15.1% intergenic (+42/‑80) ytjA → / → yjjU uncharacterized protein/putative patatin‑like family phospholipase
RA 4,620,090 C→T 5.3% T163I (ACC→ATC)  deoB → phosphopentomutase
RA 4,620,095 A→T 5.2% K165* (AAG→TAG) ‡ deoB → phosphopentomutase
RA 4,620,096 A→T 5.2% K165M (AAG→ATG) ‡ deoB → phosphopentomutase
RA 4,620,101 A→G 5.0% I167V (ATT→GTT)  deoB → phosphopentomutase
RA 4,631,643 A→G 5.2% D304G (GAC→GGC)  slt → lytic murein transglycosylase, soluble
RA 4,633,213 G→T 7.6% intergenic (+127/+20) trpR → / ← yjjX transcriptional repressor, tryptophan‑binding/non‑canonical purine NTP phosphatase, ITPase/XTPase
RA 4,633,216 A→C 7.6% intergenic (+130/+17) trpR → / ← yjjX transcriptional repressor, tryptophan‑binding/non‑canonical purine NTP phosphatase, ITPase/XTPase
RA 4,638,690 C→T 9.8% G171G (GGC→GGT)  creD → inner membrane protein
RA 4,638,691 A→G 9.6% T172A (ACC→GCC)  creD → inner membrane protein

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 707899 708106 208 37 [35] [35] 37 glnS/chiP glutamyl‑tRNA synthetase/chitoporin, uptake of chitosugars
* * ÷ NC_000913 3423782–3424522 3424522 1–741 37 [34] [35] 38 [rrfD]–[rrlD] [rrfD],[rrlD]
* * ÷ NC_000913 4304505 4304610 106 40 [35] [29] 36 ytcA/yjcS putative inner membrane efflux pump‑associated DUF1656 family protein/metallo‑beta‑lactamase superfamily protein

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 5590 =NA (NA)10 (0.060) 8/224 NT 15.2% noncoding (26/105 nt) RIP1 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP1 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 2304478 = 56 (0.320)noncoding (62/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 16653NA (NA)8 (0.050) 7/224 NT NA noncoding (1267/1345 nt) IS186 repeat region
?NC_000913 = 16691 NA (NA)noncoding (1305/1345 nt) IS186 repeat region
* ? NC_000913 = 68731258 (1.380)17 (0.100) 13/224 NT 6.7% coding (1318/1701 nt) araB L‑ribulokinase
?NC_000913 = 68753 234 (1.330)coding (1296/1701 nt) araB L‑ribulokinase
* ? NC_000913 88450 =201 (1.080)14 (0.080) 8/230 NT 7.0% coding (423/1005 nt) cra transcriptional repressor‑activator for carbon metabolism
?NC_000913 88491 = 180 (1.000)coding (464/1005 nt) cra transcriptional repressor‑activator for carbon metabolism
* ? NC_000913 103901 =202 (1.080)12 (0.070) 9/226 NT 5.8% coding (747/831 nt) ftsQ divisome assembly protein, membrane anchored protein involved in growth of wall at septum
?NC_000913 103941 = 199 (1.120)coding (787/831 nt) ftsQ divisome assembly protein, membrane anchored protein involved in growth of wall at septum
* ? NC_000913 111593 =89 (0.480)14 (0.080) 12/224 NT 12.0% noncoding (164/200 nt) RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site
?NC_000913 111626 = 121 (0.690)noncoding (197/200 nt) RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site
* ? NC_000913 = 12779678 (0.420)10 (0.060) 8/230 NT 11.2% intergenic (+209/‑116) aceF/lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
?NC_000913 = 127837 83 (0.460)intergenic (+250/‑75) aceF/lpd pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase
* ? NC_000913 148707 =139 (0.740)8 (0.040) 7/230 NT 5.7% coding (89/852 nt) panC pantothenate synthetase
?NC_000913 148742 = 128 (0.710)coding (54/852 nt) panC pantothenate synthetase
* ? NC_000913 183652 =137 (0.730)12 (0.070) 10/218 NT 8.1% intergenic (+32/+57) cdaR/yaeH carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein
?NC_000913 183685 = 147 (0.860)intergenic (+65/+24) cdaR/yaeH carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein
* ? NC_000913 = 183661150 (0.800)26 (0.150) 14/218 NT 15.5% intergenic (+41/+48) cdaR/yaeH carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein
?NC_000913 = 183674 147 (0.860)intergenic (+54/+35) cdaR/yaeH carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein
* ? NC_000913 = 190654137 (0.730)9 (0.050) 7/228 NT 6.6% intergenic (+55/‑203) rpsB/tsf 30S ribosomal subunit protein S2/translation elongation factor EF‑Ts
?NC_000913 = 190695 123 (0.690)intergenic (+96/‑162) rpsB/tsf 30S ribosomal subunit protein S2/translation elongation factor EF‑Ts
* ? NC_000913 193444 =45 (0.240)5 (0.030) 4/218 NT 10.3% intergenic (+15/‑77) frr/dxr ribosome recycling factor/1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase
?NC_000913 193489 = 46 (0.270)intergenic (+60/‑32) frr/dxr ribosome recycling factor/1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase
* ? NC_000913 200763 =185 (0.990)16 (0.090) 10/226 NT 8.5% coding (282/486 nt) skp periplasmic chaperone
?NC_000913 200790 = 168 (0.950)coding (309/486 nt) skp periplasmic chaperone
* ? NC_000913 223936 =NA (NA)6 (0.030) 5/222 NT NA noncoding (166/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 224021 = NA (NA)noncoding (251/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 224380 =NA (NA)10 (0.060) 9/230 NT NA noncoding (610/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 224400 = NA (NA)noncoding (630/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 224539 =NA (NA)10 (0.060) 6/226 NT NA noncoding (769/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 224581 = NA (NA)noncoding (811/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225078 =NA (NA)39 (0.220) 22/224 NT NA noncoding (1308/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 225100 = NA (NA)noncoding (1330/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 227242 =NA (NA)20 (0.110) 11/226 NT NA noncoding (1484/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 227264 = NA (NA)noncoding (1506/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 227400NA (NA)4 (0.020) 4/230 NT NA noncoding (1642/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 227485 NA (NA)noncoding (1727/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 227444NA (NA)13 (0.070) 11/228 NT NA noncoding (1686/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 227459 NA (NA)noncoding (1701/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228108NA (NA)49 (0.270) 24/230 NT NA noncoding (2350/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228124 NA (NA)noncoding (2366/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228224NA (NA)11 (0.060) 10/226 NT NA noncoding (2466/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228241 NA (NA)noncoding (2483/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 228359 =NA (NA)5 (0.030) 5/226 NT NA noncoding (2601/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 228397 = NA (NA)noncoding (2639/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 274038 =NA (NA)13 (0.070) 10/226 NT NA noncoding (1112/1195 nt) IS5 repeat region
?NC_000913 274083 = NA (NA)noncoding (1067/1195 nt) IS5 repeat region
* ? NC_000913 274384 =NA (NA)10 (0.050) 8/232 NT NA noncoding (766/1195 nt) IS5 repeat region
?NC_000913 274422 = NA (NA)noncoding (728/1195 nt) IS5 repeat region
* ? NC_000913 274620 =NA (NA)9 (0.050) 7/220 NT NA noncoding (530/1195 nt) IS5 repeat region
?NC_000913 274663 = NA (NA)noncoding (487/1195 nt) IS5 repeat region
* ? NC_000913 = 274724NA (NA)5 (0.030) 4/232 NT NA noncoding (426/1195 nt) IS5 repeat region
?NC_000913 = 274784 NA (NA)noncoding (366/1195 nt) IS5 repeat region
* ? NC_000913 277707 =NA (NA)6 (0.030) 6/224 NT 5.4% noncoding (33/67 nt) REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 277738 = 106 (0.600)noncoding (64/67 nt) REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 315689NA (NA)4 (0.020) 4/232 NT NA noncoding (461/1255 nt) IS3 repeat region
?NC_000913 = 315751 NA (NA)noncoding (523/1255 nt) IS3 repeat region
* ? NC_000913 = 315852NA (NA)12 (0.070) 7/230 NT NA noncoding (624/1255 nt) IS3 repeat region
?NC_000913 = 315875 NA (NA)noncoding (647/1255 nt) IS3 repeat region
* ? NC_000913 316193 =NA (NA)4 (0.020) 4/220 NT NA noncoding (965/1255 nt) IS3 repeat region
?NC_000913 316230 = NA (NA)noncoding (1002/1255 nt) IS3 repeat region
* ? NC_000913 = 381669NA (NA)6 (0.030) 6/224 NT NA noncoding (410/1331 nt) IS2 repeat region
?NC_000913 = 381695 NA (NA)noncoding (436/1331 nt) IS2 repeat region
* ? NC_000913 382110 =NA (NA)16 (0.090) 10/228 NT NA noncoding (851/1331 nt) IS2 repeat region
?NC_000913 382141 = NA (NA)noncoding (882/1331 nt) IS2 repeat region
* ? NC_000913 = 40362672 (0.390)4 (0.020) 4/220 NT 5.0% intergenic (+25/‑77) psiF/yaiC PsiF family protein/diguanylate cyclase, cellulose regualtor
?NC_000913 = 403636 85 (0.490)intergenic (+35/‑67) psiF/yaiC PsiF family protein/diguanylate cyclase, cellulose regualtor
* ? NC_000913 421005 =90 (0.480)8 (0.050) 5/222 NT 7.5% coding (20/1374 nt) proY proline‑specific permease
?NC_000913 421041 = 114 (0.660)coding (56/1374 nt) proY proline‑specific permease
* ? NC_000913 483821 =171 (0.920)9 (0.050) 9/224 NT 5.0% coding (583/3150 nt) acrB multidrug efflux system protein
?NC_000913 483883 = 179 (1.020)coding (521/3150 nt) acrB multidrug efflux system protein
* ? NC_000913 = 668251180 (0.960)18 (0.100) 11/220 NT 9.4% coding (465/468 nt) rlmH 23S rRNA m(3)Psi1915 pseudouridine methyltransferase, SAM‑dependent
?NC_000913 = 668256 179 (1.040)coding (460/468 nt) rlmH 23S rRNA m(3)Psi1915 pseudouridine methyltransferase, SAM‑dependent
* ? NC_000913 762803 =NA (NA)10 (0.060)
+CTACG
4/228 NT 30.3% noncoding (42/167 nt) REP68 (repetitive extragenic palindromic) element; contains 4 REP sequences REP68 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 3708527 = 24 (0.130)intergenic (‑822/+89) dppA/proK dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro
* ? NC_000913 791792 =107 (0.570)10 (0.060) 8/226 NT 8.3% coding (264/1017 nt) galE UDP‑galactose‑4‑epimerase
?NC_000913 791819 = 118 (0.670)coding (237/1017 nt) galE UDP‑galactose‑4‑epimerase
* ? NC_000913 = 937227NA (NA)11 (0.060) 10/222 NT NA noncoding (4/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 937259 NA (NA)noncoding (36/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 1121419 =92 (0.490)6 (0.030) 6/226 NT 6.6% coding (69/246 nt) dinI DNA damage‑inducible protein I
?NC_000913 1121450 = 82 (0.460)coding (38/246 nt) dinI DNA damage‑inducible protein I
* ? NC_000913 1182645 =169 (0.910)14 (0.080) 9/224 NT 8.4% coding (185/1047 nt) potD spermidine/putrescine ABC transporter periplasmic binding protein
?NC_000913 1182663 = 145 (0.830)coding (167/1047 nt) potD spermidine/putrescine ABC transporter periplasmic binding protein
* ? NC_000913 1207790 =54 (0.290)140 (0.870) 89/206 NT 76.2% coding (290/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 1209619 = 41 (0.250)pseudogene (1/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 120780555 (0.290)85 (0.530) 57/206 NT 65.8% coding (305/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 = 1209602 41 (0.250)pseudogene (18/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 12994980 (0.000)90 (0.500) 72/230 NT 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913 1396531 =NA (NA)7 (0.040) 7/226 NT NA noncoding (488/1195 nt) IS5 repeat region
?NC_000913 = 1428264 NA (NA)noncoding (531/1196 nt) IS5 repeat region
* ? NC_000913 = 1468681NA (NA)4 (0.020)
+GGTTATCGTCGGG
4/212 NT NA noncoding (560/1331 nt) IS2 repeat region
?NC_000913 1650843 = NA (NA)noncoding (1/706 nt) IS2 repeat region
* ? NC_000913 1490218 =150 (0.800)10 (0.060) 6/224 NT 6.4% pseudogene (496/750 nt) gapC pseudogene, GAP dehydrogenase; glyceraldehyde‑3‑phosphate dehydrogenase (second fragment)
?NC_000913 1490258 = 151 (0.860)pseudogene (456/750 nt) gapC pseudogene, GAP dehydrogenase; glyceraldehyde‑3‑phosphate dehydrogenase (second fragment)
* ? NC_000913 1570641 =107 (0.570)6 (0.040)
+ATAACGTTGTAAA
5/212 NT 9.5% intergenic (‑152/+4) gadC/gadB glutamate:gamma‑aminobutyric acid antiporter/glutamate decarboxylase B, PLP‑dependent
?NC_000913 3666120 = 22 (0.120)intergenic (‑310/+60) gadX/gadA acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent
* ? NC_000913 = 162941137 (0.200)4 (0.020) 4/226 NT 10.1% coding (197/204 nt) ydfZ selenoprotein, function unknown
?NC_000913 = 1629426 36 (0.200)intergenic (+8/+27) ydfZ/ydfI selenoprotein, function unknown/putative NAD‑dependent D‑mannonate oxidoreductase
* ? NC_000913 1657831 =131 (0.700)8 (0.040) 8/230 NT 5.9% coding (267/306 nt) ynfD DUF1161 family periplasmic protein
?NC_000913 1657858 = NA (NA)coding (294/306 nt) ynfD DUF1161 family periplasmic protein
* ? NC_000913 1697230 =145 (0.780)7 (0.040) 6/214 NT 5.9% intergenic (‑178/+43) uidR/hdhA transcriptional repressor/7‑alpha‑hydroxysteroid dehydrogenase, NAD‑dependent
?NC_000913 1697261 = 93 (0.550)intergenic (‑209/+12) uidR/hdhA transcriptional repressor/7‑alpha‑hydroxysteroid dehydrogenase, NAD‑dependent
* ? NC_000913 1713804 =201 (1.080)12 (0.070) 12/232 NT 5.9% coding (1036/1503 nt) dtpA dipeptide and tripeptide permease A
?NC_000913 1713842 = 185 (1.020)coding (1074/1503 nt) dtpA dipeptide and tripeptide permease A
* ? NC_000913 1787626 =146 (0.780)8 (0.040) 8/228 NT 5.9% coding (182/834 nt) ppsR PEP synthase kinase and PEP synthase pyrophosphorylase
?NC_000913 1787651 = 115 (0.640)coding (207/834 nt) ppsR PEP synthase kinase and PEP synthase pyrophosphorylase
* ? NC_000913 1846862 =96 (0.510)5 (0.030) 4/224 NT 5.0% coding (99/1962 nt) topB DNA topoisomerase III
?NC_000913 1846899 = 98 (0.560)coding (62/1962 nt) topB DNA topoisomerase III
* ? NC_000913 = 193756388 (0.470)8 (0.050) 4/218 NT 8.2% intergenic (+42/‑86) yebK/pykA putative DNA‑binding transcriptional regulator/pyruvate kinase II
?NC_000913 = 1937592 99 (0.580)intergenic (+71/‑57) yebK/pykA putative DNA‑binding transcriptional regulator/pyruvate kinase II
* ? NC_000913 2065691 =155 (0.830)12 (0.070) 7/222 NT 7.8% coding (74/546 nt) cobU cobinamide kinase and cobinamide phosphate guanylyltransferase
?NC_000913 2065730 = 138 (0.790)coding (35/546 nt) cobU cobinamide kinase and cobinamide phosphate guanylyltransferase
* ? NC_000913 2204447 =44 (0.240)9 (0.050) 9/216 NT 20.0% intergenic (+158/‑149) yehK/yehL uncharacterized protein/putative hexameric AAA+ MoxR family ATPase
?NC_000913 2204492 = 32 (0.190)intergenic (+203/‑104) yehK/yehL uncharacterized protein/putative hexameric AAA+ MoxR family ATPase
* ? NC_000913 = 2232735NA (NA)5 (0.030) 6/226 NT NA intergenic (+7/‑143) cdd/sanA cytidine/deoxycytidine deaminase/DUF218 superfamily vancomycin high temperature exclusion protein
?NC_000913 = 2232765 NA (NA)noncoding (30/34 nt) REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 2268748113 (0.610)16 (0.090) 12/226 NT 13.1% coding (920/987 nt) yeiR Zn‑stimulated GTPase involved in zinc homeostasis; mutants are cadmium and EDTA sensitive; Zn(2+) binding protein
?NC_000913 = 2268760 105 (0.590)coding (932/987 nt) yeiR Zn‑stimulated GTPase involved in zinc homeostasis; mutants are cadmium and EDTA sensitive; Zn(2+) binding protein
* ? NC_000913 2304471 =61 (0.330)12 (0.070) 6/224 NT 22.4% noncoding (55/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 2304955 = 26 (0.150)noncoding (539/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 230453668 (0.360)9 (0.050) 7/232 NT 18.5% noncoding (120/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 2304673 13 (0.070)noncoding (257/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 2326950 =157 (0.840)10 (0.060) 7/230 NT 6.2% coding (842/1185 nt) atoB acetyl‑CoA acetyltransferase
?NC_000913 2326969 = 151 (0.840)coding (861/1185 nt) atoB acetyl‑CoA acetyltransferase
* ? NC_000913 2430981 =65 (0.350)5 (0.030) 5/224 NT 7.9% noncoding (53/84 nt) REP169 (repetitive extragenic palindromic) element; contains 2 REP sequences REP169 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 2431013 = 55 (0.310)intergenic (‑250/+9) cvpA/dedD colicin V production protein/membrane‑anchored periplasmic protein involved in septation
* ? NC_000913 = 2516411191 (1.020)16 (0.090) 8/230 NT 7.9% coding (1422/2190 nt) yfeA putative diguanylate cyclase
?NC_000913 = 2516437 186 (1.030)coding (1396/2190 nt) yfeA putative diguanylate cyclase
* ? NC_000913 = 2533705106 (0.570)9 (0.050) 6/222 NT 8.0% intergenic (+325/‑59) cysK/ptsH cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
?NC_000913 = 2533719 108 (0.620)intergenic (+339/‑45) cysK/ptsH cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
* ? NC_000913 2568185 =NA (NA)10 (0.060)
+ACCCGCTACACACCCCGCAG
3/198 NT NA noncoding (47/183 nt) REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 = 3217522 NA (NA)noncoding (89/89 nt) REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 2617968 =NA (NA)4 (0.020) 4/224 NT NA noncoding (1/37 nt) REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 2618001 = NA (NA)noncoding (34/37 nt) REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 2708671206 (1.100)16 (0.090) 12/224 NT 7.6% coding (84/957 nt) rseB anti‑sigma E factor, binds RseA
?NC_000913 = 2708691 195 (1.110)coding (64/957 nt) rseB anti‑sigma E factor, binds RseA
* ? NC_000913 2727891 =NA (NA)49 (0.280) 22/226 NT NA noncoding (1294/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2727910 = NA (NA)noncoding (1275/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 2728214 =NA (NA)43 (0.240) 21/230 NT NA noncoding (971/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2728240 = NA (NA)noncoding (945/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 2730003 =NA (NA)12 (0.070) 9/224 NT NA noncoding (1155/1542 nt) rrsG 16S ribosomal RNA of rrnG operon
?NC_000913 2730041 = NA (NA)noncoding (1117/1542 nt) rrsG 16S ribosomal RNA of rrnG operon
* ? NC_000913 2755402 =118 (0.630)8 (0.040) 5/230 NT 6.6% intergenic (+24/‑757) smpB/intA tmRNA‑binding trans‑translation protein/CP4‑57 prophage; integrase
?NC_000913 2755442 = 113 (0.630)intergenic (+64/‑717) smpB/intA tmRNA‑binding trans‑translation protein/CP4‑57 prophage; integrase
* ? NC_000913 2800357 =155 (0.830)8 (0.040) 6/228 NT 5.3% coding (212/330 nt) ygaM putative membrane‑anchored DUF883 family ribosome‑binding protein
?NC_000913 2800380 = 140 (0.780)coding (235/330 nt) ygaM putative membrane‑anchored DUF883 family ribosome‑binding protein
* ? NC_000913 = 2813016131 (0.700)7 (0.040) 5/224 NT 5.3% coding (401/1539 nt) emrB multidrug efflux system protein
?NC_000913 = 2813031 128 (0.730)coding (416/1539 nt) emrB multidrug efflux system protein
* ? NC_000913 2818349 =106 (0.570)7 (0.040) 4/222 NT 6.5% intergenic (‑75/+124) argY/argV tRNA‑Arg/tRNA‑Arg
?NC_000913 2818411 = 102 (0.590)intergenic (‑137/+62) argY/argV tRNA‑Arg/tRNA‑Arg
* ? NC_000913 2818492 =172 (0.920)15 (0.080) 8/226 NT 8.1% noncoding (58/77 nt) argV tRNA‑Arg
?NC_000913 2818515 = 176 (0.990)noncoding (35/77 nt) argV tRNA‑Arg
* ? NC_000913 2822046 =145 (0.780)7 (0.040) 5/226 NT 5.0% intergenic (‑35/+93) alaS/recX alanyl‑tRNA synthetase/regulatory protein for RecA
?NC_000913 2822080 = 126 (0.710)intergenic (‑69/+59) alaS/recX alanyl‑tRNA synthetase/regulatory protein for RecA
* ? NC_000913 2828783 =144 (0.770)7 (0.040) 5/230 NT 5.1% coding (163/360 nt) srlM sorbitol=responsive srl operon transcriptional activator
?NC_000913 2828822 = 120 (0.670)coding (202/360 nt) srlM sorbitol=responsive srl operon transcriptional activator
* ? NC_000913 2884559 =138 (0.740)14 (0.080) 12/228 NT 9.6% coding (2661/2667 nt) ygcB Cascade complex anti‑viral R‑loop helicase‑annealase Cas3
?NC_000913 2884597 = 131 (0.730)coding (2623/2667 nt) ygcB Cascade complex anti‑viral R‑loop helicase‑annealase Cas3
* ? NC_000913 2909114 =170 (0.910)12 (0.070) 10/230 NT 6.6% coding (553/1638 nt) pyrG CTP synthetase
?NC_000913 2909151 = 177 (0.980)coding (516/1638 nt) pyrG CTP synthetase
* ? NC_000913 = 2981914204 (1.090)13 (0.070) 8/226 NT 5.9% coding (269/1419 nt) araE arabinose transporter
?NC_000913 = 2981935 221 (1.250)coding (248/1419 nt) araE arabinose transporter
* ? NC_000913 3037860 =86 (0.460)6 (0.040) 6/216 NT 6.6% coding (247/1734 nt) recJ ssDNA exonuclease, 5' ‑‑> 3'‑specific
?NC_000913 3037943 = 93 (0.550)coding (164/1734 nt) recJ ssDNA exonuclease, 5' ‑‑> 3'‑specific
* ? NC_000913 3056789 =254 (1.360)21 (0.120) 14/222 NT 8.0% coding (549/549 nt) fau 5‑formyltetrahydrofolate cyclo‑ligase family protein
?NC_000913 3056813 = 244 (1.400)intergenic (+24/‑36) fau/sibC 5‑formyltetrahydrofolate cyclo‑ligase family protein/sRNA antisense regulator of toxic IbsC protein
* ? NC_000913 = 3097480112 (0.600)6 (0.030) 5/230 NT 5.4% coding (214/1137 nt) yggW HemN family putative oxidoreductase
?NC_000913 = 3097545 103 (0.570)coding (279/1137 nt) yggW HemN family putative oxidoreductase
* ? NC_000913 = 3101756NA (NA)11 (0.060) 8/224 NT NA noncoding (61/79 nt) REP218 (repetitive extragenic palindromic) element; contains 2 REP sequences REP218 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3774243 = NA (NA)noncoding (8/99 nt) RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 3123440 =110 (0.590)7 (0.040) 6/228 NT 6.7% coding (366/2172 nt) glcB malate synthase G
?NC_000913 3123495 = 89 (0.500)coding (311/2172 nt) glcB malate synthase G
* ? NC_000913 = 315067098 (0.560)12 (0.070) 10/224 NT 10.9% noncoding (117/255 nt) RIP222 (repetitive extragenic palindromic) element; contains 5 REP sequences and 2 IHF sites RIP222 (repetitive extragenic palindromic) element; contains 5 REP sequences and 2 IHF sites
?NC_000913 3774236 = NA (NA)noncoding (1/99 nt) RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 = 3161672203 (1.090)12 (0.070) 9/232 NT 5.9% coding (998/1413 nt) ftsP septal ring component that protects the divisome from stress; multicopy suppressor of ftsI(Ts)
?NC_000913 = 3161700 183 (1.010)coding (970/1413 nt) ftsP septal ring component that protects the divisome from stress; multicopy suppressor of ftsI(Ts)
* ? NC_000913 = 3194547128 (0.690)16 (0.090) 11/226 NT 11.7% intergenic (+22/+176) yqiK/sibD PHB family membrane protein, function unknown/sRNA antisense regulator of toxic IbsD protein
?NC_000913 = 3194562 120 (0.680)intergenic (+37/+161) yqiK/sibD PHB family membrane protein, function unknown/sRNA antisense regulator of toxic IbsD protein
* ? NC_000913 = 3194924135 (0.720)11 (0.060) 9/228 NT 7.8% intergenic (‑59/+175) sibD/sibE sRNA antisense regulator of toxic IbsD protein/sRNA antisense regulator of toxic IbsE protein
?NC_000913 = 3194939 129 (0.720)intergenic (‑74/+160) sibD/sibE sRNA antisense regulator of toxic IbsD protein/sRNA antisense regulator of toxic IbsE protein
* ? NC_000913 = 3385763120 (0.640)8 (0.050) 5/224 NT 6.5% coding (226/264 nt) yhcN cadmium and peroxide resistance protein, stress‑induced
?NC_000913 = 3385776 117 (0.670)coding (239/264 nt) yhcN cadmium and peroxide resistance protein, stress‑induced
* ? NC_000913 3411592 =122 (0.650)6 (0.040) 6/216 NT 6.3% intergenic (+25/‑61) fis/yhdJ global DNA‑binding transcriptional dual regulator/DNA adenine methyltransferase, SAM‑dependent
?NC_000913 3411628 = 68 (0.400)intergenic (+61/‑25) fis/yhdJ global DNA‑binding transcriptional dual regulator/DNA adenine methyltransferase, SAM‑dependent
* ? NC_000913 = 3416769171 (0.920)13 (0.070) 9/228 NT 7.3% coding (1737/3105 nt) acrF multidrug efflux system protein
?NC_000913 = 3416782 165 (0.920)coding (1750/3105 nt) acrF multidrug efflux system protein
* ? NC_000913 = 3470960NA (NA)6 (0.030) 4/226 NT NA coding (370/1185 nt) tufA translation elongation factor EF‑Tu 1
?NC_000913 = 3470998 NA (NA)coding (332/1185 nt) tufA translation elongation factor EF‑Tu 1
* ? NC_000913 3620131 =NA (NA)4 (0.020) 4/232 NT 100% coding (940/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620147 = 0 (0.000)coding (956/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620220NA (NA)10 (0.060) 9/226 NT 100% coding (1029/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620255 0 (0.000)coding (1064/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620350NA (NA)14 (0.080) 8/226 NT 100% coding (1159/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620425 0 (0.000)coding (1234/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3620357 =NA (NA)4 (0.020) 4/226 NT 100% coding (1166/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620420 = 0 (0.000)coding (1229/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620363NA (NA)4 (0.020) 4/228 NT 100% coding (1172/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620412 0 (0.000)coding (1221/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3620569 =NA (NA)23 (0.130) 14/226 NT 100% coding (1378/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620582 = 0 (0.000)coding (1391/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3621455 =NA (NA)5 (0.030) 5/230 NT 100% coding (2264/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3621474 = 0 (0.000)coding (2283/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3621712NA (NA)4 (0.020) 4/230 NT NA coding (2521/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3621776 NA (NA)coding (2585/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3622466 =NA (NA)15 (0.080) 8/230 NT 16.4% coding (3275/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3622497 = 79 (0.420)coding (3306/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3655587174 (0.930)10 (0.050) 10/232 NT 5.2% coding (316/648 nt) yhiD putative Mg(2+) transport ATPase, inner membrane protein
?NC_000913 = 3655609 192 (1.060)coding (294/648 nt) yhiD putative Mg(2+) transport ATPase, inner membrane protein
* ? NC_000913 = 366613423 (0.120)7 (0.040) 6/208 NT 19.2% intergenic (‑324/+46) gadX/gadA acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent
?NC_000913 = 3666147 39 (0.240)intergenic (‑337/+33) gadX/gadA acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent
* ? NC_000913 3712860 =189 (1.010)216 (1.160) 123/238 NT 56.8% coding (75/699 nt) yhjY autotransporter beta‑domain protein
?NC_000913 = 3873341 139 (0.740)coding (272/618 nt) dgoA 2‑oxo‑3‑deoxygalactonate 6‑phosphate aldolase
* ? NC_000913 3717215 =381 (2.040)18 (0.110) 11/214 NT 5.5% intergenic (+9/‑95) yiaD/ghrB multicopy suppressor of bamB; outer membrane lipoprotein/glyoxylate/hydroxypyruvate reductase B
?NC_000913 3717245 = 276 (1.650)intergenic (+39/‑65) yiaD/ghrB multicopy suppressor of bamB; outer membrane lipoprotein/glyoxylate/hydroxypyruvate reductase B
* ? NC_000913 3718298 =298 (1.600)36 (0.210) 24/222 NT 12.2% intergenic (+14/+36) ghrB/yiaF glyoxylate/hydroxypyruvate reductase B/barrier effect co‑colonization resistance factor; DUF3053 family lipoprotein
?NC_000913 3718334 = 240 (1.380)coding (711/711 nt) yiaF barrier effect co‑colonization resistance factor; DUF3053 family lipoprotein
* ? NC_000913 3726887 =269 (1.440)22 (0.130) 11/216 NT 8.7% intergenic (+5/+37) wecH/yiaA O‑acetyltransferase for enterobacterial common antigen (ECA)/YiaAB family inner membrane protein, tandem domains
?NC_000913 3726917 = 218 (1.290)intergenic (+35/+7) wecH/yiaA O‑acetyltransferase for enterobacterial common antigen (ECA)/YiaAB family inner membrane protein, tandem domains
* ? NC_000913 3736232 =369 (2.070)22 (0.120) 13/228 NT 5.6% noncoding (79/171 nt) REP268 (repetitive extragenic palindromic) element; contains 4 REP sequences REP268 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 = 4484414 NA (NA)noncoding (82/84 nt) REP342 (repetitive extragenic palindromic) element; contains 2 REP sequences REP342 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3774340 =320 (1.710)19 (0.110) 14/222 NT 6.5% intergenic (+146/‑84) mtlA/mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
?NC_000913 3774360 = 248 (1.430)intergenic (+166/‑64) mtlA/mtlD mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent
* ? NC_000913 = 3795026399 (2.140)25 (0.140) 19/222 NT 6.3% coding (98/1047 nt) waaF ADP‑heptose:LPS heptosyltransferase II
?NC_000913 = 3795059 378 (2.170)coding (131/1047 nt) waaF ADP‑heptose:LPS heptosyltransferase II
* ? NC_000913 = 3858205297 (1.590)22 (0.130) 13/212 NT 7.3% coding (200/1494 nt) yidJ sulfatase/phosphatase superfamily protein
?NC_000913 = 3858228 298 (1.790)coding (177/1494 nt) yidJ sulfatase/phosphatase superfamily protein
* ? NC_000913 3884850 =191 (1.020)13 (0.070) 10/226 NT 6.6% coding (358/360 nt)
coding (35/258 nt)
rnpA
yidD
protein C5 component of RNase P
membrane protein insertion efficiency factor, UPF0161 family inner membrane protein
?NC_000913 3884875 = 188 (1.060)coding (60/258 nt) yidD membrane protein insertion efficiency factor, UPF0161 family inner membrane protein
* ? NC_000913 3908479 =154 (0.830)9 (0.050) 8/232 NT 5.4% intergenic (‑113/+70) pstB/pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
?NC_000913 3908506 = 168 (0.920)intergenic (‑140/+43) pstB/pstA phosphate ABC transporter ATPase/phosphate ABC transporter permease
* ? NC_000913 = 3908685277 (1.480)32 (0.180) 15/228 NT 10.6% coding (755/891 nt) pstA phosphate ABC transporter permease
?NC_000913 = 3908700 277 (1.550)coding (740/891 nt) pstA phosphate ABC transporter permease
* ? NC_000913 3920303 =127 (0.680)10 (0.060) 9/228 NT 7.6% coding (101/534 nt) atpH F1 sector of membrane‑bound ATP synthase, delta subunit
?NC_000913 3920328 = 122 (0.680)coding (76/534 nt) atpH F1 sector of membrane‑bound ATP synthase, delta subunit
* ? NC_000913 = 3938307138 (0.740)11 (0.060) 11/222 NT 7.6% coding (81/993 nt) rbsR transcriptional repressor of ribose metabolism
?NC_000913 = 3938313 139 (0.800)coding (87/993 nt) rbsR transcriptional repressor of ribose metabolism
* ? NC_000913 = 3944991NA (NA)11 (0.060) 6/226 NT 6.7% noncoding (1288/2904 nt) rrlC 23S ribosomal RNA of rrnC operon
?NC_000913 = 4038798 162 (0.870)noncoding (1280/2905 nt) rrlA 23S ribosomal RNA of rrnA operon
* ? NC_000913 = 3962703NA (NA)6 (0.030) 4/226 NT NA noncoding (4/36 nt) REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 3962735 NA (NA)noncoding (36/36 nt) REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 3999519234 (1.250)13 (0.070) 11/224 NT 5.2% coding (1537/2163 nt) uvrD DNA‑dependent ATPase I and helicase II
?NC_000913 = 3999532 258 (1.470)coding (1550/2163 nt) uvrD DNA‑dependent ATPase I and helicase II
* ? NC_000913 = 4040481NA (NA)106 (0.600) 19/226 NT 64.7% intergenic (+58/‑36) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
?NC_000913 = 4040505 61 (0.330)intergenic (+82/‑12) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
* ? NC_000913 = 404068312 (0.060)43 (0.230) 15/234 NT 65.8% intergenic (+47/+223) rrfA/mobB 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B
?NC_000913 = 4213162 33 (0.180)intergenic (+3/‑72) rrfE/yjaA 5S ribosomal RNA of rrnE operon/stress‑induced protein
* ? NC_000913 = 4051977173 (0.930)10 (0.060) 8/226 NT 5.5% intergenic (+121/‑68) yihI/hemN activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
?NC_000913 = 4051999 179 (1.010)intergenic (+143/‑46) yihI/hemN activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
* ? NC_000913 = 4080099NA (NA)7 (0.040) 6/224 NT NA noncoding (80/98 nt) REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 4080110 NA (NA)noncoding (91/98 nt) REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 4153357113 (0.610)6 (0.030) 5/224 NT 5.4% noncoding (11/346 nt) REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences
?NC_000913 = 4153375 105 (0.600)noncoding (29/346 nt) REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences
* ? NC_000913 = 416834140 (0.210)14 (0.080) 11/218 NT 34.3% intergenic (+141/‑31) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
?NC_000913 = 4168363 17 (0.100)intergenic (+163/‑9) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
* ? NC_000913 4196527 =190 (1.020)12 (0.070) 8/232 NT 5.9% coding (282/477 nt) rsd stationary phase protein, binds sigma 70 RNA polymerase subunit
?NC_000913 4196561 = 198 (1.090)coding (248/477 nt) rsd stationary phase protein, binds sigma 70 RNA polymerase subunit
* ? NC_000913 4233833 =79 (0.420)6 (0.040) 6/218 NT 9.1% coding (76/1650 nt) pgi glucosephosphate isomerase
?NC_000913 4233869 = 48 (0.280)coding (112/1650 nt) pgi glucosephosphate isomerase
* ? NC_000913 4239740 =189 (1.010)11 (0.070) 10/216 NT 6.2% intergenic (+10/+37) yjbH/yjbT DUF940 family extracellular polysaccharide protein/putative periplasmic protein
?NC_000913 4239772 = 159 (0.940)intergenic (+42/+5) yjbH/yjbT DUF940 family extracellular polysaccharide protein/putative periplasmic protein
* ? NC_000913 4281812 =256 (1.370)19 (0.110) 14/218 NT 7.8% coding (1264/1293 nt) yjcF pentapeptide repeats protein
?NC_000913 4281841 = 214 (1.250)coding (1235/1293 nt) yjcF pentapeptide repeats protein
* ? NC_000913 4321620 =147 (0.790)8 (0.050) 6/224 NT 5.3% coding (77/453 nt) phnG ribophosphonate triphosphate synthase subunit
?NC_000913 4321659 = 146 (0.830)coding (38/453 nt) phnG ribophosphonate triphosphate synthase subunit
* ? NC_000913 = 4332094NA (NA)20 (0.120) 13/218 NT 10.3% intergenic (+90/‑22) proP/pmrR proline/glycine betaine transporter/putative membrane‑bound BasS regulator
?NC_000913 = 4332102 174 (1.020)intergenic (+98/‑14) proP/pmrR proline/glycine betaine transporter/putative membrane‑bound BasS regulator
* ? NC_000913 4341778 =64 (0.340)6 (0.040) 5/202 NT 8.3% intergenic (‑150/‑133) melR/melA melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding
?NC_000913 4341834 = 79 (0.500)intergenic (‑206/‑77) melR/melA melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding
* ? NC_000913 = 434179568 (0.360)8 (0.050) 7/202 NT 10.5% intergenic (‑167/‑116) melR/melA melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding
?NC_000913 = 4341815 79 (0.500)intergenic (‑187/‑96) melR/melA melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding
* ? NC_000913 4389302 =185 (0.990)9 (0.050) 8/228 NT 5.1% coding (69/3324 nt) mscM mechanosensitive channel protein, miniconductance
?NC_000913 4389328 = 155 (0.870)coding (43/3324 nt) mscM mechanosensitive channel protein, miniconductance
* ? NC_000913 4412327 =121 (0.650)13 (0.070) 11/226 NT 9.9% coding (349/399 nt) yjfL UPF0719 family inner membrane protein
?NC_000913 4412348 = 122 (0.690)coding (370/399 nt) yjfL UPF0719 family inner membrane protein
* ? NC_000913 = 4417460262 (1.400)17 (0.100) 14/224 NT 6.3% coding (509/750 nt) yjfP acyl CoA esterase
?NC_000913 = 4417479 263 (1.500)coding (528/750 nt) yjfP acyl CoA esterase
* ? NC_000913 = 4534139258 (1.380)14 (0.080) 12/218 NT 5.4% intergenic (‑86/+291) yjhX/yjhZ UPF0386 family protein/pseudogene, rimK paralog, C‑terminal fragment
?NC_000913 = 4534160 251 (1.470)intergenic (‑107/+270) yjhX/yjhZ UPF0386 family protein/pseudogene, rimK paralog, C‑terminal fragment
* ? NC_000913 = 4549784NA (NA)8 (0.050) 6/226 NT NA noncoding (2/36 nt) REP345 (repetitive extragenic palindromic) element; contains 1 REP sequences REP345 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4549822 NA (NA)intergenic (+112/+131) fimH/gntP minor component of type 1 fimbriae/fructuronate transporter