breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 5,563 G→A 28.9% intergenic (+33/+120) yaaX → / ← yaaA hypothetical protein/conserved hypothetical protein
RA 5,581 G→A 12.2% intergenic (+51/+102) yaaX → / ← yaaA hypothetical protein/conserved hypothetical protein
RA 5,593 A→T 8.7% intergenic (+63/+90) yaaX → / ← yaaA hypothetical protein/conserved hypothetical protein
RA 5,624 C→T 5.2% intergenic (+94/+59) yaaX → / ← yaaA hypothetical protein/conserved hypothetical protein
RA 5,628 A→G 5.5% intergenic (+98/+55) yaaX → / ← yaaA hypothetical protein/conserved hypothetical protein
RA 15,386 C→T 20.5% intergenic (+88/+59) dnaJ → / ← mokC chaperone Hsp40, co‑chaperone with DnaK/regulatory protein for HokC, overlaps CDS of hokC
RA 34,427 C→T 25.0% R364H (CGC→CAC)  caiC ← predicted crotonobetaine CoA ligase:carnitine CoA ligase
RA 45,536 G→A 9.1% S30S (TCG→TCA)  kefC → potassium:proton antiporter
RA 63,049 T→C 7.8% N137S (AAT→AGT)  polB ← DNA polymerase II
RA 63,052 A→T 7.3% V136D (GTT→GAT)  polB ← DNA polymerase II
RA 63,055 A→T 7.3% I135N (ATC→AAC)  polB ← DNA polymerase II
RA 63,058 G→A 7.4% T134I (ACT→ATT)  polB ← DNA polymerase II
RA 65,975 C→T 16.8% V242I (GTT→ATT)  leuB ← 3‑isopropylmalate dehydrogenase
RA 87,506 G→A 10.9% L178L (TTG→TTA)  ddlB → D‑Alanine:D‑alanine ligase
RA 132,188 A→G 8.7% T161A (ACA→GCA) ‡ yadD → predicted transposase
RA 132,189 C→T 8.7% T161I (ACA→ATA) ‡ yadD → predicted transposase
RA 132,193 G→T 10.4% P162P (CCG→CCT)  yadD → predicted transposase
RA 132,196 T→C 10.0% D163D (GAT→GAC)  yadD → predicted transposase
RA 132,199 C→T 10.3% D164D (GAC→GAT)  yadD → predicted transposase
RA 132,202 A→G 10.5% E165E (GAA→GAG)  yadD → predicted transposase
RA 132,220 G→T 12.3% R171R (CGG→CGT)  yadD → predicted transposase
RA 132,223 T→A 12.7% I172I (ATT→ATA)  yadD → predicted transposase
RA 132,226 G→T 11.3% A173A (GCG→GCT)  yadD → predicted transposase
RA 132,227 A→C 11.9% I174L (ATT→CTT) ‡ yadD → predicted transposase
RA 132,229 T→G 13.0% I174M (ATT→ATG) ‡ yadD → predicted transposase
RA 132,232 C→G 11.3% L175L (CTC→CTG)  yadD → predicted transposase
RA 132,238 A→G 11.8% L177L (CTA→CTG)  yadD → predicted transposase
RA 132,239 C→A 11.7% L178M (CTG→ATG) ‡ yadD → predicted transposase
RA 132,241 G→T 11.0% L178L (CTG→CTT) ‡ yadD → predicted transposase
RA 132,247 A→G 10.6% K180K (AAA→AAG)  yadD → predicted transposase
RA 138,390 A→G 7.9% S593P (TCA→CCA)  htrE ← predicted outer membrane usher protein
RA 189,184 G→T 11.6% V227V (GTG→GTT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,194 G→T 12.6% A231S (GCC→TCC) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,196 C→T 12.8% A231A (GCC→GCT) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,199 G→T 12.1% A232A (GCG→GCT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,203 T→G 10.4% S234A (TCC→GCC) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,205 C→A 10.4% S234S (TCC→TCA) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,211 T→C 11.9% S236S (AGT→AGC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,214 G→C 8.9% T237T (ACG→ACC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,215 C→A 9.3% L238M (CTG→ATG) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,217 G→T 9.2% L238L (CTG→CTT) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,218 T→C 9.2% L239L (TTG→CTG)  ldcC → lysine decarboxylase 2, constitutive
RA 189,223 C→T 9.7% I240I (ATC→ATT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,229 C→T 9.2% R242R (CGC→CGT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,453 G→T 10.3% W317L (TGG→TTG) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,454 G→C 10.3% W317C (TGG→TGC) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,460 A→G 10.2% K319K (AAA→AAG)  ldcC → lysine decarboxylase 2, constitutive
RA 189,463 G→A 10.7% Q320Q (CAG→CAA)  ldcC → lysine decarboxylase 2, constitutive
RA 189,466 G→A 10.6% T321T (ACG→ACA)  ldcC → lysine decarboxylase 2, constitutive
RA 189,475 C→G 11.5% V324V (GTC→GTG)  ldcC → lysine decarboxylase 2, constitutive
RA 189,476 C→A 11.2% P325T (CCG→ACG) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,477 C→A 11.1% P325Q (CCG→CAG) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,478 G→A 10.7% P325P (CCG→CCA) ‡ ldcC → lysine decarboxylase 2, constitutive
RA 189,481 G→C 10.8% S326S (TCG→TCC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,484 T→C 11.8% I327I (ATT→ATC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,490 C→T 14.2% F329F (TTC→TTT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,493 T→C 14.1% D330D (GAT→GAC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,496 T→C 14.1% S331S (TCT→TCC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,499 C→G 14.1% A332A (GCC→GCG)  ldcC → lysine decarboxylase 2, constitutive
RA 189,508 G→T 8.8% P335P (CCG→CCT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,580 C→T 9.4% I359I (ATC→ATT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,582 T→A 9.6% F360Y (TTC→TAC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,619 A→C 9.4% L372F (TTA→TTC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,622 G→T 9.5% S373S (TCG→TCT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,631 G→C 10.2% S376S (TCG→TCC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,632 C→A 9.9% L377M (CTG→ATG)  ldcC → lysine decarboxylase 2, constitutive
RA 189,641 A→G 9.2% I380V (ATT→GTT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,649 C→T 9.0% G382G (GGC→GGT)  ldcC → lysine decarboxylase 2, constitutive
RA 189,651:1 +C 9.4% coding (1148/2142 nt) ldcC → lysine decarboxylase 2, constitutive
RA 189,655 Δ1 bp 9.3% coding (1152/2142 nt) ldcC → lysine decarboxylase 2, constitutive
RA 189,656 G→A 9.0% D385N (GAC→AAC)  ldcC → lysine decarboxylase 2, constitutive
RA 189,664 G→A 10.4% E387E (GAG→GAA)  ldcC → lysine decarboxylase 2, constitutive
RA 189,665 G→A 10.0% A388T (GCC→ACC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,065 G→A 30.5% R521H (CGT→CAT)  ldcC → lysine decarboxylase 2, constitutive
RA 190,069 G→C 34.3% G522G (GGG→GGC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,075 A→T 47.5% V524V (GTA→GTT)  ldcC → lysine decarboxylase 2, constitutive
RA 190,078 A→T 47.5% V525V (GTA→GTT)  ldcC → lysine decarboxylase 2, constitutive
RA 190,090 C→T 41.7% G529G (GGC→GGT)  ldcC → lysine decarboxylase 2, constitutive
RA 190,093 T→G 40.0% P530P (CCT→CCG)  ldcC → lysine decarboxylase 2, constitutive
RA 190,108 T→C 40.4% F535F (TTT→TTC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,111 C→G 39.6% L536L (CTC→CTG)  ldcC → lysine decarboxylase 2, constitutive
RA 190,114 T→C 40.4% F537F (TTT→TTC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,117 T→C 37.2% S538S (AGT→AGC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,120 T→C 34.8% I539I (ATT→ATC)  ldcC → lysine decarboxylase 2, constitutive
RA 190,123 C→T 37.2% G540G (GGC→GGT)  ldcC → lysine decarboxylase 2, constitutive
RA 190,132 A→G 25.6% K543K (AAA→AAG)  ldcC → lysine decarboxylase 2, constitutive
RA 204,511 C→T 100% intergenic (+111/‑73) alaV → / → rrlH tRNA‑Ala/23S ribosomal RNA
RA 204,556 A→G 100% intergenic (+156/‑28) alaV → / → rrlH tRNA‑Ala/23S ribosomal RNA
RA 214,925 A→C 73.1% D12A (GAT→GCT)  dnaQ → DNA polymerase III epsilon subunit
RA 214,931 A→C 72.7% E14A (GAA→GCA)  dnaQ → DNA polymerase III epsilon subunit
RA 217,941 A→T 11.3% intergenic (‑33/‑73) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,944 G→A 14.3% intergenic (‑36/‑70) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,947 G→A 11.8% intergenic (‑39/‑67) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,959 A→G 14.1% intergenic (‑51/‑55) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,968 C→T 14.7% intergenic (‑60/‑46) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,977 C→T 21.6% intergenic (‑69/‑37) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 217,996 A→T 64.7% intergenic (‑88/‑18) yafU ← / → yafF predicted inner membrane protein/conserved hypothetical protein
RA 218,030 A→G 59.2% Y6C (TAC→TGC)  yafF → conserved hypothetical protein
RA 218,049 C→T 48.1% N12N (AAC→AAT)  yafF → conserved hypothetical protein
RA 218,052 A→C 14.8% A13A (GCA→GCC)  yafF → conserved hypothetical protein
RA 218,082 T→C 10.8% I23I (ATT→ATC)  yafF → conserved hypothetical protein
RA 218,097 G→A 15.0% L28L (TTG→TTA)  yafF → conserved hypothetical protein
RA 218,106 G→T 70.3% E31D (GAG→GAT)  yafF → conserved hypothetical protein
RA 218,157 C→T 15.9% D48D (GAC→GAT)  yafF → conserved hypothetical protein
RA 218,166 C→T 36.1% Y51Y (TAC→TAT)  yafF → conserved hypothetical protein
RA 218,169 G→C 15.2% L52L (CTG→CTC)  yafF → conserved hypothetical protein
RA 218,182 G→A 12.7% A57T (GCG→ACG)  yafF → conserved hypothetical protein
RA 219,996 C→T 32.8% G711D (GGT→GAT)  fadE ← acyl coenzyme A dehydrogenase
RA 222,988 T→G 32.9% intergenic (+43/‑137) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 222,990 T→C 22.0% intergenic (+45/‑135) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 222,997 T→A 35.9% intergenic (+52/‑128) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 223,016 G→A 13.9% intergenic (+71/‑109) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 223,018 C→A 26.1% intergenic (+73/‑107) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 223,030 T→G 7.4% intergenic (+85/‑95) lpcA → / → prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA 223,627 T→A 51.9% intergenic (+47/+10) prfH → / ← pepD predicted peptide chain release factor/aminoacyl‑histidine dipeptidase
RA 227,251 A→G 23.1% K15K (AAA→AAG)  crl → DNA‑binding transcriptional regulator
RA 228,508 T→G 8.0% T65T (ACA→ACC)  phoE ← outer membrane phosphoporin protein E
RA 228,520 G→A 7.7% F61F (TTC→TTT)  phoE ← outer membrane phosphoporin protein E
RA 228,526 A→C 8.5% F59L (TTT→TTG) ‡ phoE ← outer membrane phosphoporin protein E
RA 228,528 A→G 8.5% F59L (TTT→CTT) ‡ phoE ← outer membrane phosphoporin protein E
RA 228,532 G→C 8.4% I57M (ATC→ATG) ‡ phoE ← outer membrane phosphoporin protein E
RA 228,533 A→G 8.5% I57T (ATC→ACC) ‡ phoE ← outer membrane phosphoporin protein E
RA 228,534 T→C 8.5% I57V (ATC→GTC) ‡ phoE ← outer membrane phosphoporin protein E
RA 228,538 A→G 8.2% S55S (AGT→AGC)  phoE ← outer membrane phosphoporin protein E
RA 232,635 T→C 55.6% N43D (AAC→GAC)  hemB ← porphobilinogen synthase
RA 235,640 C→T 22.2% intergenic (+1/‑257) yaiA → / → aroM hypothetical protein/conserved hypothetical protein
RA 246,374 C→T 17.2% S6L (TCG→TTG)  phoR → sensory histidine kinase in two‑component regulatory system with PhoB
RA 259,095 T→C 20.9% Y8H (TAT→CAT)  yajD → conserved hypothetical protein
RA 288,960 A→G 21.5% Y535C (TAC→TGC)  lon → DNA‑binding ATP‑dependent protease La
RA 294,191 A→G 12.2% F531L (TTC→CTC)  ybaE ← predicted transporter subunit
RA 299,010 G→A 11.4% L557L (CTG→CTA)  mdlA → fused predicted multidrug transporter subunits and ATP‑binding components of ABC superfamily
RA 307,588 C→T 15.0% A45T (GCT→ACT)  ylaC ← predicted inner membrane protein
RA 309,779 G→A 10.2% R1032C (CGC→TGC)  acrB ← multidrug efflux system protein
RA 309,780 G→A 10.2% R1031R (CGC→CGT)  acrB ← multidrug efflux system protein
RA 309,786 A→G 8.5% V1029V (GTT→GTC) ‡ acrB ← multidrug efflux system protein
RA 309,788 C→T 12.0% V1029I (GTT→ATT) ‡ acrB ← multidrug efflux system protein
RA 309,801 T→C 16.9% V1024V (GTA→GTG)  acrB ← multidrug efflux system protein
RA 309,807 A→T 23.2% V1022V (GTT→GTA)  acrB ← multidrug efflux system protein
RA 309,825 T→C 19.7% V1016V (GTA→GTG) ‡ acrB ← multidrug efflux system protein
RA 309,827 C→A 18.8% V1016L (GTA→TTA) ‡ acrB ← multidrug efflux system protein
RA 309,834 G→A 18.6% T1013T (ACC→ACT) ‡ acrB ← multidrug efflux system protein
RA 309,836 T→A 18.0% T1013S (ACC→TCC) ‡ acrB ← multidrug efflux system protein
RA 309,837 C→G 17.1% V1012V (GTG→GTC)  acrB ← multidrug efflux system protein
RA 309,843 C→T 10.2% G1010G (GGG→GGA)  acrB ← multidrug efflux system protein
RA 309,846 G→T 10.2% G1009G (GGC→GGA)  acrB ← multidrug efflux system protein
RA 309,855 A→C 11.4% G1006G (GGT→GGG)  acrB ← multidrug efflux system protein
RA 309,859 G→A 13.0% T1005I (ACC→ATC)  acrB ← multidrug efflux system protein
RA 309,864 T→C 11.7% V1003V (GTA→GTG)  acrB ← multidrug efflux system protein
RA 309,867 T→A 11.5% A1002A (GCA→GCT)  acrB ← multidrug efflux system protein
RA 310,779 C→G 10.1% A698A (GCG→GCC)  acrB ← multidrug efflux system protein
RA 310,785 A→G 9.4% T696T (ACT→ACC)  acrB ← multidrug efflux system protein
RA 310,788 C→T 9.5% L695L (CTG→CTA)  acrB ← multidrug efflux system protein
RA 310,791 T→G 10.0% K694N (AAA→AAC) ‡ acrB ← multidrug efflux system protein
RA 310,792 T→G 10.0% K694T (AAA→ACA) ‡ acrB ← multidrug efflux system protein
RA 310,793 T→C 10.0% K694E (AAA→GAA) ‡ acrB ← multidrug efflux system protein
RA 310,794 T→A 10.0% E693D (GAA→GAT)  acrB ← multidrug efflux system protein
RA 310,803 A→C 9.2% L690L (CTT→CTG)  acrB ← multidrug efflux system protein
RA 310,806 G→C 9.1% G689G (GGC→GGG)  acrB ← multidrug efflux system protein
RA 310,815 G→A 9.7% D686D (GAC→GAT)  acrB ← multidrug efflux system protein
RA 310,821 C→T 9.3% L684L (CTG→CTA) ‡ acrB ← multidrug efflux system protein
RA 310,823 G→A 9.5% L684L (CTG→TTG) ‡ acrB ← multidrug efflux system protein
RA 311,445 T→C 6.8% S476S (TCA→TCG)  acrB ← multidrug efflux system protein
RA 311,451 A→G 9.1% I474I (ATT→ATC)  acrB ← multidrug efflux system protein
RA 311,457 A→G 7.2% I472I (ATT→ATC)  acrB ← multidrug efflux system protein
RA 311,469 A→G 11.0% R468R (CGT→CGC)  acrB ← multidrug efflux system protein
RA 311,475 G→A 11.2% I466I (ATC→ATT)  acrB ← multidrug efflux system protein
RA 311,478 A→T 11.3% A465A (GCT→GCA)  acrB ← multidrug efflux system protein
RA 311,481 A→C 9.8% G464G (GGT→GGG)  acrB ← multidrug efflux system protein
RA 311,496 A→G 13.1% F459F (TTT→TTC)  acrB ← multidrug efflux system protein
RA 311,502 G→T 14.8% A457A (GCC→GCA)  acrB ← multidrug efflux system protein
RA 311,511 T→A 14.8% V454V (GTA→GTT) ‡ acrB ← multidrug efflux system protein
RA 311,513 C→T 15.0% V454I (GTA→ATA) ‡ acrB ← multidrug efflux system protein
RA 311,514 G→A 14.6% F453F (TTC→TTT)  acrB ← multidrug efflux system protein
RA 311,523 C→T 16.9% S450S (TCG→TCA)  acrB ← multidrug efflux system protein
RA 311,529 T→C 16.0% V448V (GTA→GTG)  acrB ← multidrug efflux system protein
RA 311,544 G→C 11.2% V443V (GTC→GTG)  acrB ← multidrug efflux system protein
RA 311,550 A→T 10.5% A441A (GCT→GCA)  acrB ← multidrug efflux system protein
RA 311,562 C→T 5.5% Q437Q (CAG→CAA)  acrB ← multidrug efflux system protein
RA 311,643 G→T 8.0% I410I (ATC→ATA)  acrB ← multidrug efflux system protein
RA 311,646 G→C 9.3% A409A (GCC→GCG)  acrB ← multidrug efflux system protein
RA 311,649 G→A 8.0% D408D (GAC→GAT)  acrB ← multidrug efflux system protein
RA 311,655 C→G 12.3% V406V (GTG→GTC)  acrB ← multidrug efflux system protein
RA 311,658 C→G 12.3% L405F (TTG→TTC) ‡ acrB ← multidrug efflux system protein
RA 311,660 A→G 13.1% L405L (TTG→CTG) ‡ acrB ← multidrug efflux system protein
RA 311,664 G→C 17.6% G403G (GGC→GGG)  acrB ← multidrug efflux system protein
RA 311,673 G→A 23.1% L400L (CTC→CTT)  acrB ← multidrug efflux system protein
RA 311,691 T→C 22.5% T394T (ACA→ACG)  acrB ← multidrug efflux system protein
RA 311,697 C→T 22.7% T392T (ACG→ACA)  acrB ← multidrug efflux system protein
RA 311,703 T→G 18.8% I390I (ATA→ATC)  acrB ← multidrug efflux system protein
RA 311,706 C→G 17.0% S389S (TCG→TCC)  acrB ← multidrug efflux system protein
RA 311,710 A→T 18.3% F388Y (TTC→TAC)  acrB ← multidrug efflux system protein
RA 311,712 G→A 16.6% G387G (GGC→GGT)  acrB ← multidrug efflux system protein
RA 311,718 G→A 9.3% A385A (GCC→GCT)  acrB ← multidrug efflux system protein
RA 311,724 A→G 9.0% L383L (CTT→CTC)  acrB ← multidrug efflux system protein
RA 311,760 G→C 8.4% A371A (GCC→GCG)  acrB ← multidrug efflux system protein
RA 311,769 C→G 11.9% P368P (CCG→CCC)  acrB ← multidrug efflux system protein
RA 311,772 A→G 12.4% I367I (ATT→ATC)  acrB ← multidrug efflux system protein
RA 311,777 A→G 12.6% L366L (TTG→CTG)  acrB ← multidrug efflux system protein
RA 311,781 C→T 14.8% A364A (GCG→GCA)  acrB ← multidrug efflux system protein
RA 311,784 G→T 14.8% R363R (CGC→CGA)  acrB ← multidrug efflux system protein
RA 311,787 G→C 14.8% F362L (TTC→TTG) ‡ acrB ← multidrug efflux system protein
RA 311,789 A→T 14.6% F362I (TTC→ATC) ‡ acrB ← multidrug efflux system protein
RA 311,790 G→A 14.3% N361N (AAC→AAT)  acrB ← multidrug efflux system protein
RA 311,798 G→A 17.5% L359L (CTG→TTG)  acrB ← multidrug efflux system protein
RA 311,811 A→C 19.7% V354V (GTT→GTG)  acrB ← multidrug efflux system protein
RA 311,823 G→C 11.3% L350L (CTC→CTG)  acrB ← multidrug efflux system protein
RA 311,826 G→C 8.4% I349M (ATC→ATG)  acrB ← multidrug efflux system protein
RA 311,829 G→A 7.9% I348I (ATC→ATT)  acrB ← multidrug efflux system protein
RA 311,832 C→G 7.4% A347A (GCG→GCC)  acrB ← multidrug efflux system protein
RA 311,840 C→A 11.3% V345F (GTC→TTC)  acrB ← multidrug efflux system protein
RA 311,850 A→T 12.6% V341V (GTT→GTA)  acrB ← multidrug efflux system protein
RA 311,868 G→A 9.7% I335I (ATC→ATT) ‡ acrB ← multidrug efflux system protein
RA 311,870 T→G 9.8% I335L (ATC→CTC) ‡ acrB ← multidrug efflux system protein
RA 311,871 T→C 9.7% K334K (AAA→AAG) ‡ acrB ← multidrug efflux system protein
RA 311,873 T→G 9.8% K334Q (AAA→CAA) ‡ acrB ← multidrug efflux system protein
RA 311,874 C→G 9.3% V333V (GTG→GTC)  acrB ← multidrug efflux system protein
RA 311,880 C→T 9.5% P331P (CCG→CCA)  acrB ← multidrug efflux system protein
RA 311,892 G→A 10.6% Y327Y (TAC→TAT)  acrB ← multidrug efflux system protein
RA 311,895 T→A 10.8% P326P (CCA→CCT)  acrB ← multidrug efflux system protein
RA 312,510 T→C 13.5% E121E (GAA→GAG)  acrB ← multidrug efflux system protein
RA 312,513 T→C 13.5% Q120Q (CAA→CAG)  acrB ← multidrug efflux system protein
RA 312,529 A→G 18.4% M115T (ATG→ACG)  acrB ← multidrug efflux system protein
RA 312,531 C→G 18.8% A114A (GCG→GCC)  acrB ← multidrug efflux system protein
RA 312,534 C→G 18.8% L113L (CTG→CTC)  acrB ← multidrug efflux system protein
RA 312,540 C→G 20.5% L111L (CTG→CTC)  acrB ← multidrug efflux system protein
RA 312,558 A→C 16.4% V105V (GTT→GTG)  acrB ← multidrug efflux system protein
RA 312,561 C→T 16.4% Q104Q (CAG→CAA)  acrB ← multidrug efflux system protein
RA 312,573 C→A 11.1% A100A (GCG→GCT) ‡ acrB ← multidrug efflux system protein
RA 312,575 C→G 11.3% A100P (GCG→CCG) ‡ acrB ← multidrug efflux system protein
RA 312,579 A→G 11.7% T98T (ACT→ACC)  acrB ← multidrug efflux system protein
RA 312,582 A→C 7.3% G97G (GGT→GGG)  acrB ← multidrug efflux system protein
RA 312,585 A→G 7.2% S96S (TCT→TCC)  acrB ← multidrug efflux system protein
RA 312,591 A→G 5.2% F94F (TTT→TTC)  acrB ← multidrug efflux system protein
RA 312,624 G→A 6.5% D83D (GAC→GAT)  acrB ← multidrug efflux system protein
RA 312,627 A→G 6.8% S82S (AGT→AGC)  acrB ← multidrug efflux system protein
RA 312,631 T→G 6.5% N81T (AAC→ACC)  acrB ← multidrug efflux system protein
RA 312,633 A→G 6.4% S80S (TCT→TCC)  acrB ← multidrug efflux system protein
RA 312,642 G→A 8.8% Y77Y (TAC→TAT)  acrB ← multidrug efflux system protein
RA 312,687 T→C 20.2% T62T (ACA→ACG)  acrB ← multidrug efflux system protein
RA 312,696 G→A 20.4% D59D (GAC→GAT)  acrB ← multidrug efflux system protein
RA 312,705 T→G 12.2% T56T (ACA→ACC)  acrB ← multidrug efflux system protein
RA 312,708 T→C 12.5% K55K (AAA→AAG) ‡ acrB ← multidrug efflux system protein
RA 312,710 T→G 12.5% K55Q (AAA→CAA) ‡ acrB ← multidrug efflux system protein
RA 313,227 G→A 12.0% L288L (CTG→TTG)  acrA ← multidrug efflux system
RA 313,228 C→A 12.0% L287L (CTG→CTT)  acrA ← multidrug efflux system
RA 313,231 A→C 11.9% T286T (ACT→ACG)  acrA ← multidrug efflux system
RA 313,234 G→A 11.5% H285H (CAC→CAT)  acrA ← multidrug efflux system
RA 313,237 A→T 10.7% D284E (GAT→GAA) ‡ acrA ← multidrug efflux system
RA 313,239 C→G 10.9% D284H (GAT→CAT) ‡ acrA ← multidrug efflux system
RA 313,246 C→A 10.4% P281P (CCG→CCT)  acrA ← multidrug efflux system
RA 313,254 T→C 10.0% I279V (ATC→GTC)  acrA ← multidrug efflux system
RA 313,258 G→A 9.2% R277R (CGC→CGT)  acrA ← multidrug efflux system
RA 313,267 G→T 8.4% I274I (ATC→ATA)  acrA ← multidrug efflux system
RA 313,270 A→G 7.1% S273S (TCT→TCC)  acrA ← multidrug efflux system
RA 313,456 C→A 9.3% P211P (CCG→CCT)  acrA ← multidrug efflux system
RA 313,462 A→G 8.1% L209L (CTT→CTC)  acrA ← multidrug efflux system
RA 313,465 T→C 7.0% Q208Q (CAA→CAG)  acrA ← multidrug efflux system
RA 313,471 C→G 7.4% V206V (GTG→GTC)  acrA ← multidrug efflux system
RA 313,474 G→A 7.5% T205T (ACC→ACT)  acrA ← multidrug efflux system
RA 313,477 T→C 7.9% A204A (GCA→GCG)  acrA ← multidrug efflux system
RA 313,768 A→G 6.1% S107S (AGT→AGC)  acrA ← multidrug efflux system
RA 313,774 G→A 6.4% Y105Y (TAC→TAT)  acrA ← multidrug efflux system
RA 313,777 T→A 6.4% T104T (ACA→ACT) ‡ acrA ← multidrug efflux system
RA 313,778 G→T 6.2% T104K (ACA→AAA) ‡ acrA ← multidrug efflux system
RA 313,780 C→T 6.2% A103A (GCG→GCA)  acrA ← multidrug efflux system
RA 313,795 A→G 7.6% P98P (CCT→CCC)  acrA ← multidrug efflux system
RA 313,801 A→G 8.6% I96I (ATT→ATC)  acrA ← multidrug efflux system
RA 327,386 C→T 59.4% S288F (TCC→TTC)  hemH → ferrochelatase
RA 337,128 G→T 20.8% intergenic (+100/+216) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 337,146 T→G 9.1% intergenic (+118/+198) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 337,149 A→T 9.0% intergenic (+121/+195) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 337,151 C→G 25.8% intergenic (+123/+193) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 337,157 C→A 16.6% intergenic (+129/+187) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 337,171 T→C 21.6% intergenic (+143/+173) ybaQ → / ← copA predicted DNA‑binding transcriptional regulator/copper transporter
RA 349,124 C→T 47.5% A474A (GCC→GCT)  gcl → glyoxylate carboligase
RA 349,960 C→T 56.4% P155L (CCC→CTC)  hyi → hydroxypyruvate isomerase
RA 350,279 G→A 38.9% intergenic (+6/‑94) hyi → / → glxR hydroxypyruvate isomerase/tartronate semialdehyde reductase, NADH‑dependent
RA 350,336 C→T 56.6% intergenic (+63/‑37) hyi → / → glxR hydroxypyruvate isomerase/tartronate semialdehyde reductase, NADH‑dependent
RA 356,218 A→G 5.6% V200A (GTA→GCA)  folD ← bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA 356,222 G→C 6.2% H199D (CAC→GAC)  folD ← bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA 356,225 G→C 6.2% H198D (CAT→GAT)  folD ← bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA 356,229 C→T 6.4% L196L (CTG→CTA)  folD ← bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA 359,417 G→A 7.1% G216S (GGT→AGT)  sfmD → predicted outer membrane export usher protein
RA 359,423 T→A 7.2% W218R (TGG→AGG)  sfmD → predicted outer membrane export usher protein
RA 359,429 T→C 9.2% Y220H (TAT→CAT)  sfmD → predicted outer membrane export usher protein
RA 385,069 T→C 10.9% F93F (TTT→TTC)  cstA → carbon starvation protein
RA 385,072 G→C 11.6% A94A (GCG→GCC)  cstA → carbon starvation protein
RA 385,075 C→T 12.3% A95A (GCC→GCT)  cstA → carbon starvation protein
RA 385,078 T→C 12.3% I96I (ATT→ATC)  cstA → carbon starvation protein
RA 385,084 A→T 15.3% G98G (GGA→GGT)  cstA → carbon starvation protein
RA 385,087 A→T 16.7% A99A (GCA→GCT)  cstA → carbon starvation protein
RA 385,102 G→T 25.0% G104G (GGG→GGT)  cstA → carbon starvation protein
RA 385,108 A→T 29.1% V106V (GTA→GTT)  cstA → carbon starvation protein
RA 385,111 G→C 27.6% L107L (CTG→CTC)  cstA → carbon starvation protein
RA 385,114 G→C 26.1% A108A (GCG→GCC)  cstA → carbon starvation protein
RA 385,120 A→G 26.4% Q110Q (CAA→CAG)  cstA → carbon starvation protein
RA 385,135 G→T 18.7% P115P (CCG→CCT)  cstA → carbon starvation protein
RA 385,138 G→C 19.3% G116G (GGG→GGC)  cstA → carbon starvation protein
RA 385,140 T→C 17.9% M117T (ATG→ACG)  cstA → carbon starvation protein
RA 385,142 A→C 17.9% I118L (ATC→CTC) ‡ cstA → carbon starvation protein
RA 385,144 C→G 18.9% I118M (ATC→ATG) ‡ cstA → carbon starvation protein
RA 385,153 C→G 16.8% L121L (CTC→CTG)  cstA → carbon starvation protein
RA 385,156 T→G 14.3% A122A (GCT→GCG)  cstA → carbon starvation protein
RA 385,162 G→C 16.9% V124V (GTG→GTC)  cstA → carbon starvation protein
RA 385,165 T→G 15.4% V125V (GTT→GTG)  cstA → carbon starvation protein
RA 385,168 C→G 14.6% L126L (CTC→CTG)  cstA → carbon starvation protein
RA 385,202 G→A 13.9% V138I (GTT→ATT) ‡ cstA → carbon starvation protein
RA 385,204 T→C 13.9% V138V (GTT→GTC) ‡ cstA → carbon starvation protein
RA 385,207 T→C 9.8% S139S (TCT→TCC)  cstA → carbon starvation protein
RA 385,208 A→T 9.8% T140S (ACG→TCG) ‡ cstA → carbon starvation protein
RA 385,210 G→T 9.9% T140T (ACG→ACT) ‡ cstA → carbon starvation protein
RA 385,217 G→A 8.3% D143N (GAC→AAC) ‡ cstA → carbon starvation protein
RA 385,219 C→T 8.0% D143D (GAC→GAT) ‡ cstA → carbon starvation protein
RA 385,222 Δ1 bp 8.8% coding (432/2106 nt) cstA → carbon starvation protein
RA 385,225:1 +A 8.9% coding (435/2106 nt) cstA → carbon starvation protein
RA 385,228 G→T 10.7% S146S (TCG→TCT)  cstA → carbon starvation protein
RA 385,231 G→T 9.6% L147L (CTG→CTT)  cstA → carbon starvation protein
RA 385,238 C→A 8.4% L150M (CTG→ATG)  cstA → carbon starvation protein
RA 385,241 G→A 8.6% V151I (GTC→ATC)  cstA → carbon starvation protein
RA 385,411 G→T 13.7% G207G (GGG→GGT)  cstA → carbon starvation protein
RA 385,418 C→A 14.9% L210M (CTG→ATG)  cstA → carbon starvation protein
RA 385,425 A→T 15.7% Y212F (TAT→TTT)  cstA → carbon starvation protein
RA 385,427 C→A 16.0% L213M (CTG→ATG) ‡ cstA → carbon starvation protein
RA 385,429 G→T 16.0% L213L (CTG→CTT) ‡ cstA → carbon starvation protein
RA 385,442 A→G 16.7% I218V (ATT→GTT) ‡ cstA → carbon starvation protein
RA 385,444 T→G 17.2% I218M (ATT→ATG) ‡ cstA → carbon starvation protein
RA 385,447 C→T 16.0% G219G (GGC→GGT)  cstA → carbon starvation protein
RA 385,780 T→C 8.2% F330F (TTT→TTC)  cstA → carbon starvation protein
RA 385,798 C→T 20.6% G336G (GGC→GGT)  cstA → carbon starvation protein
RA 385,804 G→A 23.3% V338V (GTG→GTA)  cstA → carbon starvation protein
RA 385,816 T→C 20.3% H342H (CAT→CAC)  cstA → carbon starvation protein
RA 385,831 T→C 20.3% S347S (TCT→TCC)  cstA → carbon starvation protein
RA 385,834 G→T 17.6% G348G (GGG→GGT)  cstA → carbon starvation protein
RA 385,837 C→G 11.7% T349T (ACC→ACG)  cstA → carbon starvation protein
RA 385,843 G→A 11.1% P351P (CCG→CCA)  cstA → carbon starvation protein
RA 385,846 G→A 10.7% K352K (AAG→AAA)  cstA → carbon starvation protein
RA 385,847 A→C 10.6% M353L (ATG→CTG)  cstA → carbon starvation protein
RA 385,888 T→C 8.8% G366G (GGT→GGC)  cstA → carbon starvation protein
RA 385,890 G→C 9.8% G367A (GGG→GCG) ‡ cstA → carbon starvation protein
RA 385,891 G→A 9.8% G367G (GGG→GGA) ‡ cstA → carbon starvation protein
RA 385,895 T→C 9.3% L369L (TTA→CTA) ‡ cstA → carbon starvation protein
RA 385,897 A→G 9.8% L369L (TTA→TTG) ‡ cstA → carbon starvation protein
RA 385,903 A→G 9.8% E371E (GAA→GAG)  cstA → carbon starvation protein
RA 385,931 T→G 17.7% S381A (TCC→GCC) ‡ cstA → carbon starvation protein
RA 385,933 C→T 17.6% S381S (TCC→TCT) ‡ cstA → carbon starvation protein
RA 385,936 C→G 17.9% A382A (GCC→GCG)  cstA → carbon starvation protein
RA 385,938 G→C 17.6% C383S (TGT→TCT) ‡ cstA → carbon starvation protein
RA 385,939 T→C 17.4% C383C (TGT→TGC) ‡ cstA → carbon starvation protein
RA 385,948 T→A 10.8% D386E (GAT→GAA)  cstA → carbon starvation protein
RA 385,954 C→T 10.1% G388G (GGC→GGT)  cstA → carbon starvation protein
RA 385,955 G→C 10.0% V389L (GTG→CTG) ‡ cstA → carbon starvation protein
RA 385,957 G→T 9.9% V389V (GTG→GTT) ‡ cstA → carbon starvation protein
RA 385,960 T→C 10.0% Y390Y (TAT→TAC)  cstA → carbon starvation protein
RA 385,963 T→C 10.0% F391F (TTT→TTC)  cstA → carbon starvation protein
RA 385,966 C→G 9.7% A392A (GCC→GCG)  cstA → carbon starvation protein
RA 386,404 C→T 8.5% V538V (GTC→GTT)  cstA → carbon starvation protein
RA 386,420 A→G 8.2% I544V (ATT→GTT)  cstA → carbon starvation protein
RA 386,425 C→G 8.0% N545K (AAC→AAG)  cstA → carbon starvation protein
RA 386,427 C→G 8.3% T546S (ACT→AGT) ‡ cstA → carbon starvation protein
RA 386,428 T→C 7.9% T546T (ACT→ACC) ‡ cstA → carbon starvation protein
RA 386,443 T→C 7.1% F551F (TTT→TTC)  cstA → carbon starvation protein
RA 386,449 T→C 8.2% I553I (ATT→ATC)  cstA → carbon starvation protein
RA 386,450 G→T 8.1% A554S (GCC→TCC)  cstA → carbon starvation protein
RA 394,838 G→A 15.7% P63P (CCG→CCA)  ahpF → alkyl hydroperoxide reductase, F52a subunit, FAD/NAD(P)‑binding
RA 412,090 A→G 36.5% V89A (GTG→GCG)  leuS ← leucyl‑tRNA synthetase
RA 412,492 C→T 30.2% intergenic (‑137/+152) leuS ← / ← lnt leucyl‑tRNA synthetase/apolipoprotein N‑acyltransferase
RA 412,564 A→C 41.1% intergenic (‑209/+80) leuS ← / ← lnt leucyl‑tRNA synthetase/apolipoprotein N‑acyltransferase
RA 418,094 C→T 18.9% A55T (GCT→ACT)  miaB ← isopentenyl‑adenosine A37 tRNA methylthiolase
RA 423,971 T→C 21.7% S309G (AGT→GGT)  nagC ← DNA‑binding transcriptional dual regulator
RA 425,152 C→T 27.0% D301N (GAT→AAT)  nagA ← N‑acetylglucosamine‑6‑phosphate deacetylase
RA 434,040 C→T 20.4% intergenic (‑93/+196) fur ← / ← fldA DNA‑binding transcriptional dual regulator/flavodoxin 1
RA 452,736 C→T 17.8% A234V (GCA→GTA)  phr → deoxyribodipyrimidine photolyase, FAD‑binding
RA 454,680 A→T 7.7% R135R (CGT→CGA)  ybgH ← predicted transporter
RA 454,683 C→A 7.4% P134P (CCG→CCT) ‡ ybgH ← predicted transporter
RA 454,684 G→T 7.5% P134Q (CCG→CAG) ‡ ybgH ← predicted transporter
RA 454,690 G→T 7.5% T132N (ACC→AAC)  ybgH ← predicted transporter
RA 454,692 T→C 7.7% P131P (CCA→CCG) ‡ ybgH ← predicted transporter
RA 454,693 G→T 7.7% P131Q (CCA→CAA) ‡ ybgH ← predicted transporter
RA 454,694 G→C 7.8% P131A (CCA→GCA) ‡ ybgH ← predicted transporter
RA 454,695 C→G 7.5% E130D (GAG→GAC)  ybgH ← predicted transporter
RA 454,698 A→G 7.3% Y129Y (TAT→TAC)  ybgH ← predicted transporter
RA 454,701 C→G 7.3% L128L (CTG→CTC)  ybgH ← predicted transporter
RA 454,710 G→A 6.7% L125L (CTC→CTT)  ybgH ← predicted transporter
RA 454,715 G→A 7.2% L124L (CTG→TTG)  ybgH ← predicted transporter
RA 454,989 C→G 16.2% L32L (CTG→CTC)  ybgH ← predicted transporter
RA 454,992 C→T 16.2% L31L (CTG→CTA) ‡ ybgH ← predicted transporter
RA 454,994 G→A 16.4% L31L (CTG→TTG) ‡ ybgH ← predicted transporter
RA 455,013 G→A 29.2% S24S (AGC→AGT)  ybgH ← predicted transporter
RA 455,016 A→G 31.4% F23F (TTT→TTC)  ybgH ← predicted transporter
RA 455,019 A→G 35.0% Y22Y (TAT→TAC)  ybgH ← predicted transporter
RA 455,022 T→C 33.3% E21E (GAA→GAG)  ybgH ← predicted transporter
RA 455,034 C→G 31.2% L17L (CTG→CTC) ‡ ybgH ← predicted transporter
RA 455,036 G→T 30.0% L17M (CTG→ATG) ‡ ybgH ← predicted transporter
RA 455,040 A→C 30.5% V15V (GTT→GTG)  ybgH ← predicted transporter
RA 455,045 C→T 25.0% V14I (GTC→ATC)  ybgH ← predicted transporter
RA 455,052 A→T 20.0% I11I (ATT→ATA)  ybgH ← predicted transporter
RA 455,055 A→C 19.5% A10A (GCT→GCG)  ybgH ← predicted transporter
RA 481,654 T→A 7.7% L16Q (CTG→CAG)  tolQ → membrane spanning protein in TolA‑TolQ‑TolR complex
RA 509,855 G→C 17.1% intergenic (+80/‑103) ybhI → / → ybhJ predicted transporter/predicted hydratase
RA 551,606 G→A 15.0% L640L (CTG→TTG)  ybiW ← predicted pyruvate formate lyase
RA 574,465 G→A 36.3% E432K (GAA→AAA)  ybjD → conserved hypothetical protein with nucleoside triphosphate hydrolase domain
RA 608,004 G→A 7.1% D750D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 608,010 C→T 7.4% Q748Q (CAG→CAA)  pflB ← pyruvate formate lyase I
RA 608,019 T→A 7.3% K745N (AAA→AAT) ‡ pflB ← pyruvate formate lyase I
RA 608,020 T→C 7.3% K745R (AAA→AGA) ‡ pflB ← pyruvate formate lyase I
RA 608,021 T→G 7.4% K745Q (AAA→CAA) ‡ pflB ← pyruvate formate lyase I
RA 608,022 A→G 7.1% T744T (ACT→ACC)  pflB ← pyruvate formate lyase I
RA 608,028 C→T 7.9% S742S (TCG→TCA) ‡ pflB ← pyruvate formate lyase I
RA 608,030 A→C 8.1% S742A (TCG→GCG) ‡ pflB ← pyruvate formate lyase I
RA 608,037 A→G 8.5% R739R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 608,040 T→C 7.8% V738V (GTA→GTG)  pflB ← pyruvate formate lyase I
RA 608,043 T→G 8.1% A737A (GCA→GCC)  pflB ← pyruvate formate lyase I
RA 608,055 T→G 15.4% V733V (GTA→GTC)  pflB ← pyruvate formate lyase I
RA 608,064 G→T 17.8% T730T (ACC→ACA)  pflB ← pyruvate formate lyase I
RA 608,070 C→G 15.5% Q728H (CAG→CAC) ‡ pflB ← pyruvate formate lyase I
RA 608,072 G→T 16.0% Q728K (CAG→AAG) ‡ pflB ← pyruvate formate lyase I
RA 608,073 C→A 15.7% P727P (CCG→CCT)  pflB ← pyruvate formate lyase I
RA 608,090 T→G 16.4% N722H (AAC→CAC)  pflB ← pyruvate formate lyase I
RA 608,091 T→C 16.3% E721E (GAA→GAG)  pflB ← pyruvate formate lyase I
RA 608,094 C→G 15.0% M720I (ATG→ATC)  pflB ← pyruvate formate lyase I
RA 608,097 C→G 13.4% A719A (GCG→GCC)  pflB ← pyruvate formate lyase I
RA 608,100 G→A 13.5% D718D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 608,103 G→C 12.7% L717L (CTC→CTG)  pflB ← pyruvate formate lyase I
RA 608,115 A→C 16.0% R713R (CGT→CGG)  pflB ← pyruvate formate lyase I
RA 608,118 G→A 13.4% N712N (AAC→AAT)  pflB ← pyruvate formate lyase I
RA 608,124 C→T 12.3% V710V (GTG→GTA)  pflB ← pyruvate formate lyase I
RA 608,130 A→G 11.1% V708V (GTT→GTC)  pflB ← pyruvate formate lyase I
RA 608,136 C→G 13.5% L706L (CTG→CTC)  pflB ← pyruvate formate lyase I
RA 608,142 C→T 16.8% Q704Q (CAG→CAA)  pflB ← pyruvate formate lyase I
RA 608,148 A→G 17.4% G702G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 608,156 T→C 16.4% I700V (ATC→GTC)  pflB ← pyruvate formate lyase I
RA 608,157 G→A 16.4% S699S (TCC→TCT) ‡ pflB ← pyruvate formate lyase I
RA 608,158 G→T 16.3% S699Y (TCC→TAC) ‡ pflB ← pyruvate formate lyase I
RA 608,159 A→C 16.3% S699A (TCC→GCC) ‡ pflB ← pyruvate formate lyase I
RA 608,160 T→C 16.4% A698A (GCA→GCG)  pflB ← pyruvate formate lyase I
RA 608,175 G→A 13.9% Y693Y (TAC→TAT)  pflB ← pyruvate formate lyase I
RA 608,178 A→C 14.3% G692G (GGT→GGG)  pflB ← pyruvate formate lyase I
RA 608,186 T→G 12.4% M690L (ATG→CTG)  pflB ← pyruvate formate lyase I
RA 608,190 A→G 11.1% G688G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 608,193 A→G 11.6% A687A (GCT→GCC) ‡ pflB ← pyruvate formate lyase I
RA 608,194 G→A 12.6% A687V (GCT→GTT) ‡ pflB ← pyruvate formate lyase I
RA 608,196 C→A 11.5% L686L (CTG→CTT)  pflB ← pyruvate formate lyase I
RA 608,205 C→T 6.1% K683K (AAG→AAA)  pflB ← pyruvate formate lyase I
RA 608,274 A→G 8.0% A660A (GCT→GCC)  pflB ← pyruvate formate lyase I
RA 608,280 A→G 9.1% A658A (GCT→GCC) ‡ pflB ← pyruvate formate lyase I
RA 608,282 C→T 8.4% A658T (GCT→ACT) ‡ pflB ← pyruvate formate lyase I
RA 608,283 A→G 8.5% F657F (TTT→TTC)  pflB ← pyruvate formate lyase I
RA 608,295 A→C 11.9% A653A (GCT→GCG)  pflB ← pyruvate formate lyase I
RA 608,298 A→C 11.8% V652V (GTT→GTG)  pflB ← pyruvate formate lyase I
RA 608,301 G→C 12.3% S651S (TCC→TCG)  pflB ← pyruvate formate lyase I
RA 608,304 A→C 11.1% T650T (ACT→ACG)  pflB ← pyruvate formate lyase I
RA 608,309 G→A 11.6% L649L (CTG→TTG)  pflB ← pyruvate formate lyase I
RA 608,310 A→T 11.8% S648S (TCT→TCA)  pflB ← pyruvate formate lyase I
RA 608,316 T→C 7.7% V646V (GTA→GTG)  pflB ← pyruvate formate lyase I
RA 608,319 T→G 7.7% A645A (GCA→GCC)  pflB ← pyruvate formate lyase I
RA 608,328 C→G 6.2% Q642H (CAG→CAC) ‡ pflB ← pyruvate formate lyase I
RA 608,329 T→C 6.2% Q642R (CAG→CGG) ‡ pflB ← pyruvate formate lyase I
RA 608,340 G→A 9.2% H638H (CAC→CAT)  pflB ← pyruvate formate lyase I
RA 608,355 A→G 12.9% G633G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 608,361 T→C 11.4% G631G (GGA→GGG) ‡ pflB ← pyruvate formate lyase I
RA 608,362 C→G 12.1% G631A (GGA→GCA) ‡ pflB ← pyruvate formate lyase I
RA 608,370 C→T 15.8% A628A (GCG→GCA) ‡ pflB ← pyruvate formate lyase I
RA 608,372 C→T 15.8% A628T (GCG→ACG) ‡ pflB ← pyruvate formate lyase I
RA 608,373 G→T 15.7% G627G (GGC→GGA)  pflB ← pyruvate formate lyase I
RA 608,376 A→G 14.0% A626A (GCT→GCC)  pflB ← pyruvate formate lyase I
RA 608,379 A→G 14.7% R625R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 608,391 T→C 14.7% P621P (CCA→CCG)  pflB ← pyruvate formate lyase I
RA 608,394 G→C 15.9% T620T (ACC→ACG)  pflB ← pyruvate formate lyase I
RA 608,397 G→A 14.3% N619N (AAC→AAT)  pflB ← pyruvate formate lyase I
RA 608,403 C→G 13.0% T617T (ACG→ACC)  pflB ← pyruvate formate lyase I
RA 608,667 A→G 6.2% G529G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 608,676 A→G 6.8% G526G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 608,679 A→G 7.0% C525C (TGT→TGC)  pflB ← pyruvate formate lyase I
RA 608,682 C→T 6.9% A524A (GCG→GCA)  pflB ← pyruvate formate lyase I
RA 608,688 G→A 10.3% T522T (ACC→ACT)  pflB ← pyruvate formate lyase I
RA 608,693 Δ1 bp 10.3% coding (1561/2283 nt) pflB ← pyruvate formate lyase I
RA 608,697:1 +G 10.1% coding (1557/2283 nt) pflB ← pyruvate formate lyase I
RA 608,700 G→A 10.1% D518D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 608,706 G→A 12.5% D516D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 608,724 A→C 25.2% S510S (TCT→TCG)  pflB ← pyruvate formate lyase I
RA 608,727 G→A 25.2% A509A (GCC→GCT)  pflB ← pyruvate formate lyase I
RA 608,760 G→A 27.9% I498I (ATC→ATT)  pflB ← pyruvate formate lyase I
RA 608,766 G→A 28.2% N496N (AAC→AAT)  pflB ← pyruvate formate lyase I
RA 608,772 T→C 32.3% A494A (GCA→GCG)  pflB ← pyruvate formate lyase I
RA 608,775 A→G 32.3% T493T (ACT→ACC) ‡ pflB ← pyruvate formate lyase I
RA 608,776 G→C 32.3% T493S (ACT→AGT) ‡ pflB ← pyruvate formate lyase I
RA 608,787 T→C 21.9% K489K (AAA→AAG) ‡ pflB ← pyruvate formate lyase I
RA 608,788 T→A 21.8% K489I (AAA→ATA) ‡ pflB ← pyruvate formate lyase I
RA 608,789 T→C 21.9% K489E (AAA→GAA) ‡ pflB ← pyruvate formate lyase I
RA 608,790 A→C 24.5% A488A (GCT→GCG)  pflB ← pyruvate formate lyase I
RA 608,814 C→G 11.1% M480I (ATG→ATC) ‡ pflB ← pyruvate formate lyase I
RA 608,816 T→G 11.3% M480L (ATG→CTG) ‡ pflB ← pyruvate formate lyase I
RA 608,819 G→T 11.2% R479S (CGC→AGC)  pflB ← pyruvate formate lyase I
RA 608,820 C→G 11.3% E478D (GAG→GAC)  pflB ← pyruvate formate lyase I
RA 608,883 C→A 10.8% M457I (ATG→ATT)  pflB ← pyruvate formate lyase I
RA 608,886 T→C 11.2% K456K (AAA→AAG)  pflB ← pyruvate formate lyase I
RA 608,892 T→C 12.0% K454K (AAA→AAG)  pflB ← pyruvate formate lyase I
RA 608,895 T→C 12.0% E453E (GAA→GAG)  pflB ← pyruvate formate lyase I
RA 608,901 A→C 14.1% V451V (GTT→GTG)  pflB ← pyruvate formate lyase I
RA 608,904 G→C 11.9% G450G (GGC→GGG)  pflB ← pyruvate formate lyase I
RA 608,913 G→A 14.7% I447I (ATC→ATT)  pflB ← pyruvate formate lyase I
RA 608,922 C→G 16.0% L444L (CTG→CTC)  pflB ← pyruvate formate lyase I
RA 608,927 T→G 16.2% M443L (ATG→CTG)  pflB ← pyruvate formate lyase I
RA 608,928 G→C 16.6% T442T (ACC→ACG)  pflB ← pyruvate formate lyase I
RA 608,943 T→A 24.0% A437A (GCA→GCT)  pflB ← pyruvate formate lyase I
RA 608,946 A→G 20.2% R436R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 608,949 C→T 20.8% A435A (GCG→GCA)  pflB ← pyruvate formate lyase I
RA 608,955 G→A 25.2% F433F (TTC→TTT)  pflB ← pyruvate formate lyase I
RA 608,970 T→C 17.2% K428K (AAA→AAG)  pflB ← pyruvate formate lyase I
RA 608,978 C→T 15.3% V426I (GTT→ATT)  pflB ← pyruvate formate lyase I
RA 608,979 G→C 14.8% I425M (ATC→ATG) ‡ pflB ← pyruvate formate lyase I
RA 608,981 T→C 15.8% I425V (ATC→GTC) ‡ pflB ← pyruvate formate lyase I
RA 608,985 C→T 15.8% P423P (CCG→CCA)  pflB ← pyruvate formate lyase I
RA 608,991 T→G 15.0% V421V (GTA→GTC)  pflB ← pyruvate formate lyase I
RA 609,000 A→G 11.4% A418A (GCT→GCC)  pflB ← pyruvate formate lyase I
RA 609,006 A→C 7.3% A416A (GCT→GCG)  pflB ← pyruvate formate lyase I
RA 609,012 G→A 6.0% D414D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 609,015 A→G 5.4% D413D (GAT→GAC)  pflB ← pyruvate formate lyase I
RA 609,276 T→C 7.8% E326E (GAA→GAG) ‡ pflB ← pyruvate formate lyase I
RA 609,277 T→G 7.9% E326A (GAA→GCA) ‡ pflB ← pyruvate formate lyase I
RA 609,278 C→A 7.9% E326* (GAA→TAA) ‡ pflB ← pyruvate formate lyase I
RA 609,282 G→A 8.2% Y324Y (TAC→TAT) ‡ pflB ← pyruvate formate lyase I
RA 609,283 T→A 7.8% Y324F (TAC→TTC) ‡ pflB ← pyruvate formate lyase I
RA 609,291 A→T 7.7% T321T (ACT→ACA)  pflB ← pyruvate formate lyase I
RA 609,705 A→G 5.5% R183R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 609,708 G→A 5.5% Y182Y (TAC→TAT)  pflB ← pyruvate formate lyase I
RA 609,720 G→A 12.5% I178I (ATC→ATT)  pflB ← pyruvate formate lyase I
RA 609,723 A→G 14.9% R177R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 609,726 G→C 15.1% G176G (GGC→GGG)  pflB ← pyruvate formate lyase I
RA 609,738 T→G 22.0% A172A (GCA→GCC) ‡ pflB ← pyruvate formate lyase I
RA 609,739 G→C 19.9% A172G (GCA→GGA) ‡ pflB ← pyruvate formate lyase I
RA 609,747 C→T 21.2% L169L (CTG→CTA) ‡ pflB ← pyruvate formate lyase I
RA 609,749 G→A 21.2% L169L (CTG→TTG) ‡ pflB ← pyruvate formate lyase I
RA 609,759 A→C 20.8% V165V (GTT→GTG)  pflB ← pyruvate formate lyase I
RA 609,762 A→G 21.9% G164G (GGT→GGC)  pflB ← pyruvate formate lyase I
RA 609,777 A→G 22.1% R159R (CGT→CGC)  pflB ← pyruvate formate lyase I
RA 609,783 G→C 19.2% I157M (ATC→ATG)  pflB ← pyruvate formate lyase I
RA 609,786 G→A 17.6% D156D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 609,792 A→T 16.8% T154T (ACT→ACA) ‡ pflB ← pyruvate formate lyase I
RA 609,794 T→A 17.3% T154S (ACT→TCT) ‡ pflB ← pyruvate formate lyase I
RA 609,801 G→A 10.3% D151D (GAC→GAT)  pflB ← pyruvate formate lyase I
RA 609,804 G→A 9.2% F150F (TTC→TTT)  pflB ← pyruvate formate lyase I
RA 609,807 C→T 9.7% V149V (GTG→GTA)  pflB ← pyruvate formate lyase I
RA 630,073 C→T 32.4% G10S (GGC→AGC)  ycbC ← conserved inner membrane protein
RA 684,711 G→A 18.7% D23N (GAC→AAC)  yccU → predicted CoA‑binding protein with NAD(P)‑binding Rossmann‑fold domain
RA 705,295 A→G 50.7% G32G (GGT→GGC)  ymcB ← conserved hypothetical protein
RA 706,680 C→T 48.3% R244K (AGG→AAG)  lpxL ← lauryl‑acyl carrier protein (ACP)‑dependent acyltransferase
RA 720,216 T→C 32.0% intergenic (+14/+221) mviN → / ← rne predicted inner membrane protein/fused ribonucleaseE endoribonuclease and scaffold for formation of degradosome
RA 741,873 T→C 12.2% Y124Y (TAT→TAC)  ycfL → hypothetical protein
RA 775,475 C→T 10.9% H366H (CAC→CAT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,487 C→T 24.5% T370T (ACC→ACT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,500 T→C 35.2% L375L (TTA→CTA) ‡ icd → isocitrate dehydrogenase, specific for NADP+
RA 775,502 A→G 35.2% L375L (TTA→TTG) ‡ icd → isocitrate dehydrogenase, specific for NADP+
RA 775,532 C→T 39.7% N385N (AAC→AAT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,535 G→C 39.7% A386A (GCG→GCC)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,538 A→G 38.0% K387K (AAA→AAG)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,547 C→T 31.2% T390T (ACC→ACT)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,559 G→A 30.4% E394E (GAG→GAA)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,571 T→A 34.5% D398E (GAT→GAA)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,580 A→G 26.1% K401K (AAA→AAG)  icd → isocitrate dehydrogenase, specific for NADP+
RA 775,607 C→A 15.5% D410E (GAC→GAA)  icd → isocitrate dehydrogenase, specific for NADP+
RA 788,075 G→A 28.6% P461S (CCA→TCA)  ycgB ← conserved hypothetical protein
RA 805,245 T→C 9.7% intergenic (+46/+54) dhaR → / ← ycgV predicted DNA‑binding transcriptional regulator, dihydroxyacetone/predicted adhesin
RA 805,466 T→C 9.1% N901D (AAC→GAC)  ycgV ← predicted adhesin
RA 806,555 C→T 12.7% G538S (GGC→AGC)  ycgV ← predicted adhesin
RA 820,928 T→A 5.7% F184I (TTC→ATC)  kdsA → 3‑deoxy‑D‑manno‑octulosonate 8‑phosphate synthase
RA 821,445 T→C 38.5% S7G (AGC→GGC)  ldrA ← toxic polypeptide, small
RA 821,535 G→T 29.7% intergenic (‑72/+382) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,537:1 +T 29.7% intergenic (‑74/+380) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,576 T→G 41.9% intergenic (‑113/+341) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,688 T→A 10.1% intergenic (‑225/+229) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,728 A→G 17.6% intergenic (‑265/+189) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,735 A→G 29.1% intergenic (‑272/+182) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,744 C→T 33.3% intergenic (‑281/+173) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,760 G→A 37.5% intergenic (‑297/+157) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,766 G→A 41.3% intergenic (‑303/+151) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,788 T→G 37.8% intergenic (‑325/+129) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 821,826 A→T 38.6% intergenic (‑363/+91) ldrA ← / ← ldrC toxic polypeptide, small/toxic polypeptide, small
RA 822,222 T→A 11.7% intergenic (‑198/+206) ldrC ← / ← chaA toxic polypeptide, small/calcium/sodium:proton antiporter
RA 822,224 G→T 11.5% intergenic (‑200/+204) ldrC ← / ← chaA toxic polypeptide, small/calcium/sodium:proton antiporter
RA 822,269 A→G 8.1% intergenic (‑245/+159) ldrC ← / ← chaA toxic polypeptide, small/calcium/sodium:proton antiporter
RA 822,278 C→T 7.0% intergenic (‑254/+150) ldrC ← / ← chaA toxic polypeptide, small/calcium/sodium:proton antiporter
RA 832,094 C→T 15.0% D184D (GAC→GAT)  narG → nitrate reductase 1, alpha subunit
RA 832,097 T→C 16.1% R185R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 832,103 T→C 15.9% A187A (GCT→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,115 A→G 18.7% P191P (CCA→CCG)  narG → nitrate reductase 1, alpha subunit
RA 832,118 T→C 18.5% I192I (ATT→ATC)  narG → nitrate reductase 1, alpha subunit
RA 832,124 A→G 15.3% A194A (GCA→GCG)  narG → nitrate reductase 1, alpha subunit
RA 832,145 A→C 12.1% A201A (GCA→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,146 T→G 12.2% S202A (TCG→GCG) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,148 G→C 12.3% S202S (TCG→TCC) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,151 T→A 11.4% G203G (GGT→GGA)  narG → nitrate reductase 1, alpha subunit
RA 832,152 G→A 11.3% A204T (GCA→ACA) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,154 A→G 10.7% A204A (GCA→GCG) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,157 C→T 9.7% R205R (CGC→CGT)  narG → nitrate reductase 1, alpha subunit
RA 832,163 C→G 13.5% L207L (CTC→CTG)  narG → nitrate reductase 1, alpha subunit
RA 832,170 A→C 14.1% I210L (ATT→CTT)  narG → nitrate reductase 1, alpha subunit
RA 832,178 T→C 12.3% G212G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 832,181 T→C 12.6% T213T (ACT→ACC)  narG → nitrate reductase 1, alpha subunit
RA 832,184 C→T 12.9% C214C (TGC→TGT)  narG → nitrate reductase 1, alpha subunit
RA 832,190 C→T 11.9% S216S (AGC→AGT)  narG → nitrate reductase 1, alpha subunit
RA 832,205 C→T 17.8% Y221Y (TAC→TAT)  narG → nitrate reductase 1, alpha subunit
RA 832,212 T→C 23.5% L224L (TTG→CTG)  narG → nitrate reductase 1, alpha subunit
RA 832,217 T→G 22.1% P225P (CCT→CCG)  narG → nitrate reductase 1, alpha subunit
RA 832,220 T→C 22.1% P226P (CCT→CCC)  narG → nitrate reductase 1, alpha subunit
RA 832,223 G→C 20.4% A227A (GCG→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,226 T→G 24.6% S228S (TCT→TCG)  narG → nitrate reductase 1, alpha subunit
RA 832,230 C→A 19.0% Q230K (CAA→AAA) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,231 A→T 19.5% Q230L (CAA→CTA) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,232 A→G 19.7% Q230Q (CAA→CAG) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,250 T→C 18.9% T236T (ACT→ACC)  narG → nitrate reductase 1, alpha subunit
RA 832,268 T→C 27.3% A242A (GCT→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,277 C→T 24.7% Y245Y (TAC→TAT)  narG → nitrate reductase 1, alpha subunit
RA 832,307 A→T 38.8% S255S (TCA→TCT)  narG → nitrate reductase 1, alpha subunit
RA 832,313 G→A 37.2% V257V (GTG→GTA)  narG → nitrate reductase 1, alpha subunit
RA 832,322 G→A 32.2% T260T (ACG→ACA)  narG → nitrate reductase 1, alpha subunit
RA 832,328 C→G 23.9% T262T (ACC→ACG)  narG → nitrate reductase 1, alpha subunit
RA 832,334 T→C 21.4% D264D (GAT→GAC)  narG → nitrate reductase 1, alpha subunit
RA 832,337 T→C 20.3% A265A (GCT→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,349 T→C 7.2% T269T (ACT→ACC)  narG → nitrate reductase 1, alpha subunit
RA 832,355 G→A 6.9% V271V (GTG→GTA)  narG → nitrate reductase 1, alpha subunit
RA 832,358 T→C 6.7% R272R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 832,413 C→T 9.2% L291L (CTG→TTG)  narG → nitrate reductase 1, alpha subunit
RA 832,421 T→C 12.2% D293D (GAT→GAC)  narG → nitrate reductase 1, alpha subunit
RA 832,423 T→A 12.2% L294Q (CTG→CAG)  narG → nitrate reductase 1, alpha subunit
RA 832,442 G→A 12.3% Q300Q (CAG→CAA)  narG → nitrate reductase 1, alpha subunit
RA 832,448 C→T 7.3% T302T (ACC→ACT)  narG → nitrate reductase 1, alpha subunit
RA 832,452 G→A 6.6% A304T (GCG→ACG) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,453 C→G 6.6% A304G (GCG→GGG) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,454 G→C 6.6% A304A (GCG→GCC) ‡ narG → nitrate reductase 1, alpha subunit
RA 832,457 A→C 6.6% A305A (GCA→GCC)  narG → nitrate reductase 1, alpha subunit
RA 832,458 A→C 6.6% M306L (ATG→CTG)  narG → nitrate reductase 1, alpha subunit
RA 832,464 C→A 7.2% L308M (CTG→ATG)  narG → nitrate reductase 1, alpha subunit
RA 832,469 G→A 6.8% A309A (GCG→GCA)  narG → nitrate reductase 1, alpha subunit
RA 832,712 T→G 8.7% S390S (TCT→TCG)  narG → nitrate reductase 1, alpha subunit
RA 833,144 C→T 8.6% H534H (CAC→CAT)  narG → nitrate reductase 1, alpha subunit
RA 833,147 T→G 10.1% G535G (GGT→GGG)  narG → nitrate reductase 1, alpha subunit
RA 833,150 T→C 7.9% R536R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 833,163 G→C 13.3% V541L (GTC→CTC)  narG → nitrate reductase 1, alpha subunit
RA 833,168 T→C 13.3% G542G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 833,171 G→A 10.9% A543A (GCG→GCA)  narG → nitrate reductase 1, alpha subunit
RA 833,174 G→T 10.8% G544G (GGG→GGT)  narG → nitrate reductase 1, alpha subunit
RA 833,175 C→G 10.5% L545V (CTG→GTG) ‡ narG → nitrate reductase 1, alpha subunit
RA 833,177 G→T 10.7% L545L (CTG→CTT) ‡ narG → nitrate reductase 1, alpha subunit
RA 833,195 C→G 10.5% L551L (CTC→CTG)  narG → nitrate reductase 1, alpha subunit
RA 833,198 T→C 10.8% D552D (GAT→GAC)  narG → nitrate reductase 1, alpha subunit
RA 833,207 T→C 10.4% Y555Y (TAT→TAC)  narG → nitrate reductase 1, alpha subunit
RA 833,231 T→C 7.4% I563I (ATT→ATC)  narG → nitrate reductase 1, alpha subunit
RA 833,240 C→T 9.1% G566G (GGC→GGT)  narG → nitrate reductase 1, alpha subunit
RA 833,249 T→G 16.2% G569G (GGT→GGG)  narG → nitrate reductase 1, alpha subunit
RA 833,252 G→A 14.3% Q570Q (CAG→CAA)  narG → nitrate reductase 1, alpha subunit
RA 833,258 G→T 15.8% G572G (GGG→GGT)  narG → nitrate reductase 1, alpha subunit
RA 833,270 G→A 14.6% A576A (GCG→GCA)  narG → nitrate reductase 1, alpha subunit
RA 833,279 A→C 15.4% V579V (GTA→GTC)  narG → nitrate reductase 1, alpha subunit
RA 833,282 T→C 15.0% G580G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 833,843 T→C 6.8% D767D (GAT→GAC)  narG → nitrate reductase 1, alpha subunit
RA 833,847 G→C 8.9% V769L (GTG→CTG)  narG → nitrate reductase 1, alpha subunit
RA 833,852 T→G 6.1% V770V (GTT→GTG)  narG → nitrate reductase 1, alpha subunit
RA 833,858 G→C 7.6% L772L (CTG→CTC)  narG → nitrate reductase 1, alpha subunit
RA 833,867 T→C 13.4% R775R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 833,868 C→A 13.4% L776M (CTG→ATG)  narG → nitrate reductase 1, alpha subunit
RA 833,873 G→C 15.1% S777S (TCG→TCC)  narG → nitrate reductase 1, alpha subunit
RA 833,876 C→T 12.5% S778S (AGC→AGT)  narG → nitrate reductase 1, alpha subunit
RA 833,882 T→C 14.3% C780C (TGT→TGC)  narG → nitrate reductase 1, alpha subunit
RA 833,885 C→G 14.3% L781L (CTC→CTG)  narG → nitrate reductase 1, alpha subunit
RA 833,887 A→T 14.4% Y782F (TAT→TTT) ‡ narG → nitrate reductase 1, alpha subunit
RA 833,888 T→C 15.1% Y782Y (TAT→TAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 833,894 C→T 20.0% D784D (GAC→GAT)  narG → nitrate reductase 1, alpha subunit
RA 833,898 A→G 20.0% I786V (ATT→GTT)  narG → nitrate reductase 1, alpha subunit
RA 833,901 T→C 28.1% L787L (TTG→CTG)  narG → nitrate reductase 1, alpha subunit
RA 833,906 G→C 28.8% P788P (CCG→CCC)  narG → nitrate reductase 1, alpha subunit
RA 833,909 G→C 29.3% T789T (ACG→ACC)  narG → nitrate reductase 1, alpha subunit
RA 833,912 G→C 28.9% A790A (GCG→GCC)  narG → nitrate reductase 1, alpha subunit
RA 833,933 C→T 36.2% D797D (GAC→GAT)  narG → nitrate reductase 1, alpha subunit
RA 833,939 T→C 35.1% N799N (AAT→AAC)  narG → nitrate reductase 1, alpha subunit
RA 833,942 T→C 35.7% T800T (ACT→ACC)  narG → nitrate reductase 1, alpha subunit
RA 833,966 C→T 34.2% H808H (CAC→CAT)  narG → nitrate reductase 1, alpha subunit
RA 833,972 G→T 41.3% L810L (CTG→CTT)  narG → nitrate reductase 1, alpha subunit
RA 833,993 C→G 33.3% A817A (GCC→GCG)  narG → nitrate reductase 1, alpha subunit
RA 834,000 G→T 31.0% A820S (GCG→TCG) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,002 G→A 30.4% A820A (GCG→GCA) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,003 A→C 28.6% K821Q (AAA→CAA) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,004 A→G 28.6% K821R (AAA→AGA) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,005 A→C 28.6% K821N (AAA→AAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,028 C→G 19.2% A829G (GCC→GGC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,029 C→T 19.2% A829A (GCC→GCT) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,182 T→C 15.9% G880G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 834,194 A→G 18.4% P884P (CCA→CCG)  narG → nitrate reductase 1, alpha subunit
RA 834,195 C→A 18.4% H885N (CAC→AAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,197 C→T 18.4% H885H (CAC→CAT) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,201 A→G 20.0% M887V (ATG→GTG)  narG → nitrate reductase 1, alpha subunit
RA 834,205 T→C 20.0% V888A (GTC→GCC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,206 C→G 20.1% V888V (GTC→GTG) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,209 A→G 21.4% V889V (GTA→GTG)  narG → nitrate reductase 1, alpha subunit
RA 834,218 T→C 22.9% D892D (GAT→GAC)  narG → nitrate reductase 1, alpha subunit
RA 834,221 T→C 22.9% Y893Y (TAT→TAC)  narG → nitrate reductase 1, alpha subunit
RA 834,224 G→T 23.7% P894P (CCG→CCT)  narG → nitrate reductase 1, alpha subunit
RA 834,227 G→T 23.3% A895A (GCG→GCT)  narG → nitrate reductase 1, alpha subunit
RA 834,230 T→G 23.2% T896T (ACT→ACG)  narG → nitrate reductase 1, alpha subunit
RA 834,233 C→T 23.6% Y897Y (TAC→TAT)  narG → nitrate reductase 1, alpha subunit
RA 834,248 T→G 14.3% S902S (TCT→TCG)  narG → nitrate reductase 1, alpha subunit
RA 834,249 A→C 14.6% I903L (ATC→CTC)  narG → nitrate reductase 1, alpha subunit
RA 834,440 G→T 13.9% Q966H (CAG→CAT)  narG → nitrate reductase 1, alpha subunit
RA 834,443 A→T 13.5% V967V (GTA→GTT)  narG → nitrate reductase 1, alpha subunit
RA 834,446 C→A 12.9% A968A (GCC→GCA)  narG → nitrate reductase 1, alpha subunit
RA 834,449 G→C 12.7% V969V (GTG→GTC)  narG → nitrate reductase 1, alpha subunit
RA 834,482 T→G 17.1% G980G (GGT→GGG)  narG → nitrate reductase 1, alpha subunit
RA 834,485 T→C 17.4% R981R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 834,488 C→A 17.3% D982E (GAC→GAA)  narG → nitrate reductase 1, alpha subunit
RA 834,494 G→C 21.7% T984T (ACG→ACC)  narG → nitrate reductase 1, alpha subunit
RA 834,507 A→C 35.3% N989H (AAT→CAT) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,509 T→C 37.5% N989N (AAT→AAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,515 A→G 42.9% E991E (GAA→GAG)  narG → nitrate reductase 1, alpha subunit
RA 834,527 C→T 45.9% I995I (ATC→ATT)  narG → nitrate reductase 1, alpha subunit
RA 834,533 C→T 43.1% F997F (TTC→TTT)  narG → nitrate reductase 1, alpha subunit
RA 834,548 A→G 34.5% A1002A (GCA→GCG)  narG → nitrate reductase 1, alpha subunit
RA 834,557 C→T 30.3% R1005R (CGC→CGT)  narG → nitrate reductase 1, alpha subunit
RA 834,575 G→C 27.0% P1011P (CCG→CCC)  narG → nitrate reductase 1, alpha subunit
RA 834,584 T→C 19.1% S1014S (TCT→TCC)  narG → nitrate reductase 1, alpha subunit
RA 834,594 G→A 21.7% D1018N (GAT→AAT) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,595 A→G 21.0% D1018G (GAT→GGT) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,596 T→C 22.0% D1018D (GAT→GAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,599 A→T 23.9% E1019D (GAA→GAT)  narG → nitrate reductase 1, alpha subunit
RA 834,605 T→C 25.7% V1021V (GTT→GTC)  narG → nitrate reductase 1, alpha subunit
RA 834,608 T→C 26.1% S1022S (TCT→TCC)  narG → nitrate reductase 1, alpha subunit
RA 834,611 C→T 26.8% Y1023Y (TAC→TAT)  narG → nitrate reductase 1, alpha subunit
RA 834,617 C→G 27.5% A1025A (GCC→GCG)  narG → nitrate reductase 1, alpha subunit
RA 834,620 T→A 28.6% G1026G (GGT→GGA)  narG → nitrate reductase 1, alpha subunit
RA 834,635 C→T 20.5% H1031H (CAC→CAT)  narG → nitrate reductase 1, alpha subunit
RA 834,639 C→T 20.0% L1033L (CTG→TTG) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,641 G→A 20.1% L1033L (CTG→CTA) ‡ narG → nitrate reductase 1, alpha subunit
RA 834,644 C→T 18.7% I1034I (ATC→ATT)  narG → nitrate reductase 1, alpha subunit
RA 834,647 A→G 19.0% P1035P (CCA→CCG)  narG → nitrate reductase 1, alpha subunit
RA 834,653 T→C 18.5% R1037R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 834,659 C→G 20.8% L1039L (CTC→CTG)  narG → nitrate reductase 1, alpha subunit
RA 834,662 T→G 20.8% S1040S (TCT→TCG)  narG → nitrate reductase 1, alpha subunit
RA 834,665 T→A 18.6% G1041G (GGT→GGA)  narG → nitrate reductase 1, alpha subunit
RA 834,668 T→C 18.6% R1042R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 834,674 A→G 16.4% Q1044Q (CAA→CAG)  narG → nitrate reductase 1, alpha subunit
RA 834,677 G→C 17.1% L1045L (CTG→CTC)  narG → nitrate reductase 1, alpha subunit
RA 834,689 C→T 17.6% H1049H (CAC→CAT)  narG → nitrate reductase 1, alpha subunit
RA 834,691 A→C 18.6% Q1050P (CAG→CCG)  narG → nitrate reductase 1, alpha subunit
RA 834,703 A→C 18.6% D1054A (GAT→GCT)  narG → nitrate reductase 1, alpha subunit
RA 834,707 C→T 19.7% F1055F (TTC→TTT)  narG → nitrate reductase 1, alpha subunit
RA 834,720 C→G 11.4% L1060V (CTG→GTG)  narG → nitrate reductase 1, alpha subunit
RA 834,724 T→C 10.4% V1061A (GTT→GCT)  narG → nitrate reductase 1, alpha subunit
RA 834,731 T→C 8.3% R1063R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 834,737 G→T 10.3% P1065P (CCG→CCT)  narG → nitrate reductase 1, alpha subunit
RA 834,827 G→A 15.6% K1095K (AAG→AAA)  narG → nitrate reductase 1, alpha subunit
RA 834,833 T→C 16.0% G1097G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 834,836 C→T 14.5% I1098I (ATC→ATT)  narG → nitrate reductase 1, alpha subunit
RA 834,842 C→A 14.4% S1100S (TCC→TCA)  narG → nitrate reductase 1, alpha subunit
RA 834,851 C→T 8.7% S1103S (AGC→AGT)  narG → nitrate reductase 1, alpha subunit
RA 834,854 C→A 7.3% D1104E (GAC→GAA)  narG → nitrate reductase 1, alpha subunit
RA 834,863 G→A 7.5% L1107L (CTG→CTA)  narG → nitrate reductase 1, alpha subunit
RA 834,971 T→C 7.4% G1143G (GGT→GGC)  narG → nitrate reductase 1, alpha subunit
RA 834,974 T→G 8.3% A1144A (GCT→GCG)  narG → nitrate reductase 1, alpha subunit
RA 834,986 T→C 12.8% R1148R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 834,992 T→G 14.4% V1150V (GTT→GTG)  narG → nitrate reductase 1, alpha subunit
RA 835,001 G→A 15.6% Q1153Q (CAG→CAA)  narG → nitrate reductase 1, alpha subunit
RA 835,007 T→A 15.9% V1155V (GTT→GTA)  narG → nitrate reductase 1, alpha subunit
RA 835,011 G→C 16.7% A1157P (GCA→CCA) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,013 A→G 16.5% A1157A (GCA→GCG) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,016 G→C 16.6% G1158G (GGG→GGC)  narG → nitrate reductase 1, alpha subunit
RA 835,031 C→T 16.0% Y1163Y (TAC→TAT)  narG → nitrate reductase 1, alpha subunit
RA 835,037 G→C 10.3% A1165A (GCG→GCC)  narG → nitrate reductase 1, alpha subunit
RA 835,046 T→C 5.1% R1168R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 835,178 T→C 18.5% Y1212Y (TAT→TAC)  narG → nitrate reductase 1, alpha subunit
RA 835,187 A→C 18.6% V1215V (GTA→GTC)  narG → nitrate reductase 1, alpha subunit
RA 835,190 T→A 19.1% G1216G (GGT→GGA)  narG → nitrate reductase 1, alpha subunit
RA 835,193 T→G 19.0% S1217S (TCT→TCG)  narG → nitrate reductase 1, alpha subunit
RA 835,208 T→C 15.3% F1222F (TTT→TTC)  narG → nitrate reductase 1, alpha subunit
RA 835,209 G→A 15.3% V1223I (GTT→ATT) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,211 T→C 15.3% V1223V (GTT→GTC) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,212 G→A 15.3% V1224I (GTA→ATA) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,214 A→G 13.0% V1224V (GTA→GTG) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,215 G→A 13.0% V1225M (GTG→ATG) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,217 G→C 13.2% V1225V (GTG→GTC) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,220 T→C 13.5% R1226R (CGT→CGC)  narG → nitrate reductase 1, alpha subunit
RA 835,233 A→G 22.0% I1231V (ATT→GTT)  narG → nitrate reductase 1, alpha subunit
RA 835,236 G→A 22.6% D1232N (GAC→AAC)  narG → nitrate reductase 1, alpha subunit
RA 835,242 T→C 13.9% L1234L (TTA→CTA) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,244 A→G 14.1% L1234L (TTA→TTG) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,249 G→A 13.4% G1236D (GGC→GAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,250 C→T 12.9% G1236G (GGC→GGT) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,256 C→T 12.6% G1238G (GGC→GGT)  narG → nitrate reductase 1, alpha subunit
RA 835,257 A→C 12.5% N1239H (AAT→CAT) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,258 A→G 12.5% N1239S (AAT→AGT) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,259 T→C 12.6% N1239N (AAT→AAC) ‡ narG → nitrate reductase 1, alpha subunit
RA 835,262 C→T 12.6% D1240D (GAC→GAT)  narG → nitrate reductase 1, alpha subunit
RA 835,275 Δ1 bp 18.7% coding (3733/3744 nt) narG → nitrate reductase 1, alpha subunit
RA 835,278:1 +A 17.1% coding (3736/3744 nt) narG → nitrate reductase 1, alpha subunit
RA 835,279 T→A 18.2% V1246E (GTA→GAA)  narG → nitrate reductase 1, alpha subunit
RA 835,291 T→C 26.8% I3I (ATT→ATC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,315 G→T 36.3% L11L (CTG→CTT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,318 T→C 37.5% N12N (AAT→AAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,324 T→C 40.6% D14D (GAT→GAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,327 G→A 39.4% K15K (AAG→AAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,330 C→T 38.9% C16C (TGC→TGT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,342 C→T 39.2% H20H (CAC→CAT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,351 A→G 30.9% S23S (TCA→TCG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,354 T→G 29.6% V24V (GTT→GTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,376 A→G 24.9% S32G (AGC→GGC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,378 C→G 25.2% S32R (AGC→AGG) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,381 T→C 24.9% R33R (CGT→CGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,388 G→A 21.3% V36M (GTG→ATG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,393 A→G 21.5% E37E (GAA→GAG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,396 T→C 21.5% Y38Y (TAT→TAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,399 G→A 20.3% A39A (GCG→GCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,405 C→T 18.3% F41F (TTC→TTT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,414 G→C 9.6% V44V (GTG→GTC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,768 C→G 12.7% D162E (GAC→GAG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,769 A→G 12.7% N163D (AAC→GAC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,770 A→C 12.8% N163T (AAC→ACC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,774 C→G 15.1% I164M (ATC→ATG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,777 G→A 13.3% Q165Q (CAG→CAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,782 C→A 13.0% A167E (GCG→GAG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,789 T→C 14.3% Y169Y (TAT→TAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,790 A→G 14.3% S170G (AGC→GGC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,792 C→G 12.3% S170R (AGC→AGG) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,798 C→T 13.9% F172F (TTC→TTT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,819 T→C 19.6% Y179Y (TAT→TAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,820 T→C 19.6% L180L (TTG→CTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,846 G→C 20.9% L188L (CTG→CTC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,848:1 +T 21.3% coding (566/1539 nt) narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,852 G→A 21.6% P190P (CCG→CCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,855 Δ1 bp 22.2% coding (573/1539 nt) narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,858 T→C 25.8% C192C (TGT→TGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,873 G→A 28.8% P197P (CCG→CCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,879 T→C 26.4% G199G (GGT→GGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,882 G→T 25.3% A200A (GCG→GCT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,885 T→C 24.2% I201I (ATT→ATC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,891 G→A 22.0% K203K (AAG→AAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,894 T→C 15.9% R204R (CGT→CGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,903 T→C 12.5% D207D (GAT→GAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,909 C→T 14.4% I209I (ATC→ATT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,912 C→G 14.6% V210V (GTC→GTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,918 C→T 14.8% I212I (ATC→ATT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,921 C→T 15.0% D213D (GAC→GAT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,946 A→T 22.4% M222L (ATG→TTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,954 C→A 24.2% I224I (ATC→ATA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,956 C→G 24.2% T225S (ACT→AGT) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,957 T→C 24.2% T225T (ACT→ACC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,960 A→T 24.5% G226G (GGA→GGT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,963 C→T 27.6% C227C (TGC→TGT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,993 G→A 25.0% K237K (AAG→AAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 835,999 T→C 22.8% G239G (GGT→GGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,005 T→A 23.0% S241S (TCT→TCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,008 G→A 17.2% E242E (GAG→GAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,011 G→A 17.2% K243K (AAG→AAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,047 G→A 14.5% Q255Q (CAG→CAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,302 G→A 34.1% A340A (GCG→GCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,305 G→A 33.3% L341L (CTG→CTA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,309 C→T 33.3% L343L (CTG→TTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,314 T→C 32.0% H344H (CAT→CAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,317 G→T 32.0% P345P (CCG→CCT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,323 T→C 29.6% Y347Y (TAT→TAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,329 A→C 31.4% T349T (ACA→ACC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,350 G→T 21.9% V356V (GTG→GTT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,353 G→T 22.0% P357P (CCG→CCT)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,356 T→G 22.1% P358P (CCT→CCG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,362 T→A 16.7% S360S (TCT→TCA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,443 A→G 23.9% V387V (GTA→GTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,446 G→A 22.0% Q388Q (CAG→CAA)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,452 G→C 25.0% L390L (CTG→CTC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,455 G→C 25.0% A391A (GCG→GCC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,459 C→A 27.6% L393M (CTG→ATG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,462 C→T 27.6% L394L (CTG→TTG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,466 C→G 24.9% T395S (ACC→AGC) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,467 C→T 25.0% T395T (ACC→ACT) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,473 T→C 24.5% G397G (GGT→GGC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,480 A→G 16.1% K400E (AAA→GAA) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,481 A→G 16.1% K400R (AAA→AGA) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,482 A→T 16.1% K400N (AAA→AAT) ‡ narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,494 C→G 8.0% R404R (CGC→CGG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,497 A→G 7.4% A405A (GCA→GCG)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 836,612 T→C 22.2% Y444H (TAC→CAC)  narH → nitrate reductase 1, beta (Fe‑S) subunit
RA 837,036 A→G 11.5% S73S (TCA→TCG)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,040 T→C 12.0% L75L (TTG→CTG)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,048 T→C 17.6% F77F (TTT→TTC)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,057 G→T 21.7% V80V (GTG→GTT)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,060 C→T 20.0% H81H (CAC→CAT)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,062 G→C 20.0% G82A (GGC→GCC)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,066 A→G 23.4% E83E (GAA→GAG)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,075 C→T 20.7% D86D (GAC→GAT)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,087 G→A 20.4% A90A (GCG→GCA)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,193 C→T 27.8% Q126* (CAA→TAA)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 837,716 T→C 12.2% F63F (TTT→TTC)  narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 837,722 T→G 12.8% G65G (GGT→GGG)  narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 837,728 C→G 12.7% F67L (TTC→TTG)  narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 837,734 T→C 13.1% G69G (GGT→GGC)  narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 837,738 C→T 11.9% L71L (CTG→TTG) ‡ narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 837,740 G→A 11.6% L71L (CTG→CTA) ‡ narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 845,737 T→C 15.5% Y178H (TAC→CAC)  tdk → thymidine kinase/deoxyuridine kinase
RA 871,512 T→C 10.4% I504T (ATT→ACT)  topA → DNA topoisomerase I, omega subunit
RA 890,121 T→C 28.6% intergenic (‑128/+240) fabI ← / ← ycjD enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/conserved hypothetical protein
RA 910,889 G→A 20.0% K43K (AAG→AAA)  ycjV → predicted sugar transporter subunit
RA 910,895 C→T 22.3% T45T (ACC→ACT)  ycjV → predicted sugar transporter subunit
RA 910,896 A→T 22.3% T46S (ACC→TCC) ‡ ycjV → predicted sugar transporter subunit
RA 910,897 C→T 22.8% T46I (ACC→ATC) ‡ ycjV → predicted sugar transporter subunit
RA 910,898 C→A 22.8% T46T (ACC→ACA) ‡ ycjV → predicted sugar transporter subunit
RA 910,923 G→A 31.3% E55K (GAG→AAG) ‡ ycjV → predicted sugar transporter subunit
RA 910,924 A→C 31.4% E55A (GAG→GCG) ‡ ycjV → predicted sugar transporter subunit
RA 910,930 G→C 27.0% S57T (AGC→ACC)  ycjV → predicted sugar transporter subunit
RA 910,932 G→A 27.0% G58S (GGC→AGC)  ycjV → predicted sugar transporter subunit
RA 910,940 T→C 22.5% D60D (GAT→GAC)  ycjV → predicted sugar transporter subunit
RA 910,946 G→C 14.8% L62F (TTG→TTC)  ycjV → predicted sugar transporter subunit
RA 910,951 A→G 6.7% D64G (GAC→GGC) ‡ ycjV → predicted sugar transporter subunit
RA 910,952 C→T 6.9% D64D (GAC→GAT) ‡ ycjV → predicted sugar transporter subunit
RA 910,954 G→A 6.7% G65D (GGC→GAC) ‡ ycjV → predicted sugar transporter subunit
RA 910,955 C→G 6.7% G65G (GGC→GGG) ‡ ycjV → predicted sugar transporter subunit
RA 917,592 A→G 31.2% L311L (TTA→TTG)  tyrR → DNA‑binding transcriptional dual regulator, tyrosine‑binding
RA 922,063 C→T 23.8% R45* (CGA→TGA)  ycjZ → predicted DNA‑binding transcriptional regulator
RA 943,008 A→G 8.4% L45S (TTA→TCA)  ddpF ← D‑Ala‑D‑Ala transporter subunit
RA 965,844 A→T 53.5% V17D (GTT→GAT)  ydeM ← conserved hypothetical protein
RA 974,990 A→T 54.6% intergenic (+742/+250) lsrB → / ← ydeH AI2 transporter/conserved hypothetical protein
RA 975,257:1 +A 43.5% coding (358/375 nt) ydeH ← conserved hypothetical protein
RA 980,208 A→G 39.7% Y33H (TAT→CAT)  cspI ← cold shock protein
RA 980,233 T→A 7.7% K24N (AAA→AAT) ‡ cspI ← cold shock protein
RA 980,235 T→C 10.9% K24E (AAA→GAA) ‡ cspI ← cold shock protein
RA 980,236 C→A 10.6% P23P (CCG→CCT)  cspI ← cold shock protein
RA 980,239 C→A 12.0% T22T (ACG→ACT)  cspI ← cold shock protein
RA 980,245 G→A 8.7% F20F (TTC→TTT)  cspI ← cold shock protein
RA 980,248 A→G 12.8% G19G (GGT→GGC)  cspI ← cold shock protein
RA 980,260 T→A 12.3% E15D (GAA→GAT)  cspI ← cold shock protein
RA 980,263 A→T 5.4% P14P (CCT→CCA) ‡ cspI ← cold shock protein
RA 980,265 G→C 18.2% P14A (CCT→GCT) ‡ cspI ← cold shock protein
RA 980,278 C→T 14.8% V9V (GTG→GTA)  cspI ← cold shock protein
RA 981,683 Δ1 bp 17.2% coding (11/533 nt) ydfQ ← predicted lysozyme
RA 982,587 T→C 17.1% S11S (TCT→TCC)  ydfA → hypothetical protein
RA 982,595 A→G 18.8% Y14C (TAC→TGC)  ydfA → hypothetical protein
RA 982,605 T→C 22.3% F17F (TTT→TTC)  ydfA → hypothetical protein
RA 982,608 A→C 22.9% P18P (CCA→CCC)  ydfA → hypothetical protein
RA 982,617 C→T 27.5% D21D (GAC→GAT)  ydfA → hypothetical protein
RA 982,620 C→A 28.5% G22G (GGC→GGA)  ydfA → hypothetical protein
RA 982,629 C→T 29.6% T25T (ACC→ACT)  ydfA → hypothetical protein
RA 982,632 A→C 28.3% A26A (GCA→GCC)  ydfA → hypothetical protein
RA 982,656 G→A 23.0% T34T (ACG→ACA)  ydfA → hypothetical protein
RA 982,670 A→C 19.1% N39T (AAT→ACT)  ydfA → hypothetical protein
RA 983,505 T→C 16.3% intergenic (+417/‑151) ydfC → / → dicB hypothetical protein/cell division inhibition protein
RA 983,519 G→A 14.9% intergenic (+431/‑137) ydfC → / → dicB hypothetical protein/cell division inhibition protein
RA 983,528 C→T 14.6% intergenic (+440/‑128) ydfC → / → dicB hypothetical protein/cell division inhibition protein
RA 1,008,267 C→T 21.4% C340C (TGC→TGT)  ydgI → predicted arginine/ornithine antiporter transporter
RA 1,009,234 G→A 15.1% D190N (GAT→AAT)  folM → dihydrofolate reductase isozyme
RA 1,014,482 A→G 21.4% D529D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,488 C→G 25.8% V527V (GTG→GTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,491 A→C 26.7% L526L (CTT→CTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,515 C→T 27.3% V518V (GTG→GTA)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,521 A→G 27.3% I516I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,533 G→A 25.0% A512A (GCC→GCT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,611 A→G 22.9% G486G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,617 A→G 25.4% S484S (AGT→AGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,620 G→A 24.5% G483G (GGC→GGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,623 A→G 24.6% L482L (CTT→CTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,644 T→A 44.9% K475N (AAA→AAT) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,646 T→G 44.9% K475Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,650 G→C 42.9% A473A (GCC→GCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,653 A→G 41.2% D472D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,656 C→G 37.2% T471T (ACG→ACC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,659 C→A 38.7% V470V (GTG→GTT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,668 G→A 39.1% S467S (AGC→AGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,677 G→A 29.6% G464G (GGC→GGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,698 A→G 24.2% S457S (AGT→AGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,701 T→G 23.0% G456G (GGA→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,707 C→G 21.3% Q454H (CAG→CAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,710 C→G 20.5% A453A (GCG→GCC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,712 C→A 21.6% A453S (GCG→TCG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,719 T→C 20.7% Q450Q (CAA→CAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,720 T→A 20.7% Q450L (CAA→CTA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,725 G→C 21.7% V448V (GTC→GTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,728 A→G 20.7% Y447Y (TAT→TAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,731 A→G 18.6% S446S (TCT→TCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,734 A→G 13.6% D445D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,764 A→T 22.2% S435S (TCT→TCA)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,770 G→T 21.0% S433S (TCC→TCA)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,773 G→T 20.5% A432A (GCC→GCA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,775 C→G 20.0% A432P (GCC→CCC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,782 T→G 20.0% E429D (GAA→GAC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,783 T→G 20.0% E429A (GAA→GCA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,785 C→A 19.5% P428P (CCG→CCT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,788 C→G 17.0% T427T (ACG→ACC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,794 G→C 17.3% A425A (GCC→GCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,812 A→G 12.3% I419I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,818 A→G 10.7% H417H (CAT→CAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,839 C→A 10.6% L410L (CTG→CTT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,842 C→T 10.8% G409G (GGG→GGA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,843 C→T 12.1% G409E (GGG→GAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,847 C→T 9.8% E408K (GAA→AAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,852 T→G 10.3% N406T (AAC→ACC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,853 T→C 10.2% N406D (AAC→GAC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,014,854 A→G 10.8% D405D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,857 C→A 12.1% M404I (ATG→ATT)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,861 C→A 10.7% R403L (CGG→CTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,014,872 T→C 6.3% K399K (AAA→AAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,007 T→A 16.0% G354G (GGA→GGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,010 C→G 15.7% A353A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,013 T→C 15.1% K352K (AAA→AAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,015 T→G 15.1% K352Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,022 C→T 13.8% E349E (GAG→GAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,027 C→G 12.1% E348Q (GAA→CAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,028 C→T 12.0% P347P (CCG→CCA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,031 G→A 11.4% I346I (ATC→ATT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,034 A→G 12.7% Y345Y (TAT→TAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,037 T→C 13.4% K344K (AAA→AAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,039 T→G 12.5% K344Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,046 A→G 10.8% N341N (AAT→AAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,049 A→G 10.2% H340H (CAT→CAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,073 C→A 16.4% G332G (GGG→GGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,076 C→T 16.4% Q331Q (CAG→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,078 G→C 15.9% Q331E (CAG→GAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,079 A→G 15.5% R330R (CGT→CGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,088 C→T 22.2% K327K (AAG→AAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,097 G→A 21.9% I324I (ATC→ATT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,100 A→G 23.2% N323N (AAT→AAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,112 A→G 28.3% S319S (TCT→TCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,130 A→G 30.6% G313G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,163 G→A 29.7% R302R (CGC→CGT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,166 A→G 29.1% I301I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,169 C→A 26.9% V300V (GTG→GTT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,175 G→A 27.7% I298I (ATC→ATT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,184 A→C 27.9% A295A (GCT→GCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,199 A→G 26.4% G290G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,211 A→G 29.8% G286G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,214 C→A 30.3% L285L (CTG→CTT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,220 A→G 23.6% L283L (CTT→CTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,223 A→T 17.0% N282K (AAT→AAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,226 T→C 17.3% Q281Q (CAA→CAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,229 C→G 10.9% A280A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,232 T→C 9.5% E279E (GAA→GAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,235 G→T 8.7% I278I (ATC→ATA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,236 A→T 8.8% I278N (ATC→AAC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,237 T→C 8.9% I278V (ATC→GTC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,243 A→G 10.9% L276L (TTG→CTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,247 T→C 12.6% K274K (AAA→AAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,249 T→G 12.7% K274Q (AAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,256 T→C 12.3% E271E (GAA→GAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,258 C→G 12.8% E271Q (GAA→CAA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,259 C→G 13.9% V270V (GTG→GTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,280 G→A 11.9% H263H (CAC→CAT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,283 C→T 11.6% E262E (GAG→GAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,298 T→C 11.5% P257P (CCA→CCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,451 C→G 16.6% G206G (GGG→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,454 C→G 16.7% P205P (CCG→CCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,457 C→A 14.7% T204T (ACG→ACT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,463 T→C 13.6% L202L (TTA→TTG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,465 A→G 13.2% L202L (TTA→CTA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,466 C→G 13.2% A201A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,481 A→G 15.6% Y196Y (TAT→TAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,493 C→T 12.1% K192K (AAG→AAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,499 T→G 10.0% A190A (GCA→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,502 C→A 11.0% S189S (TCG→TCT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,505 A→G 9.1% G188G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,508 A→G 8.8% G187G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,511 A→G 8.7% G186G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,592 A→G 14.3% N159N (AAT→AAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,595 C→G 14.3% V158V (GTG→GTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,598 T→C 13.9% E157E (GAA→GAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,604 A→G 16.6% Y155Y (TAT→TAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,610 A→G 18.2% D153D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,618 G→C 20.9% P151A (CCG→GCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,622 G→A 21.4% N149N (AAC→AAT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,625 T→C 23.2% Q148Q (CAA→CAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,628 C→T 23.2% S147S (TCG→TCA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,631 G→A 24.4% Y146Y (TAC→TAT)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,640 A→G 34.3% N143N (AAT→AAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,655 A→G 39.1% T138T (ACT→ACC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,667 A→G 36.0% G134G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,670 G→T 22.7% R133R (CGC→CGA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,671 C→T 22.7% R133H (CGC→CAC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,672 G→T 22.4% R133S (CGC→AGC) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,675 C→A 21.7% A132S (GCG→TCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,681 C→T 23.8% A130T (GCG→ACG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,682 C→T 23.8% A129A (GCG→GCA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,683 G→T 23.7% A129E (GCG→GAG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,694 A→G 18.4% G125G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,697 A→G 21.4% G124G (GGT→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,706 T→C 14.3% V121V (GTA→GTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,709 A→G 12.8% R120R (CGT→CGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,715 C→G 11.3% G118G (GGG→GGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,727 A→G 11.7% V114V (GTT→GTC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,730 A→G 12.7% I113I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,733 A→G 10.9% I112I (ATT→ATC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,754 A→G 12.9% C105C (TGT→TGC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,760 T→C 14.6% P103P (CCA→CCG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,766 A→C 16.4% V101V (GTT→GTG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,775 C→G 18.4% A98A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,778 C→G 18.3% A97A (GCG→GCC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,784 G→T 19.6% D95E (GAC→GAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,793 A→T 18.2% R92R (CGT→CGA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,795 G→T 17.8% R92S (CGT→AGT) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,796 C→T 17.8% L91L (CTG→CTA) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,798 G→A 17.4% L91L (CTG→TTG) ‡ fumA ← aerobic Class I fumarate hydratase
RA 1,015,814 A→G 21.0% Y85Y (TAT→TAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,817 T→C 20.3% K84K (AAA→AAG)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,820 A→G 19.7% D83D (GAT→GAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,823 A→G 16.9% N82N (AAT→AAC)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,835 C→T 14.3% E78E (GAG→GAA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,838 C→T 12.3% P77P (CCG→CCA)  fumA ← aerobic Class I fumarate hydratase
RA 1,015,841 G→A 10.6% D76D (GAC→GAT)  fumA ← aerobic Class I fumarate hydratase
RA 1,017,194 G→A 12.0% A310T (GCA→ACA)  manA → mannose‑6‑phosphate isomerase
RA 1,019,201 G→A 42.8% intergenic (+150/+76) ydgA → / ← uidC conserved hypothetical protein/predicted outer membrane porin protein
RA 1,019,219:1 +C 17.2% intergenic (+168/+58) ydgA → / ← uidC conserved hypothetical protein/predicted outer membrane porin protein
RA 1,026,302 C→A 10.8% G190G (GGG→GGT)  malI ← DNA‑binding transcriptional repressor
RA 1,032,910 T→C 25.4% intergenic (+55/‑31) ydgT → / → ydgK predicted regulator/conserved inner membrane protein
RA 1,036,505 G→A 100% A632A (GCG→GCA)  rsxC → fused predicted 4Fe‑4S ferredoxin‑type protein
RA 1,041,581 G→A 18.7% A374A (GCG→GCA)  ydgR → predicted transporter
RA 1,045,790 C→T 20.0% L99L (TTG→TTA)  ydhA ← predicted lipoprotein
RA 1,050,725 T→C 25.4% V305A (GTC→GCC)  ydhK → conserved inner membrane protein
RA 1,071,158 A→G 28.8% Y4C (TAT→TGT)  mdtK → multidrug efflux system transporter
RA 1,080,002 G→A 14.1% P507L (CCA→CTA)  ydhV ← predicted oxidoreductase
RA 1,094,503 C→T 11.1% G625D (GGC→GAC)  ydiJ ← predicted FAD‑linked oxidoreductase
RA 1,102,502 T→C 7.1% F42F (TTT→TTC)  aroD → 3‑dehydroquinate dehydratase
RA 1,143,545 A→T 5.5% D663V (GAT→GTT)  katE → hydroperoxidase HPII(III)
RA 1,179,532 T→C 43.5% *328Q (TAA→CAA)  ansA → cytoplasmic L‑asparaginase I
RA 1,191,074 A→C 55.8% intergenic (+415/+485) yeaJ → / ← rnd predicted diguanylate cyclase/ribonuclease D
RA 1,191,560 T→C 68.4% *116W (TGA→TGG)  rnd ← ribonuclease D
RA 1,201,033 C→T 10.1% T62T (ACC→ACT)  sdaA → L‑serine deaminase I
RA 1,201,054 T→C 12.6% G69G (GGT→GGC)  sdaA → L‑serine deaminase I
RA 1,201,057 T→G 14.1% L70L (CTT→CTG)  sdaA → L‑serine deaminase I
RA 1,201,060 A→G 11.7% A71A (GCA→GCG)  sdaA → L‑serine deaminase I
RA 1,201,067 G→C 11.0% E74Q (GAA→CAA) ‡ sdaA → L‑serine deaminase I
RA 1,201,068 A→T 10.8% E74V (GAA→GTA) ‡ sdaA → L‑serine deaminase I
RA 1,201,069 A→G 10.8% E74E (GAA→GAG) ‡ sdaA → L‑serine deaminase I
RA 1,201,072 T→G 10.9% P75P (CCT→CCG)  sdaA → L‑serine deaminase I
RA 1,201,074 C→A 11.2% A76D (GCC→GAC) ‡ sdaA → L‑serine deaminase I
RA 1,201,075 C→T 11.2% A76A (GCC→GCT) ‡ sdaA → L‑serine deaminase I
RA 1,201,586 C→T 8.2% L247L (CTG→TTG)  sdaA → L‑serine deaminase I
RA 1,202,128 G→C 14.0% T427T (ACG→ACC)  sdaA → L‑serine deaminase I
RA 1,202,140 C→A 20.9% T431T (ACC→ACA)  sdaA → L‑serine deaminase I
RA 1,202,146 G→A 18.7% K433K (AAG→AAA)  sdaA → L‑serine deaminase I
RA 1,202,149 C→T 18.6% D434D (GAC→GAT)  sdaA → L‑serine deaminase I
RA 1,202,161 A→G 17.5% K438K (AAA→AAG)  sdaA → L‑serine deaminase I
RA 1,202,176 A→T 8.7% S443S (TCA→TCT)  sdaA → L‑serine deaminase I
RA 1,211,202 A→T 8.7% V50V (GTT→GTA)  cspC ← stress protein, member of the CspA‑family
RA 1,211,206 T→C 8.1% N49S (AAC→AGC) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,207 T→G 8.0% N49H (AAC→CAC) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,220 C→A 11.8% L44L (CTG→CTT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,229 G→A 12.9% F41F (TTC→TTT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,232 G→A 17.6% G40G (GGC→GGT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,239 C→G 21.5% G38A (GGT→GCT) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,240 C→T 23.8% G38S (GGT→AGT) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,247 A→T 20.2% A35A (GCT→GCA)  cspC ← stress protein, member of the CspA‑family
RA 1,211,250 G→A 24.2% S34S (TCC→TCT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,268 A→G 26.7% D28D (GAT→GAC)  cspC ← stress protein, member of the CspA‑family
RA 1,211,280 A→G 26.5% D24D (GAT→GAC)  cspC ← stress protein, member of the CspA‑family
RA 1,211,283 A→T 24.6% A23A (GCT→GCA) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,284 G→T 27.0% A23D (GCT→GAT) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,298 G→A 27.1% G18G (GGC→GGT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,301 A→G 26.3% F17F (TTT→TTC)  cspC ← stress protein, member of the CspA‑family
RA 1,211,304 A→T 25.6% G16G (GGT→GGA)  cspC ← stress protein, member of the CspA‑family
RA 1,211,310 A→G 20.5% S14S (TCT→TCC)  cspC ← stress protein, member of the CspA‑family
RA 1,211,316 G→A 20.0% N12N (AAC→AAT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,319 G→A 18.2% F11F (TTC→TTT)  cspC ← stress protein, member of the CspA‑family
RA 1,211,331 C→G 10.6% Q7H (CAG→CAC) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,211,333 G→T 10.7% Q7K (CAG→AAG) ‡ cspC ← stress protein, member of the CspA‑family
RA 1,222,231 G→C 14.0% G269A (GGT→GCT)  yebT → conserved hypothetical protein
RA 1,250,792 A→C 54.1% L167L (CTT→CTG)  ruvC ← component of RuvABC resolvasome, endonuclease
RA 1,255,649 G→A 17.6% A113A (GCG→GCA)  yecE → conserved hypothetical protein
RA 1,258,382 A→T 19.4% intergenic (+53/+112) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,389 T→G 20.0% intergenic (+60/+105) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,404 C→T 11.3% intergenic (+75/+90) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,406 G→T 14.4% intergenic (+77/+88) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,410 Δ1 bp 11.3% intergenic (+81/+84) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,411 T→A 12.6% intergenic (+82/+83) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,414 G→T 12.1% intergenic (+85/+80) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,415 T→C 11.9% intergenic (+86/+79) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,258,429 A→G 9.5% intergenic (+100/+65) yecP → / ← torZ predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,304 G→A 6.4% N540N (AAC→AAT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,317 A→T 6.4% F536Y (TTT→TAT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,319 T→G 6.7% Q535H (CAA→CAC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,320 T→C 6.6% Q535R (CAA→CGA) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,322 C→T 6.7% P534P (CCG→CCA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,325 A→C 7.1% A533A (GCT→GCG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,327 C→G 6.9% A533P (GCT→CCT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,328 A→C 7.3% V532V (GTT→GTG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,331 A→C 6.9% A531A (GCT→GCG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,332 G→A 6.9% A531V (GCT→GTT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,334 C→T 6.9% Q530Q (CAG→CAA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,349 A→C 18.9% I525M (ATT→ATG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,351 T→G 17.7% I525L (ATT→CTT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,358 G→A 17.8% N522N (AAC→AAT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,361 G→A 16.5% S521S (AGC→AGT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,379 C→G 13.3% T515T (ACG→ACC)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,382 C→G 12.7% L514F (TTG→TTC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,384 A→G 12.7% L514L (TTG→CTG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,385 G→A 12.6% D513D (GAC→GAT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,391 G→A 12.0% R511R (CGC→CGT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,400 C→A 10.4% S508S (TCG→TCT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,799 T→C 12.5% L375L (TTA→TTG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,805 C→T 16.4% A373A (GCG→GCA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,808 C→T 16.4% A372A (GCG→GCA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,817 C→G 19.2% V369V (GTG→GTC)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,820 C→G 20.0% L368L (CTG→CTC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,822 G→T 19.7% L368M (CTG→ATG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,838 T→C 22.2% E362E (GAA→GAG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,845 T→A 20.8% Y360F (TAT→TTT)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,847 T→C 21.4% Q359Q (CAA→CAG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,850 C→T 21.4% Q358Q (CAG→CAA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,259,859 A→C 20.3% I355M (ATT→ATG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,297 A→G 8.2% V209V (GTT→GTC)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,300 C→A 7.6% Q208H (CAG→CAT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,302 G→C 7.9% Q208E (CAG→GAG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,306 G→A 7.8% N206N (AAC→AAT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,308 T→G 8.6% N206H (AAC→CAC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,315 A→C 8.6% I203M (ATT→ATG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,317 T→C 8.9% I203V (ATT→GTT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,327 G→A 7.5% S199S (TCC→TCT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,329 A→T 7.5% S199T (TCC→ACC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,333 C→T 12.0% Q197Q (CAG→CAA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,341 C→G 5.7% E195Q (GAA→CAA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,348 C→T 14.3% E192E (GAG→GAA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,351 T→C 14.0% V191V (GTA→GTG) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,353 C→T 14.0% V191I (GTA→ATA) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,354 A→C 13.8% S190S (TCT→TCG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,363 C→T 14.3% V187V (GTG→GTA)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,366 A→G 14.0% H186H (CAT→CAC) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,367 T→C 13.6% H186R (CAT→CGT) ‡ torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,260,374 T→G 13.0% M184L (ATG→CTG)  torZ ← trimethylamine N‑oxide reductase system III, catalytic subunit
RA 1,268,310 T→A 14.9% I99F (ATC→TTC)  pgsA ← phosphatidylglycerophosphate synthetase
RA 1,274,778 G→A 56.4% S30N (AGC→AAC)  yodA → conserved metal‑binding protein
RA 1,299,396 A→G 6.3% intergenic (‑321/+169) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,400 A→G 6.9% intergenic (‑325/+165) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,404 G→T 10.5% intergenic (‑329/+161) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,417 A→G 13.8% intergenic (‑342/+148) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,418 C→T 13.8% intergenic (‑343/+147) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,421 G→A 13.8% intergenic (‑346/+144) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,423 A→C 14.6% intergenic (‑348/+142) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,439 A→G 13.9% intergenic (‑364/+126) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,448 A→G 10.5% intergenic (‑373/+117) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,299,487 G→A 30.8% intergenic (‑412/+78) cobU ← / ← yeeX bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA 1,300,414 A→G 30.6% I237I (ATT→ATC)  yeeA ← conserved inner membrane protein
RA 1,304,455 T→C 13.4% R389R (CGT→CGC)  sbcB → exonuclease I
RA 1,309,899 G→A 53.3% R31R (CGC→CGT)  yefM ← antitoxin of the YoeB‑YefM toxin‑antitoxin system
RA 1,314,255 T→C 56.6% H170H (CAT→CAC)  hisB → fused histidinol‑phosphatase and imidazoleglycerol‑phosphate dehydratase
RA 1,321,783 G→A 52.3% intergenic (‑237/+257) gnd ← / ← galF gluconate‑6‑phosphate dehydrogenase, decarboxylating/predicted subunit with GalU
RA 1,327,153 C→T 12.1% intergenic (‑143/+133) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,327,159 G→A 14.2% intergenic (‑149/+127) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,327,162 T→A 19.8% intergenic (‑152/+124) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,327,163 T→C 20.0% intergenic (‑153/+123) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,327,164 C→A 12.8% intergenic (‑154/+122) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,327,166 G→C 13.1% intergenic (‑156/+120) wcaK ← / ← wzxC predicted pyruvyl transferase/colanic acid exporter
RA 1,337,480 A→G 43.3% S5S (AGT→AGC)  wcaF ← predicted acyl transferase
RA 1,341,041 C→T 9.2% A41T (GCG→ACG)  wcaB ← predicted acyl transferase
RA 1,347,119 T→C 7.7% G204G (GGT→GGC)  yegH → fused predicted membrane proteins
RA 1,350,843 T→C 18.6% intergenic (‑22/+70) dcd ← / ← udk 2'‑deoxycytidine 5'‑triphosphate deaminase/uridine/cytidine kinase
RA 1,370,859 T→C 6.7% intergenic (+116/‑14) yohK → / → cdd predicted inner membrane protein/cytidine/deoxycytidine deaminase
RA 1,374,127 T→C 18.0% L356L (TTA→CTA)  yeiT → predicted oxidoreductase
RA 1,390,615 A→G 57.0% Q249Q (CAA→CAG)  nfo → endonuclease IV with intrinsic 3'‑5' exonuclease activity
RA 1,395,087 T→C 10.4% intergenic (‑160/‑208) fruB ← / → setB fused fructose‑specific PTS enzyme IIA component and HPr component/lactose/glucose efflux system
RA 1,395,393 G→T 11.2% L33L (CTG→CTT)  setB → lactose/glucose efflux system
RA 1,395,396 A→G 11.6% Q34Q (CAA→CAG)  setB → lactose/glucose efflux system
RA 1,395,399 C→T 11.7% T35T (ACC→ACT)  setB → lactose/glucose efflux system
RA 1,395,402 G→T 11.5% P36P (CCG→CCT)  setB → lactose/glucose efflux system
RA 1,395,405 A→C 13.1% T37T (ACA→ACC)  setB → lactose/glucose efflux system
RA 1,395,408 C→A 12.6% L38L (CTC→CTA)  setB → lactose/glucose efflux system
RA 1,395,660 T→A 10.3% A122A (GCT→GCA)  setB → lactose/glucose efflux system
RA 1,395,675 T→C 7.8% F127F (TTT→TTC)  setB → lactose/glucose efflux system
RA 1,395,681 T→C 7.7% L129L (CTT→CTC)  setB → lactose/glucose efflux system
RA 1,396,026 C→T 8.4% I244I (ATC→ATT)  setB → lactose/glucose efflux system
RA 1,396,027 A→G 8.5% N245D (AAC→GAC) ‡ setB → lactose/glucose efflux system
RA 1,396,029 C→T 8.6% N245N (AAC→AAT) ‡ setB → lactose/glucose efflux system
RA 1,396,041 T→A 9.8% L249L (CTT→CTA)  setB → lactose/glucose efflux system
RA 1,396,042 C→A 10.5% P250T (CCC→ACC)  setB → lactose/glucose efflux system
RA 1,396,047 G→T 11.5% E251D (GAG→GAT)  setB → lactose/glucose efflux system
RA 1,396,054 G→A 11.7% A254T (GCC→ACC) ‡ setB → lactose/glucose efflux system
RA 1,396,056 C→T 12.0% A254A (GCC→GCT) ‡ setB → lactose/glucose efflux system
RA 1,396,059 T→A 13.3% G255G (GGT→GGA)  setB → lactose/glucose efflux system
RA 1,396,061 T→A 15.0% V256E (GTG→GAG) ‡ setB → lactose/glucose efflux system
RA 1,396,062 G→A 16.3% V256V (GTG→GTA) ‡ setB → lactose/glucose efflux system
RA 1,396,068 G→T 20.6% M258I (ATG→ATT)  setB → lactose/glucose efflux system
RA 1,396,071 G→T 18.7% G259G (GGG→GGT)  setB → lactose/glucose efflux system
RA 1,408,246 T→C 8.9% L172S (TTA→TCA)  yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,248 A→T 8.5% T173S (ACG→TCG) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,249 C→G 9.2% T173R (ACG→AGG) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,250 G→C 9.2% T173T (ACG→ACC) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,253 A→C 8.9% R174R (CGA→CGC)  yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,258 A→C 9.1% E176A (GAA→GCA) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,259 A→G 9.8% E176E (GAA→GAG) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,260 T→G 9.6% L177V (TTA→GTA) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,262 A→G 9.6% L177L (TTA→TTG) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,263 T→C 9.6% L178L (TTA→CTA) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,265 A→G 10.2% L178L (TTA→TTG) ‡ yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,277 A→G 10.2% E182E (GAA→GAG)  yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,408,280 G→A 10.6% P183P (CCG→CCA)  yejF → fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA 1,417,571 A→T 10.0% intergenic (+3/‑72) yejM → / → proL predicted hydrolase, inner membrane/tRNA‑Pro
RA 1,417,574 T→A 10.4% intergenic (+6/‑69) yejM → / → proL predicted hydrolase, inner membrane/tRNA‑Pro
RA 1,417,577 A→T 8.6% intergenic (+9/‑66) yejM → / → proL predicted hydrolase, inner membrane/tRNA‑Pro
RA 1,439,294 G→A 14.0% D336D (GAC→GAT)  ompC ← outer membrane porin protein C
RA 1,439,300 G→A 13.1% Y334Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,439,333 A→C 11.9% A323A (GCT→GCG)  ompC ← outer membrane porin protein C
RA 1,439,341 C→T 6.0% V321I (GTT→ATT)  ompC ← outer membrane porin protein C
RA 1,439,414 C→G 9.1% L296L (CTG→CTC) ‡ ompC ← outer membrane porin protein C
RA 1,439,416 G→T 10.4% L296M (CTG→ATG) ‡ ompC ← outer membrane porin protein C
RA 1,439,423 A→G 10.1% R293R (CGT→CGC)  ompC ← outer membrane porin protein C
RA 1,439,429 A→G 8.8% G291G (GGT→GGC)  ompC ← outer membrane porin protein C
RA 1,439,432 G→A 8.6% F290F (TTC→TTT)  ompC ← outer membrane porin protein C
RA 1,439,444 G→A 15.1% Y286Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,439,457 G→A 14.5% A282V (GCT→GTT)  ompC ← outer membrane porin protein C
RA 1,439,462 G→A 12.4% F280F (TTC→TTT)  ompC ← outer membrane porin protein C
RA 1,439,468 C→T 11.3% Q278Q (CAG→CAA)  ompC ← outer membrane porin protein C
RA 1,439,471 T→G 9.8% A277A (GCA→GCC) ‡ ompC ← outer membrane porin protein C
RA 1,439,473 C→T 7.6% A277T (GCA→ACA) ‡ ompC ← outer membrane porin protein C
RA 1,439,789 C→T 7.7% Q171Q (CAG→CAA)  ompC ← outer membrane porin protein C
RA 1,439,792 G→A 12.6% Y170Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,439,798 A→C 16.7% V168V (GTT→GTG)  ompC ← outer membrane porin protein C
RA 1,439,801 A→C 11.0% A167A (GCT→GCG)  ompC ← outer membrane porin protein C
RA 1,439,804 A→G 11.3% F166F (TTT→TTC)  ompC ← outer membrane porin protein C
RA 1,439,813 G→A 12.9% G163G (GGC→GGT)  ompC ← outer membrane porin protein C
RA 1,439,816 G→A 18.6% D162D (GAC→GAT) ‡ ompC ← outer membrane porin protein C
RA 1,439,818 C→T 12.6% D162N (GAC→AAC) ‡ ompC ← outer membrane porin protein C
RA 1,439,819 A→T 12.6% V161V (GTT→GTA)  ompC ← outer membrane porin protein C
RA 1,439,834 G→A 13.5% D156D (GAC→GAT) ‡ ompC ← outer membrane porin protein C
RA 1,439,835 T→C 8.0% D156G (GAC→GGC) ‡ ompC ← outer membrane porin protein C
RA 1,439,840 G→A 13.5% N154N (AAC→AAT)  ompC ← outer membrane porin protein C
RA 1,439,846 G→A 9.7% Y152Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,439,849 G→A 10.3% T151T (ACC→ACT)  ompC ← outer membrane porin protein C
RA 1,439,857 A→C 9.5% F149V (TTC→GTC)  ompC ← outer membrane porin protein C
RA 1,439,921 T→C 7.0% V127V (GTA→GTG) ‡ ompC ← outer membrane porin protein C
RA 1,439,923 C→T 7.0% V127I (GTA→ATA) ‡ ompC ← outer membrane porin protein C
RA 1,439,924 G→A 6.9% D126D (GAC→GAT)  ompC ← outer membrane porin protein C
RA 1,439,933 G→T 7.8% S123S (TCC→TCA) ‡ ompC ← outer membrane porin protein C
RA 1,439,935 A→C 7.5% S123A (TCC→GCC) ‡ ompC ← outer membrane porin protein C
RA 1,439,936 A→T 7.5% T122T (ACT→ACA) ‡ ompC ← outer membrane porin protein C
RA 1,439,937 G→T 7.4% T122N (ACT→AAT) ‡ ompC ← outer membrane porin protein C
RA 1,439,938 T→C 7.6% T122A (ACT→GCT) ‡ ompC ← outer membrane porin protein C
RA 1,439,948 A→T 7.9% V118V (GTT→GTA)  ompC ← outer membrane porin protein C
RA 1,439,951 A→G 7.7% V117V (GTT→GTC)  ompC ← outer membrane porin protein C
RA 1,439,954 G→A 6.8% G116G (GGC→GGT)  ompC ← outer membrane porin protein C
RA 1,439,969 G→A 7.4% Y111Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,440,224 G→A 8.8% N26N (AAC→AAT)  ompC ← outer membrane porin protein C
RA 1,440,227 G→A 9.0% Y25Y (TAC→TAT)  ompC ← outer membrane porin protein C
RA 1,440,236 A→G 7.9% A22A (GCT→GCC)  ompC ← outer membrane porin protein C
RA 1,440,239 A→T 7.9% A21A (GCT→GCA)  ompC ← outer membrane porin protein C
RA 1,440,242 G→A 7.7% N20N (AAC→AAT) ‡ ompC ← outer membrane porin protein C
RA 1,440,244 T→G 8.2% N20H (AAC→CAC) ‡ ompC ← outer membrane porin protein C
RA 1,467,882 Δ1 bp 20.8% intergenic (+41/+87) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,905:1 +T 25.9% intergenic (+64/+64) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,905:2 +C 25.9% intergenic (+64/+64) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,905:3 +C 25.9% intergenic (+64/+64) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,905:4 +C 25.9% intergenic (+64/+64) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,908 T→A 24.9% intergenic (+67/+61) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,467,910:2 +T 25.9% intergenic (+69/+59) ubiG → / ← yfaL bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA 1,474,821 T→G 17.2% intergenic (+119/‑115) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,474,827 G→T 16.6% intergenic (+125/‑109) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,474,830 T→A 16.2% intergenic (+128/‑106) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,474,835 C→T 16.2% intergenic (+133/‑101) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,474,863 C→G 13.4% intergenic (+161/‑73) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,474,864 C→T 15.5% intergenic (+162/‑72) nrdA → / → nrdB ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA 1,481,282 G→A 18.6% A362T (GCT→ACT)  glpA → sn‑glycerol‑3‑phosphate dehydrogenase (anaerobic), large subunit, FAD/NAD(P)‑binding
RA 1,484,894 T→C 54.1% M316V (ATG→GTG)  menF ← isochorismate synthase 2
RA 1,486,279 T→C 35.1% T345A (ACA→GCA)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 1,491,595 C→T 16.3% P96P (CCG→CCA)  nuoJ ← NADH:ubiquinone oxidoreductase, membrane subunit J
RA 1,502,353 G→A 39.2% S92L (TCA→TTA)  lrhA ← DNA‑binding transcriptional repressor
RA 1,502,847 A→T 52.3% intergenic (‑220/‑700) lrhA ← / → yfbQ DNA‑binding transcriptional repressor/predicted aminotransferase
RA 1,513,018 T→C 21.4% intergenic (+141/+291) pta → / ← ubiX phosphate acetyltransferase/3‑octaprenyl‑4‑hydroxybenzoate carboxy‑lyase
RA 1,557,415 A→G 56.7% *128Q (TAG→CAG)  emrY ← predicted multidrug efflux system
RA 1,563,207 C→T 6.6% Q1072* (CAG→TAG)  evgS → hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA 1,564,887 C→T 21.2% intergenic (‑99/+193) yfdE ← / ← glk predicted CoA‑transferase, NAD(P)‑binding/glucokinase
RA 1,564,912 G→A 36.2% intergenic (‑124/+168) yfdE ← / ← glk predicted CoA‑transferase, NAD(P)‑binding/glucokinase
RA 1,574,052 T→G 14.5% noncoding (64/76 nt) valU → tRNA‑Val
RA 1,581,079 C→T 27.4% G47S (GGT→AGT)  ypeB ← hypothetical protein
RA 1,591,605 G→A 26.4% intergenic (+64/+125) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,621 G→A 37.1% intergenic (+80/+109) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,630 A→T 7.4% intergenic (+89/+100) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,633 G→A 21.5% intergenic (+92/+97) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,634 T→C 21.4% intergenic (+93/+96) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,635 G→C 7.5% intergenic (+94/+95) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,637 T→A 17.8% intergenic (+96/+93) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,640 T→A 8.2% intergenic (+99/+90) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,658 C→T 9.8% intergenic (+117/+72) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,591,660 T→A 10.0% intergenic (+119/+70) yfeS → / ← cysM conserved hypothetical protein/cysteine synthase B
RA 1,614,452 C→T 19.2% intergenic (‑77/+140) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,453 G→C 19.2% intergenic (‑78/+139) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,454 T→C 18.2% intergenic (‑79/+138) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,455 A→T 18.2% intergenic (‑80/+137) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,459 T→C 31.5% intergenic (‑84/+133) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,466 G→A 35.2% intergenic (‑91/+126) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,472 G→A 14.1% intergenic (‑97/+120) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,480 C→T 21.4% intergenic (‑105/+112) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,491 A→T 16.3% intergenic (‑116/+101) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,492 T→C 32.6% intergenic (‑117/+100) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,614,522 A→G 14.3% intergenic (‑147/+70) eutH ← / ← eutG predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA 1,622,247 A→C 9.3% intergenic (‑174/+119) ypfE ← / ← maeB predicted carboxysome structural protein with predicted role in ethanol utilization/fused malic enzyme predicted oxidoreductase and predicted phosphotransacetylase
RA 1,631,410 T→C 22.2% E128E (GAA→GAG)  aegA ← fused predicted FeS binding subunit and predicted NAD/FAD‑binding subunit of oxidoreductase
RA 1,646,153 C→T 14.9% intergenic (‑125/‑21) dapA ← / → gcvR dihydrodipicolinate synthase/DNA‑binding transcriptional repressor, regulatory protein accessory to GcvA
RA 1,666,180 T→A 9.1% I193F (ATC→TTC)  guaB ← IMP dehydrogenase
RA 1,666,716 A→G 12.8% V14A (GTT→GCT)  guaB ← IMP dehydrogenase
RA 1,712,236 C→T 24.0% A1066T (GCT→ACT)  yphG ← conserved hypothetical protein
RA 1,714,607 C→A 21.9% L275L (CTG→CTT)  yphG ← conserved hypothetical protein
RA 1,716,814 T→G 10.4% intergenic (+72/+126) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,816 C→T 10.5% intergenic (+74/+124) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,832 A→C 14.5% intergenic (+90/+108) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,833 C→A 30.1% intergenic (+91/+107) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,835 G→T 19.8% intergenic (+93/+105) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,836 A→G 15.0% intergenic (+94/+104) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,837 G→C 13.0% intergenic (+95/+103) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,846 A→C 17.0% intergenic (+104/+94) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,859 A→G 16.7% intergenic (+117/+81) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,860 A→C 25.8% intergenic (+118/+80) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,861 A→T 39.4% intergenic (+119/+79) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,716,872 C→A 17.6% intergenic (+130/+68) yphH → / ← glyA predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA 1,720,956 G→A 17.8% H178H (CAC→CAT)  yfhA ← predicted DNA‑binding response regulator in two‑component system
RA 1,729,738 C→T 17.5% L372F (CTT→TTT)  yfhD → predicted transglycosylase
RA 1,741,082 T→C 12.9% K120R (AAA→AGA)  rseB ← anti‑sigma factor
RA 1,746,998 G→A 12.5% intergenic (+82/+127) srmB → / ← yfiE ATP‑dependent RNA helicase/predicted DNA‑binding transcriptional regulator
RA 1,747,003 T→C 12.8% intergenic (+87/+122) srmB → / ← yfiE ATP‑dependent RNA helicase/predicted DNA‑binding transcriptional regulator
RA 1,753,067 G→A 27.9% V143V (GTG→GTA)  yfiQ → fused predicted acyl‑CoA synthetase NAD(P)‑binding subunit and ATP‑binding subunit
RA 1,763,556 T→C 20.9% noncoding (288/1542 nt) rrsG ← 16S ribosomal RNA
RA 1,763,636 A→G 30.0% noncoding (208/1542 nt) rrsG ← 16S ribosomal RNA
RA 1,789,035 T→C 28.9% S58P (TCC→CCC)  ygaF → hypothetical protein
RA 1,789,192 T→C 34.2% V110A (GTG→GCG)  ygaF → hypothetical protein
RA 1,804,090 G→A 73.5% G52G (GGG→GGA)  mprA → DNA‑binding transcriptional regulator
RA 1,823,325:1 +G 23.7% intergenic (+62/+66) norW → / ← hypF NADH:flavorubredoxin oxidoreductase/carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA 1,823,331 G→T 19.3% intergenic (+68/+60) norW → / ← hypF NADH:flavorubredoxin oxidoreductase/carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA 1,826,240 T→C 14.7% E28E (GAA→GAG)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,243 C→A 13.8% Q27H (CAG→CAT)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,249 A→C 16.7% S25S (TCT→TCG)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,252 A→C 17.8% V24V (GTT→GTG)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,255 C→T 17.4% A23A (GCG→GCA) ‡ hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,256 G→A 35.7% A23V (GCG→GTG) ‡ hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,261 C→A 20.6% A21A (GCG→GCT)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,264 T→C 20.5% V20V (GTA→GTG)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,285 A→G 17.0% I13I (ATT→ATC)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,294 A→C 16.6% S10R (AGT→AGG) ‡ hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,295 C→G 16.5% S10T (AGT→ACT) ‡ hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,300 G→A 16.5% D8D (GAC→GAT)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,303 A→C 14.5% A7A (GCT→GCG)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,826,309 G→A 9.6% I5I (ATC→ATT)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 1,834,068 G→A 22.2% L56L (CTG→CTA)  ygbM → conserved hypothetical protein
RA 1,837,444 G→A 8.2% A325A (GCC→GCT)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,447 A→C 8.0% S324R (AGT→AGG) ‡ nlpD ← predicted outer membrane lipoprotein
RA 1,837,448 C→G 7.8% S324T (AGT→ACT) ‡ nlpD ← predicted outer membrane lipoprotein
RA 1,837,450 C→A 7.9% L323L (CTG→CTT) ‡ nlpD ← predicted outer membrane lipoprotein
RA 1,837,452 G→T 9.0% L323M (CTG→ATG) ‡ nlpD ← predicted outer membrane lipoprotein
RA 1,837,459 A→T 8.1% D320E (GAT→GAA)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,463 T→C 7.8% N319S (AAT→AGT)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,465 A→G 7.4% H318H (CAT→CAC)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,471 G→A 6.6% I316I (ATC→ATT)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,474 G→C 6.5% I315M (ATC→ATG)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,477 A→G 6.3% I314I (ATT→ATC)  nlpD ← predicted outer membrane lipoprotein
RA 1,837,480 C→G 6.0% L313L (CTG→CTC)  nlpD ← predicted outer membrane lipoprotein
RA 1,864,319 C→T 9.3% intergenic (+66/+82) ygcP → / ← ygcQ predicted anti‑terminator regulatory protein/predicted flavoprotein
RA 1,864,336 G→A 16.7% intergenic (+83/+65) ygcP → / ← ygcQ predicted anti‑terminator regulatory protein/predicted flavoprotein
RA 1,864,337 A→C 14.1% intergenic (+84/+64) ygcP → / ← ygcQ predicted anti‑terminator regulatory protein/predicted flavoprotein
RA 1,873,630 C→A 38.0% intergenic (+774/+599) ygcE → / ← ygcF predicted kinase/conserved hypothetical protein
RA 1,889,569 A→G 9.1% R220R (CGT→CGC)  gudX ← predicted glucarate dehydratase
RA 1,892,019:1 +GC 100% intergenic (‑437/+54) gudP ← / ← ygdL predicted D‑glucarate transporter/conserved hypothetical protein
RA 1,900,258 G→A 29.6% A928V (GCT→GTT)  recB ← exonuclease V (RecBCD complex), beta subunit
RA 1,914,596 T→G 11.7% K292N (AAA→AAC)  ptsP ← fused PEP‑protein phosphotransferase (enzyme I) of PTS system
RA 1,921,110 T→C 35.9% S648G (AGC→GGC)  aas ← fused 2‑acylglycerophospho‑ethanolamine acyl transferase and acyl‑acyl carrier protein synthetase
RA 1,932,763 G→A 65.4% intergenic (‑134/+162) yqeF ← / ← lysS predicted acyltransferase/lysine tRNA synthetase, constitutive
RA 1,932,853 C→T 27.6% intergenic (‑224/+72) yqeF ← / ← lysS predicted acyltransferase/lysine tRNA synthetase, constitutive
RA 1,932,952 C→G 10.0% L497L (CTG→CTC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,932,967 G→A 11.9% I492I (ATC→ATT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,932,970 G→A 11.9% T491T (ACC→ACT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,932,982 G→A 12.7% T487T (ACC→ACT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,932,985 G→A 11.1% F486F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,932,994 T→A 16.5% V483V (GTA→GTT) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,932,996 C→T 15.8% V483I (GTA→ATA) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,000 A→T 15.6% R481R (CGT→CGA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,015 T→A 14.0% G476G (GGA→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,024 T→A 13.6% A473A (GCA→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,027 T→G 13.6% T472T (ACA→ACC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,030 C→T 11.6% P471P (CCG→CCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,036 T→C 10.3% L469L (TTA→TTG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,038 A→G 10.3% L469L (TTA→CTA) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,039 G→A 10.2% G468G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,044 G→A 12.4% H467Y (CAT→TAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,051 T→C 14.0% A464A (GCA→GCG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,054 G→A 14.4% T463T (ACC→ACT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,057 G→C 14.0% V462V (GTC→GTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,069 A→G 12.1% D458D (GAT→GAC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,072 G→A 12.2% Y457Y (TAC→TAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,081 C→G 17.9% A454A (GCG→GCC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,099 G→A 15.7% D448D (GAC→GAT) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,100 T→G 16.7% D448A (GAC→GCC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,105 C→A 13.9% A446A (GCG→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,108 G→A 15.3% A445A (GCC→GCT) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,109 G→T 13.5% A445D (GCC→GAC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,110 C→T 13.4% A445T (GCC→ACC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,117 A→T 16.3% D442E (GAT→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,121 A→T 18.1% L441Q (CTG→CAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,126 G→A 16.8% R439R (CGC→CGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,131 G→C 19.3% Q438E (CAA→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,132 C→A 19.2% A437A (GCG→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,153 C→T 12.6% L430L (CTG→CTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,165 G→A 13.0% G426G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,168 G→A 12.2% N425N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,189 A→G 12.0% I418I (ATT→ATC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,198 C→T 16.6% E415E (GAG→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,204 G→A 18.6% R413R (CGC→CGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,210 T→G 22.1% T411T (ACA→ACC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,228 G→A 28.6% D405D (GAC→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,231 G→A 28.6% N404N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,237 A→G 30.0% R402R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,240 C→T 31.6% A401A (GCG→GCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,249 A→G 33.3% S398S (TCT→TCC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,252 A→C 33.3% V397V (GTT→GTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,270 A→C 32.6% T391T (ACT→ACG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,276 G→A 34.1% F389F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,282 C→T 33.7% P387P (CCG→CCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,312 T→A 18.2% E377D (GAA→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,315 G→A 17.5% F376F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,324 G→T 14.0% T373T (ACC→ACA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,327 A→G 10.2% V372V (GTT→GTC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,330 G→A 7.7% I371I (ATC→ATT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,555 C→T 9.0% S296S (TCG→TCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,558 T→C 9.4% E295E (GAA→GAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,561 G→T 8.7% T294T (ACC→ACA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,567 C→T 11.9% E292E (GAG→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,570 G→A 13.0% I291I (ATC→ATT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,575 G→A 14.3% L290L (CTG→TTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,579 T→G 14.9% K288N (AAA→AAC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,581 T→G 14.8% K288Q (AAA→CAA) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,588 T→C 14.7% A285A (GCA→GCG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,591 G→A 14.3% Y284Y (TAC→TAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,594 A→C 14.4% A283A (GCT→GCG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,615 G→T 12.9% T276T (ACC→ACA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,624 T→A 13.3% P273P (CCA→CCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,627 G→A 14.3% N272N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,633 A→G 14.3% R270R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,636 T→A 14.5% V269V (GTA→GTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,639 G→A 14.7% S268S (TCC→TCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,651 G→A 21.4% N264N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,681 A→C 23.6% R254R (CGT→CGG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,684 C→T 20.7% E253E (GAG→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,687 G→A 16.2% F252F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,690 G→A 16.4% G251G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,693 A→G 17.4% G250G (GGT→GGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,696 A→T 17.4% V249V (GTT→GTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,699 C→A 16.6% V248V (GTG→GTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,708 C→T 12.0% K245K (AAG→AAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,711 G→C 12.7% L244L (CTC→CTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,714 G→A 12.2% Y243Y (TAC→TAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,720 T→C 11.3% E241E (GAA→GAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,738 G→A 10.8% Y235Y (TAC→TAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,744 G→A 9.2% D233D (GAC→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,756 C→A 7.5% A229A (GCG→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,759 G→A 7.4% N228N (AAC→AAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,765 G→A 10.0% H226H (CAC→CAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,771 G→A 9.8% I224I (ATC→ATT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,780 A→G 12.9% R221R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,783 C→A 11.8% A220A (GCG→GCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,788 C→A 11.8% A219S (GCT→TCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,789 G→T 12.7% A218A (GCC→GCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,792 A→C 13.0% G217G (GGT→GGG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,795 G→A 12.3% G216G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,798 A→T 12.5% P215P (CCT→CCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,801 G→A 13.2% I214I (ATC→ATT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,804 C→T 12.3% V213V (GTG→GTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,819 C→G 12.5% T208T (ACG→ACC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,825 A→T 10.5% V206V (GTT→GTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,936 C→T 14.0% Q169Q (CAG→CAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,945 G→A 17.4% R166R (CGC→CGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,948 C→G 17.4% A165A (GCG→GCC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,949 G→A 17.4% A165V (GCG→GTG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,965 A→G 23.2% L160L (TTG→CTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,966 G→A 22.8% G159G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,969 G→A 22.8% H158H (CAC→CAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,981 C→T 22.9% P154P (CCG→CCA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,984 C→T 18.8% L153L (CTG→CTA) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,986 G→A 19.1% L153L (CTG→TTG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,933,987 C→A 18.0% P152P (CCG→CCT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,933,993 C→T 14.6% L150L (CTG→CTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,002 G→A 9.9% T147T (ACC→ACT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,011 A→G 8.3% R144R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,016 A→G 6.1% L143L (TTG→CTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,023 G→A 5.0% C140C (TGC→TGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,161 G→A 10.4% R94R (CGC→CGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,164 A→G 9.7% G93G (GGT→GGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,167 G→A 9.9% G92G (GGC→GGT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,170 A→G 10.0% V91V (GTT→GTC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,173 G→A 9.5% D90D (GAC→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,181 G→A 11.7% L88L (CTG→TTG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,182 G→C 11.7% T87T (ACC→ACG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,185 A→T 11.9% V86V (GTT→GTA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,188 G→A 11.2% F85F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,191 A→G 13.4% S84S (TCT→TCC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,194 C→G 13.2% A83A (GCG→GCC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,200 A→C 15.5% G81G (GGT→GGG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,206 A→G 21.5% I79I (ATT→ATC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,224 G→T 19.9% R73R (CGC→CGA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,236 G→C 16.7% A69A (GCC→GCG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,238 C→A 19.4% A69S (GCC→TCC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,266 T→C 10.4% E59E (GAA→GAG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,268 C→G 10.4% E59Q (GAA→CAA) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,272 C→A 7.0% E57D (GAG→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,275 T→C 6.6% K56K (AAA→AAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,278 G→C 6.0% G55G (GGC→GGG) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,279 C→G 6.1% G55A (GGC→GCC) ‡ lysS ← lysine tRNA synthetase, constitutive
RA 1,934,281 G→A 6.1% D54D (GAC→GAT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,284 G→A 6.3% F53F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,287 T→C 6.6% E52E (GAA→GAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,291 G→T 8.7% A51E (GCA→GAA)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,299 T→C 8.3% Q48Q (CAA→CAG)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,314 A→G 8.5% D43D (GAT→GAC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,320 A→G 7.8% R41R (CGT→CGC)  lysS ← lysine tRNA synthetase, constitutive
RA 1,934,323 G→A 5.9% F40F (TTC→TTT)  lysS ← lysine tRNA synthetase, constitutive
RA 1,941,697 T→C 13.9% intergenic (+136/+60) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,941,698 G→A 12.3% intergenic (+137/+59) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,941,702 T→G 29.2% intergenic (+141/+55) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,941,704 C→A 25.9% intergenic (+143/+53) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,941,723 G→A 7.2% intergenic (+162/+34) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,941,724 G→A 7.9% intergenic (+163/+33) ygfZ → / ← yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA 1,960,125 G→A 12.0% intergenic (‑55/+160) fbaA ← / ← pgk fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA 1,960,131 T→A 14.7% intergenic (‑61/+154) fbaA ← / ← pgk fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA 1,960,141 C→T 13.0% intergenic (‑71/+144) fbaA ← / ← pgk fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA 1,963,700 C→T 8.0% A108T (GCC→ACC)  yggD ← predicted DNA‑binding transcriptional regulator
RA 1,985,434 A→G 8.9% intergenic (+37/+118) yggW → / ← yggM predicted oxidoreductase/conserved hypothetical protein
RA 1,985,438 G→T 8.5% intergenic (+41/+114) yggW → / ← yggM predicted oxidoreductase/conserved hypothetical protein
RA 1,990,234 A→G 50.0% L76L (TTA→TTG)  mutY → adenine DNA glycosylase
RA 2,006,920 C→G 8.5% S2T (AGT→ACT) 
E327D (GAG→GAC) 
hybB ←
hybA ←
predicted hydrogenase 2 cytochrome b type component
hydrogenase 2 4Fe‑4S ferredoxin‑type component
RA 2,008,716 T→C 5.8% K102K (AAA→AAG)  hybO ← hydrogenase 2, small subunit
RA 2,013,459 G→T 16.6% intergenic (+153/+119) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,013,460 A→G 16.9% intergenic (+154/+118) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,013,461 G→T 12.3% intergenic (+155/+117) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,013,466 Δ1 bp 18.1% intergenic (+160/+112) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,013,468 A→T 14.3% intergenic (+162/+110) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,013,480 T→G 17.1% intergenic (+174/+98) yghA → / ← exbD predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 2,026,414 G→A 28.2% intergenic (‑173/+61) plsC ← / ← parC 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A
RA 2,035,931 C→T 10.7% F21F (TTC→TTT)  ygiC → hypothetical protein
RA 2,040,713 C→T 35.5% D40D (GAC→GAT)  yqiH → predicted periplasmic pilin chaperone
RA 2,040,951 T→A 38.3% *120K (TAA→AAA)  yqiH → predicted periplasmic pilin chaperone
RA 2,041,438 G→A 46.5% D32N (GAT→AAT)  yqiI → conserved hypothetical protein
RA 2,045,818 C→T 10.4% intergenic (+580/+215) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,825 A→G 8.9% intergenic (+587/+208) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,830:1 +A 8.9% intergenic (+592/+203) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,835 C→T 7.3% intergenic (+597/+198) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,838 G→T 8.4% intergenic (+600/+195) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,839 T→A 12.0% intergenic (+601/+194) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,045,864 T→A 6.6% intergenic (+626/+169) yqiK → / ← rfaE conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA 2,050,271 A→G 11.6% L28L (CTT→CTC)  glnE ← fused deadenylyltransferase and adenylyltransferase for glutamine synthetase
RA 2,057,586 C→T 18.3% D137D (GAC→GAT)  ttdA → L‑tartrate dehydratase, alpha subunit
RA 2,065,625 C→T 11.7% intergenic (+24/+55) rpoD → / ← ygjF RNA polymerase, sigma 70 (sigma D) factor/G/U mismatch‑specific DNA glycosylase
RA 2,068,647 T→C 10.5% E381E (GAA→GAG)  aer ← fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA 2,068,650 G→T 10.6% G380G (GGC→GGA)  aer ← fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA 2,068,656 A→G 10.7% R378R (CGT→CGC)  aer ← fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA 2,068,659 C→A 12.4% A377A (GCG→GCT)  aer ← fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA 2,068,671 C→T 12.0% A373A (GCG→GCA)  aer ← fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA 2,072,881 C→A 16.3% P235T (CCG→ACG)  ebgR → DNA‑binding transcriptional repressor
RA 2,076,873 C→T 21.3% H147Y (CAT→TAT)  ebgC → cryptic beta‑D‑galactosidase, beta subunit
RA 2,080,563 G→A 6.6% Q86Q (CAG→CAA)  exuT → hexuronate transporter
RA 2,087,666 C→T 50.0% T54I (ACC→ATC)  yhaH → predicted inner membrane protein
RA 2,089,817 C→T 16.6% V99V (GTC→GTT)  yhaK → predicted pirin‑related protein
RA 2,093,664 A→G 6.2% N396N (AAT→AAC)  tdcG ← L‑serine dehydratase 3
RA 2,093,670 T→C 10.7% E394E (GAA→GAG)  tdcG ← L‑serine dehydratase 3
RA 2,093,673 A→G 11.4% I393I (ATT→ATC)  tdcG ← L‑serine dehydratase 3
RA 2,093,679 C→T 10.1% P391P (CCG→CCA)  tdcG ← L‑serine dehydratase 3
RA 2,093,682 G→C 10.2% I390M (ATC→ATG) ‡ tdcG ← L‑serine dehydratase 3
RA 2,093,684 T→C 10.1% I390V (ATC→GTC) ‡ tdcG ← L‑serine dehydratase 3
RA 2,093,685 T→C 10.2% Q389Q (CAA→CAG)  tdcG ← L‑serine dehydratase 3
RA 2,093,700 A→G 14.8% V384V (GTT→GTC)  tdcG ← L‑serine dehydratase 3
RA 2,093,706 A→G 17.0% D382D (GAT→GAC)  tdcG ← L‑serine dehydratase 3
RA 2,093,709 G→A 18.6% C381C (TGC→TGT)  tdcG ← L‑serine dehydratase 3
RA 2,093,712 G→C 19.0% T380T (ACC→ACG)  tdcG ← L‑serine dehydratase 3
RA 2,093,718 C→A 19.2% G378G (GGG→GGT)  tdcG ← L‑serine dehydratase 3
RA 2,093,721 A→G 20.0% L377L (CTT→CTC)  tdcG ← L‑serine dehydratase 3
RA 2,093,727 A→G 20.0% H375H (CAT→CAC)  tdcG ← L‑serine dehydratase 3
RA 2,093,736 C→G 16.4% A372A (GCG→GCC)  tdcG ← L‑serine dehydratase 3
RA 2,093,751 A→G 15.7% N367N (AAT→AAC) ‡ tdcG ← L‑serine dehydratase 3
RA 2,093,752 T→A 16.3% N367I (AAT→ATT) ‡ tdcG ← L‑serine dehydratase 3
RA 2,093,757 T→C 16.9% V365V (GTA→GTG)  tdcG ← L‑serine dehydratase 3
RA 2,093,769 A→G 10.9% S361S (AGT→AGC)  tdcG ← L‑serine dehydratase 3
RA 2,093,772 G→T 12.7% G360G (GGC→GGA)  tdcG ← L‑serine dehydratase 3
RA 2,093,964 T→A 10.1% V296V (GTA→GTT)  tdcG ← L‑serine dehydratase 3
RA 2,093,973 A→G 19.0% I293I (ATT→ATC)  tdcG ← L‑serine dehydratase 3
RA 2,093,979 G→C 18.7% G291G (GGC→GGG)  tdcG ← L‑serine dehydratase 3
RA 2,094,000 T→C 21.0% A284A (GCA→GCG)  tdcG ← L‑serine dehydratase 3
RA 2,094,003 C→A 21.7% T283T (ACG→ACT)  tdcG ← L‑serine dehydratase 3
RA 2,094,006 T→C 21.1% V282V (GTA→GTG)  tdcG ← L‑serine dehydratase 3
RA 2,094,015 C→A 18.2% G279G (GGG→GGT)  tdcG ← L‑serine dehydratase 3
RA 2,094,024 T→A 16.7% A276A (GCA→GCT)  tdcG ← L‑serine dehydratase 3
RA 2,094,789 C→T 7.6% G21G (GGG→GGA)  tdcG ← L‑serine dehydratase 3
RA 2,094,810 G→A 9.1% P14P (CCC→CCT)  tdcG ← L‑serine dehydratase 3
RA 2,094,813 A→G 8.6% G13G (GGT→GGC)  tdcG ← L‑serine dehydratase 3
RA 2,094,819 C→G 8.1% G11G (GGG→GGC)  tdcG ← L‑serine dehydratase 3
RA 2,094,822 A→G 7.3% I10I (ATT→ATC)  tdcG ← L‑serine dehydratase 3
RA 2,111,795 T→C 11.3% C147R (TGC→CGC)  agaI → galactosamine‑6‑phosphate isomerase
RA 2,130,584 A→G 9.4% I107I (ATT→ATC)  mtr ← tryptophan transporter of high affinity
RA 2,130,596 G→A 9.1% T103T (ACC→ACT)  mtr ← tryptophan transporter of high affinity
RA 2,130,599 C→G 8.6% L102L (CTG→CTC)  mtr ← tryptophan transporter of high affinity
RA 2,130,611 C→A 11.6% V98V (GTG→GTT)  mtr ← tryptophan transporter of high affinity
RA 2,130,614 A→G 11.4% F97F (TTT→TTC)  mtr ← tryptophan transporter of high affinity
RA 2,130,622 T→C 12.6% I95V (ATT→GTT)  mtr ← tryptophan transporter of high affinity
RA 2,130,625 A→T 12.2% S94T (TCC→ACC)  mtr ← tryptophan transporter of high affinity
RA 2,130,629 G→A 9.8% G92G (GGC→GGT)  mtr ← tryptophan transporter of high affinity
RA 2,130,633 T→C 10.5% N91S (AAC→AGC)  mtr ← tryptophan transporter of high affinity
RA 2,130,637 C→T 8.5% V90I (GTC→ATC)  mtr ← tryptophan transporter of high affinity
RA 2,130,638 C→A 8.4% V89V (GTG→GTT) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,640 C→T 8.5% V89M (GTG→ATG) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,648 C→G 7.1% G86A (GGC→GCC) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,649 C→T 7.1% G86S (GGC→AGC) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,650 T→G 7.2% K85N (AAA→AAC)  mtr ← tryptophan transporter of high affinity
RA 2,130,653 G→A 7.0% G84G (GGC→GGT)  mtr ← tryptophan transporter of high affinity
RA 2,130,656 C→G 7.0% L83L (CTG→CTC) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,658 G→T 6.4% L83M (CTG→ATG) ‡ mtr ← tryptophan transporter of high affinity
RA 2,130,659 C→T 6.6% L82L (TTG→TTA)  mtr ← tryptophan transporter of high affinity
RA 2,131,666 G→A 19.3% L428L (CTG→TTG)  deaD ← ATP‑dependent RNA helicase
JC 2,133,767 (TCGTTA)2→1 36.0% coding (246‑251/891 nt) nlpI ← conserved hypothetical protein
RA 2,155,567 A→T 16.3% intergenic (+78/+108) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,591 T→A 9.7% intergenic (+102/+84) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,592 C→T 9.1% intergenic (+103/+83) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,605 C→T 7.7% intergenic (+116/+70) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,607 T→A 7.6% intergenic (+118/+68) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,617:1 +A 7.1% intergenic (+128/+58) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,155,618 T→A 6.9% intergenic (+129/+57) dacB → / ← obgE D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA 2,220,170 C→T 6.3% intergenic (+430/‑548) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,174 G→A 6.1% intergenic (+434/‑544) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,179 G→T 7.9% intergenic (+439/‑539) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,199 C→T 15.8% intergenic (+459/‑519) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,205 A→C 15.1% intergenic (+465/‑513) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,206 T→C 14.7% intergenic (+466/‑512) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,208 C→A 15.5% intergenic (+468/‑510) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,209 C→A 15.4% intergenic (+469/‑509) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,218 T→C 16.1% intergenic (+478/‑500) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,226 T→C 11.8% intergenic (+486/‑492) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,220,238 C→T 9.4% intergenic (+498/‑480) yhdH → / → accB predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA 2,225,948 G→C 35.4% V129V (GTG→GTC)  dusB → tRNA‑dihydrouridine synthase B
RA 2,236,063 G→A 7.3% V403V (GTG→GTA)  purH → fused IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase
RA 2,245,573 T→C 17.0% intergenic (‑89/‑6) nudC ← / → rsd NADH pyrophosphatase/stationary phase protein, binds sigma 70 RNA polymerase subunit
RA 2,264,627 T→C 12.5% K6K (AAA→AAG)  nusG ← transcription termination factor
RA 2,264,986 T→C 17.5% E15G (GAA→GGA)  secE ← preprotein translocase membrane subunit
RA 2,280,720 G→A 30.3% R201* (CGA→TGA)  fabR ← DNA‑binding transcriptional repressor
RA 2,292,617 A→G 51.7% intergenic (+168/‑253) fsaB → / → gldA fructose‑6‑phosphate aldolase 2/glycerol dehydrogenase, NAD
RA 2,294,050 A→C 26.0% intergenic (+77/‑198) gldA → / → yijF glycerol dehydrogenase, NAD/conserved hypothetical protein
RA 2,294,089 C→A 19.2% intergenic (+116/‑159) gldA → / → yijF glycerol dehydrogenase, NAD/conserved hypothetical protein
RA 2,297,298 T→C 18.3% E258G (GAA→GGA)  katG ← catalase/hydroperoxidase HPI(I)
RA 2,303,886 G→A 10.4% intergenic (+59/‑125) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,887 T→G 10.4% intergenic (+60/‑124) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,888 C→G 10.4% intergenic (+61/‑123) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,892:1 +C 11.4% intergenic (+65/‑119) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,893:1 +G 10.6% intergenic (+66/‑118) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,898 T→C 12.2% intergenic (+71/‑113) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,904 G→A 11.5% intergenic (+77/‑107) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,907 T→A 13.2% intergenic (+80/‑104) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,913 C→T 13.8% intergenic (+86/‑98) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,303,925 C→A 14.2% intergenic (+98/‑86) metJ → / → yiiX DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA 2,311,509 T→C 15.1% intergenic (+20/‑47) hslU → / → menA molecular chaperone and ATPase component of HslUV protease/1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
RA 2,316,796 G→A 28.0% L157L (CTG→CTA)  glpX → fructose 1,6‑bisphosphatase II
RA 2,329,107 T→C 19.6% intergenic (‑24/+125) yiiM ← / ← kdgT conserved hypothetical protein/2‑keto‑3‑deoxy‑D‑gluconate transporter
RA 2,331,252 A→C 61.1% intergenic (‑157/+273) sodA ← / ← fdhD superoxide dismutase, Mn/formate dehydrogenase formation protein
RA 2,334,140 A→G 17.4% K530R (AAG→AGG)  fdoG → formate dehydrogenase‑O, large subunit
RA 2,346,508 G→A 18.9% P21S (CCA→TCA)  hemN ← coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA 2,359,867 G→A 43.2% noncoding (1228/2905 nt) rrlA ← 23S ribosomal RNA
RA 2,359,876 C→T 41.1% noncoding (1219/2905 nt) rrlA ← 23S ribosomal RNA
RA 2,371,040 T→C 8.3% intergenic (+36/+345) fadA → / ← fre 3‑ketoacyl‑CoA thiolase/flavin reductase
RA 2,371,046 G→A 8.9% intergenic (+42/+339) fadA → / ← fre 3‑ketoacyl‑CoA thiolase/flavin reductase
RA 2,371,048 T→A 9.1% intergenic (+44/+337) fadA → / ← fre 3‑ketoacyl‑CoA thiolase/flavin reductase
RA 2,371,056 C→G 9.2% intergenic (+52/+329) fadA → / ← fre 3‑ketoacyl‑CoA thiolase/flavin reductase
RA 2,371,634 C→T 12.8% E151E (GAG→GAA)  fre ← flavin reductase
RA 2,376,834 G→A 10.6% V518V (GTC→GTT)  ubiB ← 2‑octaprenylphenol hydroxylase
RA 2,401,662 T→C 8.5% K222R (AAA→AGA)  xerC ← site‑specific tyrosine recombinase
RA 2,419,194 C→T 9.1% E273E (GAG→GAA)  wzyE ← predicted Wzy protein involved in ECA polysaccharide chain elongation
RA 2,421,757 C→T 17.8% M193I (ATG→ATA)  wzxE ← O‑antigen translocase
RA 2,425,537 G→A 12.8% T185T (ACC→ACT)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,789 G→A 6.4% N101N (AAC→AAT)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,804 C→T 7.0% A96A (GCG→GCA)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,807 T→C 7.0% A95A (GCA→GCG)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,810 C→A 7.6% P94P (CCG→CCT)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,816 G→T 6.0% D92E (GAC→GAA) ‡ rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,817 T→G 6.1% D92A (GAC→GCC) ‡ rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,818 C→T 6.1% D92N (GAC→AAC) ‡ rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,425,822 A→T 5.9% S90S (TCT→TCA)  rffG ← dTDP‑glucose 4,6‑dehydratase
RA 2,429,480 C→T 16.0% G35S (GGC→AGC)  wzzE ← Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA 2,430,365 T→C 45.2% I111M (ATA→ATG)  rfe ← UDP‑GlcNAc:undecaprenylphosphate GlcNAc‑1‑phosphate transferase
RA 2,432,788 C→T 15.1% G22E (GGG→GAG)  trxA ← thioredoxin 1
RA 2,477,458 T→C 21.3% V168V (GTT→GTC)  pstA → phosphate transporter subunit
RA 2,477,887 A→G 21.4% intergenic (+42/‑141) pstA → / → pstB phosphate transporter subunit/phosphate transporter subunit
RA 2,492,284 C→T 12.9% L361L (CTG→TTG)  gyrB → DNA gyrase, subunit B
RA 2,493,652 A→C 13.5% intergenic (+34/‑341) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,493,675 C→T 22.9% intergenic (+57/‑318) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,493,676 T→C 24.6% intergenic (+58/‑317) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,493,694 T→G 20.4% intergenic (+76/‑299) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,493,697 T→C 19.3% intergenic (+79/‑296) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,493,839 A→C 42.0% intergenic (+221/‑154) gyrB → / → ibpA DNA gyrase, subunit B/heat shock chaperone
RA 2,494,512 A→G 7.4% intergenic (+106/‑6) ibpA → / → ibpB heat shock chaperone/heat shock chaperone
RA 2,507,530 G→A 13.1% P198P (CCG→CCA)  yicI → predicted alpha‑glucosidase
RA 2,547,976 T→C 24.6% V62A (GTT→GCT)  htrL → hypothetical protein
RA 2,549,665 G→A 18.7% G248R (GGG→AGG)  kbl → glycine C‑acetyltransferase
RA 2,562,540 G→T 7.9% L513M (CTG→ATG)  lldP ← L‑lactate permease
RA 2,562,544 T→C 8.4% V511V (GTA→GTG) ‡ lldP ← L‑lactate permease
RA 2,562,545 A→G 8.6% V511A (GTA→GCA) ‡ lldP ← L‑lactate permease
RA 2,562,546 C→T 9.7% V511I (GTA→ATA) ‡ lldP ← L‑lactate permease
RA 2,562,550 C→G 9.8% A509A (GCG→GCC)  lldP ← L‑lactate permease
RA 2,562,553 A→G 10.6% C508C (TGT→TGC)  lldP ← L‑lactate permease
RA 2,562,559 G→C 11.1% I506M (ATC→ATG) ‡ lldP ← L‑lactate permease
RA 2,562,561 T→C 11.1% I506V (ATC→GTC) ‡ lldP ← L‑lactate permease
RA 2,562,562 A→G 11.1% A505A (GCT→GCC)  lldP ← L‑lactate permease
RA 2,562,589 A→G 9.5% G496G (GGT→GGC)  lldP ← L‑lactate permease
RA 2,562,691 T→G 12.5% S462S (TCA→TCC)  lldP ← L‑lactate permease
RA 2,562,697 A→G 13.6% D460D (GAT→GAC)  lldP ← L‑lactate permease
RA 2,562,703 C→G 9.5% G458G (GGG→GGC)  lldP ← L‑lactate permease
RA 2,562,709 C→A 9.3% L456L (CTG→CTT)  lldP ← L‑lactate permease
RA 2,562,718 C→G 10.2% G453G (GGG→GGC)  lldP ← L‑lactate permease
RA 2,562,733 G→A 8.5% F448F (TTC→TTT)  lldP ← L‑lactate permease
RA 2,569,784 T→C 11.7% I18I (ATT→ATC)  yibI → predicted inner membrane protein
RA 2,569,787 T→C 11.7% F19F (TTT→TTC)  yibI → predicted inner membrane protein
RA 2,569,793 A→G 11.0% G21G (GGA→GGG)  yibI → predicted inner membrane protein
RA 2,569,799 C→T 10.5% I23I (ATC→ATT)  yibI → predicted inner membrane protein
RA 2,569,800 G→A 9.8% A24T (GCG→ACG) ‡ yibI → predicted inner membrane protein
RA 2,569,801 C→T 9.9% A24V (GCG→GTG) ‡ yibI → predicted inner membrane protein
RA 2,569,802 G→T 9.8% A24A (GCG→GCT) ‡ yibI → predicted inner membrane protein
RA 2,569,803 A→T 9.6% I25L (ATA→TTA)  yibI → predicted inner membrane protein
RA 2,569,811 C→T 9.7% D27D (GAC→GAT)  yibI → predicted inner membrane protein
RA 2,569,814 C→T 9.3% I28I (ATC→ATT)  yibI → predicted inner membrane protein
RA 2,569,817 T→C 8.9% P29P (CCT→CCC)  yibI → predicted inner membrane protein
RA 2,569,820 T→C 8.4% Y30Y (TAT→TAC)  yibI → predicted inner membrane protein
RA 2,569,847 C→T 13.6% P39P (CCC→CCT)  yibI → predicted inner membrane protein
RA 2,569,859 T→C 18.8% A43A (GCT→GCC)  yibI → predicted inner membrane protein
RA 2,569,866 A→G 18.3% T46A (ACG→GCG) ‡ yibI → predicted inner membrane protein
RA 2,569,867 C→T 19.5% T46M (ACG→ATG) ‡ yibI → predicted inner membrane protein
RA 2,569,868 G→T 19.4% T46T (ACG→ACT) ‡ yibI → predicted inner membrane protein
RA 2,569,871 G→T 19.3% A47A (GCG→GCT)  yibI → predicted inner membrane protein
RA 2,569,874 C→T 17.4% G48G (GGC→GGT)  yibI → predicted inner membrane protein
RA 2,569,883 C→T 23.1% S51S (AGC→AGT)  yibI → predicted inner membrane protein
RA 2,569,892 T→G 18.7% T54T (ACT→ACG)  yibI → predicted inner membrane protein
RA 2,569,893 C→T 18.7% L55L (CTG→TTG) ‡ yibI → predicted inner membrane protein
RA 2,569,895 G→A 17.2% L55L (CTG→CTA) ‡ yibI → predicted inner membrane protein
RA 2,569,922 C→T 12.3% I64I (ATC→ATT)  yibI → predicted inner membrane protein
RA 2,569,928 G→C 10.0% A66A (GCG→GCC)  yibI → predicted inner membrane protein
RA 2,569,934 C→T 9.7% L68L (CTC→CTT)  yibI → predicted inner membrane protein
RA 2,570,755 T→G 7.9% T220T (ACT→ACG)  yibH → hypothetical protein
RA 2,570,756 G→A 7.9% V221I (GTC→ATC) ‡ yibH → hypothetical protein
RA 2,570,758 C→A 8.6% V221V (GTC→GTA) ‡ yibH → hypothetical protein
RA 2,570,759 A→G 8.1% I222V (ATT→GTT) ‡ yibH → hypothetical protein
RA 2,570,761 T→G 8.4% I222M (ATT→ATG) ‡ yibH → hypothetical protein
RA 2,570,764 C→T 8.2% R223R (CGC→CGT)  yibH → hypothetical protein
RA 2,570,774 A→G 6.8% N227D (AAT→GAT)  yibH → hypothetical protein
RA 2,570,779 C→T 6.6% G228G (GGC→GGT)  yibH → hypothetical protein
RA 2,570,782 C→T 6.0% Y229Y (TAC→TAT)  yibH → hypothetical protein
RA 2,570,785 T→G 6.0% V230V (GTT→GTG)  yibH → hypothetical protein
RA 2,570,788 T→C 5.9% T231T (ACT→ACC)  yibH → hypothetical protein
RA 2,570,800 C→T 8.7% I235I (ATC→ATT)  yibH → hypothetical protein
RA 2,570,803 C→T 6.6% R236R (CGC→CGT)  yibH → hypothetical protein
RA 2,570,806 A→G 6.2% P237P (CCA→CCG)  yibH → hypothetical protein
RA 2,570,812 A→C 6.7% T239T (ACA→ACC)  yibH → hypothetical protein
RA 2,570,833 G→A 8.4% L246L (CTG→CTA)  yibH → hypothetical protein
RA 2,570,848 C→G 7.4% V251V (GTC→GTG)  yibH → hypothetical protein
RA 2,570,851 C→T 7.6% F252F (TTC→TTT)  yibH → hypothetical protein
RA 2,570,854 C→A 7.9% I253I (ATC→ATA)  yibH → hypothetical protein
RA 2,571,121 C→T 7.7% G342G (GGC→GGT)  yibH → hypothetical protein
RA 2,571,124 C→T 7.8% I343I (ATC→ATT)  yibH → hypothetical protein
RA 2,571,148 C→T 13.9% S351S (TCC→TCT)  yibH → hypothetical protein
RA 2,571,151 C→T 13.9% D352D (GAC→GAT)  yibH → hypothetical protein
RA 2,571,166 T→C 18.9% V357V (GTT→GTC)  yibH → hypothetical protein
RA 2,571,178 G→C 18.1% R361R (CGG→CGC)  yibH → hypothetical protein
RA 2,571,187 G→A 16.6% L364L (CTG→CTA)  yibH → hypothetical protein
RA 2,571,188 C→T 16.6% L365L (CTA→TTA)  yibH → hypothetical protein
RA 2,571,191 A→C 16.2% R366R (AGA→CGA) ‡ yibH → hypothetical protein
RA 2,571,193 A→C 17.4% R366S (AGA→AGC) ‡ yibH → hypothetical protein
RA 2,571,206 A→G 12.3% M371V (ATG→GTG)  yibH → hypothetical protein
RA 2,571,214 T→C 10.8% Y373Y (TAT→TAC)  yibH → hypothetical protein
RA 2,571,225 A→T 16.4% D377V (GAT→GTT)  yibH → hypothetical protein
RA 2,571,326 T→C 15.5% intergenic (+94/‑1685) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,329 T→G 17.2% intergenic (+97/‑1682) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,330 T→C 17.2% intergenic (+98/‑1681) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,338 T→G 20.7% intergenic (+106/‑1673) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,344:1 +A 16.9% intergenic (+112/‑1667) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,345 T→G 17.0% intergenic (+113/‑1666) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,350 G→A 19.6% intergenic (+118/‑1661) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,351 A→G 19.2% intergenic (+119/‑1660) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,352 G→C 21.2% intergenic (+120/‑1659) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,357 C→A 21.2% intergenic (+125/‑1654) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,371 T→C 26.7% intergenic (+139/‑1640) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,384 T→A 14.3% intergenic (+152/‑1627) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,571,398 G→C 9.3% intergenic (+166/‑1613) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,487 A→G 35.6% intergenic (+1255/‑524) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,705 C→T 32.8% intergenic (+1473/‑306) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,707 T→C 32.9% intergenic (+1475/‑304) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,708 A→C 31.5% intergenic (+1476/‑303) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,711 T→C 18.6% intergenic (+1479/‑300) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,713 C→T 27.6% intergenic (+1481/‑298) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,727 G→T 25.7% intergenic (+1495/‑284) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,736 T→A 25.0% intergenic (+1504/‑275) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,751 T→A 14.6% intergenic (+1519/‑260) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,752 G→A 9.8% intergenic (+1520/‑259) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,756 T→A 9.7% intergenic (+1524/‑255) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,758 A→C 9.7% intergenic (+1526/‑253) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,759 A→G 9.7% intergenic (+1527/‑252) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,761 G→A 8.5% intergenic (+1529/‑250) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,762 T→G 9.4% intergenic (+1530/‑249) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,768 A→G 8.1% intergenic (+1536/‑243) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,770 A→G 8.1% intergenic (+1538/‑241) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,772 T→C 8.1% intergenic (+1540/‑239) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,773 A→G 8.1% intergenic (+1541/‑238) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,941 G→A 49.0% intergenic (+1709/‑70) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,572,989 T→C 34.7% intergenic (+1757/‑22) yibH → / → ysaB hypothetical protein/hypothetical protein
RA 2,573,339 T→C 28.8% intergenic (+29/‑66) ysaB → / → glyQ hypothetical protein/glycine tRNA synthetase, alpha subunit
RA 2,584,304 A→G 7.5% H991H (CAT→CAC) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,306 G→T 8.4% H991N (CAT→AAT) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,314 A→G 11.7% V988A (GTT→GCT)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,316 C→T 11.6% L987L (CTG→CTA)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,322 C→T 13.6% L985L (CTG→CTA) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,324 G→A 13.6% L985L (CTG→TTG) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,325 C→T 13.6% V984V (GTG→GTA)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,343 C→G 13.8% L978L (CTG→CTC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,584,361 T→A 10.8% P972P (CCA→CCT)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,002 T→G 6.3% L425L (CTA→CTC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,011 T→C 8.6% E422E (GAA→GAG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,015 G→A 8.0% A421V (GCG→GTG) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,016 C→T 8.0% A421T (GCG→ACG) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,017 A→C 8.2% I420M (ATT→ATG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,020 G→C 7.5% V419V (GTC→GTG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,023 A→G 7.7% R418R (CGT→CGC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,047 G→T 13.1% I410I (ATC→ATA)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,050 G→C 13.7% A409A (GCC→GCG)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,053 G→A 13.7% D408D (GAC→GAT)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,059 C→G 13.3% V406V (GTG→GTC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,062 C→G 13.3% L405L (CTG→CTC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,065 T→C 10.6% L404L (TTA→TTG) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,067 A→G 11.1% L404L (TTA→CTA) ‡ mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,071 T→G 10.2% I402I (ATA→ATC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,074 C→G 9.2% A401A (GCG→GCC)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,586,077 C→A 9.7% L400L (CTG→CTT)  mdtF ← multidrug transporter, RpoS‑dependent
RA 2,587,282 T→C 10.9% intergenic (‑6/+19) mdtF ← / ← mdtE multidrug transporter, RpoS‑dependent/multidrug resistance efflux transporter
RA 2,592,859 T→A 6.0% N50I (AAT→ATT)  yhiF ← predicted DNA‑binding ranscriptional regulator
RA 2,592,861 C→G 5.1% M49I (ATG→ATC) ‡ yhiF ← predicted DNA‑binding ranscriptional regulator
RA 2,592,863 T→A 5.2% M49L (ATG→TTG) ‡ yhiF ← predicted DNA‑binding ranscriptional regulator
RA 2,595,215 T→G 12.9% T27T (ACA→ACC) ‡ arsC ← arsenate reductase
RA 2,595,216 G→T 12.9% T27K (ACA→AAA) ‡ arsC ← arsenate reductase
RA 2,595,222 C→T 14.0% S25N (AGC→AAC)  arsC ← arsenate reductase
RA 2,595,227 G→A 12.5% R23R (CGC→CGT) ‡ arsC ← arsenate reductase
RA 2,595,228 C→T 12.5% R23H (CGC→CAC) ‡ arsC ← arsenate reductase
RA 2,595,230 G→A 12.3% I22I (ATC→ATT) ‡ arsC ← arsenate reductase
RA 2,595,232 T→G 12.5% I22L (ATC→CTC) ‡ arsC ← arsenate reductase
RA 2,595,245 A→G 21.8% N17N (AAT→AAC)  arsC ← arsenate reductase
RA 2,595,248 A→G 23.2% R16R (CGT→CGC)  arsC ← arsenate reductase
RA 2,595,251 C→T 23.9% S15S (TCG→TCA)  arsC ← arsenate reductase
RA 2,595,254 C→G 22.3% T14T (ACG→ACC)  arsC ← arsenate reductase
RA 2,595,260 G→A 24.5% C12C (TGC→TGT)  arsC ← arsenate reductase
RA 2,595,278 A→G 29.4% I6I (ATT→ATC)  arsC ← arsenate reductase
RA 2,595,306 C→A 33.3% intergenic (‑11/+2) arsC ← / ← arsB arsenate reductase/arsenite/antimonite transporter
RA 2,595,319 A→C 28.4% F427V (TTC→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,326 A→C 26.7% R424R (CGT→CGG)  arsB ← arsenite/antimonite transporter
RA 2,595,329 T→C 25.0% L423L (CTA→CTG) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,330 A→C 24.4% L423R (CTA→CGA) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,331 G→A 25.0% L423L (CTA→TTA) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,341 A→G 21.7% A419A (GCT→GCC)  arsB ← arsenite/antimonite transporter
RA 2,595,347 C→A 21.6% T417T (ACG→ACT)  arsB ← arsenite/antimonite transporter
RA 2,595,350 C→G 20.5% V416V (GTG→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,362 A→C 18.9% P412P (CCT→CCG)  arsB ← arsenite/antimonite transporter
RA 2,595,367 G→C 18.7% L411V (CTG→GTG)  arsB ← arsenite/antimonite transporter
RA 2,595,368 G→A 18.6% T410T (ACC→ACT)  arsB ← arsenite/antimonite transporter
RA 2,595,376 T→C 19.3% I408V (ATC→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,380 C→G 20.5% G406G (GGG→GGC)  arsB ← arsenite/antimonite transporter
RA 2,595,383 T→G 19.3% T405T (ACA→ACC)  arsB ← arsenite/antimonite transporter
RA 2,595,404 G→A 21.5% S398S (AGC→AGT) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,405 C→G 21.8% S398T (AGC→ACC) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,410 A→T 19.7% T396T (ACT→ACA)  arsB ← arsenite/antimonite transporter
RA 2,595,425 C→G 9.9% S391S (TCG→TCC) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,427 A→C 9.7% S391A (TCG→GCG) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,431 T→C 9.9% V389V (GTA→GTG)  arsB ← arsenite/antimonite transporter
RA 2,595,434 G→A 10.0% H388H (CAC→CAT)  arsB ← arsenite/antimonite transporter
RA 2,595,443 G→C 8.3% L385L (CTC→CTG)  arsB ← arsenite/antimonite transporter
RA 2,595,446 T→C 7.7% L384L (CTA→CTG)  arsB ← arsenite/antimonite transporter
RA 2,595,449 C→A 7.6% T383T (ACG→ACT)  arsB ← arsenite/antimonite transporter
RA 2,595,452 A→T 7.7% A382A (GCT→GCA)  arsB ← arsenite/antimonite transporter
RA 2,595,458 G→A 7.4% S380S (AGC→AGT)  arsB ← arsenite/antimonite transporter
RA 2,595,461 A→G 6.2% G379G (GGT→GGC)  arsB ← arsenite/antimonite transporter
RA 2,595,467 T→C 10.4% P377P (CCA→CCG)  arsB ← arsenite/antimonite transporter
RA 2,595,473 A→G 14.4% I375I (ATT→ATC)  arsB ← arsenite/antimonite transporter
RA 2,595,482 T→G 22.6% G372G (GGA→GGC)  arsB ← arsenite/antimonite transporter
RA 2,595,485 C→T 21.5% L371L (TTG→TTA)  arsB ← arsenite/antimonite transporter
RA 2,595,491 G→A 25.0% C369C (TGC→TGT)  arsB ← arsenite/antimonite transporter
RA 2,595,514 C→T 24.6% V362I (GTT→ATT)  arsB ← arsenite/antimonite transporter
RA 2,595,518 C→T 25.2% A360A (GCG→GCA)  arsB ← arsenite/antimonite transporter
RA 2,595,521 T→C 23.2% E359E (GAA→GAG)  arsB ← arsenite/antimonite transporter
RA 2,595,529 T→C 21.6% I357V (ATC→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,530 A→G 21.8% V356V (GTT→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,538 A→T 16.5% S354T (TCT→ACT)  arsB ← arsenite/antimonite transporter
RA 2,595,539 T→C 15.8% A353A (GCA→GCG)  arsB ← arsenite/antimonite transporter
RA 2,595,545 G→A 16.5% S351S (AGC→AGT)  arsB ← arsenite/antimonite transporter
RA 2,595,548 G→C 16.5% G350G (GGC→GGG)  arsB ← arsenite/antimonite transporter
RA 2,595,551 A→G 16.3% D349D (GAT→GAC)  arsB ← arsenite/antimonite transporter
RA 2,595,557 G→C 18.1% S347S (TCC→TCG)  arsB ← arsenite/antimonite transporter
RA 2,595,562 A→G 15.0% L346L (TTG→CTG)  arsB ← arsenite/antimonite transporter
RA 2,595,566 G→A 16.0% G344G (GGC→GGT)  arsB ← arsenite/antimonite transporter
RA 2,595,571 C→T 16.0% V343I (GTT→ATT)  arsB ← arsenite/antimonite transporter
RA 2,595,575 T→C 18.7% V341V (GTA→GTG)  arsB ← arsenite/antimonite transporter
RA 2,595,590 G→A 9.8% N336N (AAC→AAT)  arsB ← arsenite/antimonite transporter
RA 2,595,596 A→C 22.2% I334M (ATT→ATG) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,598 T→C 22.2% I334V (ATT→GTT) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,599 A→T 25.5% S333S (TCT→TCA)  arsB ← arsenite/antimonite transporter
RA 2,595,602 A→T 21.0% S332S (TCT→TCA)  arsB ← arsenite/antimonite transporter
RA 2,595,608 G→A 17.0% F330F (TTC→TTT)  arsB ← arsenite/antimonite transporter
RA 2,595,611 G→T 17.0% A329A (GCC→GCA)  arsB ← arsenite/antimonite transporter
RA 2,595,695 T→G 7.4% L301F (TTA→TTC)  arsB ← arsenite/antimonite transporter
RA 2,595,698 T→C 7.1% G300G (GGA→GGG)  arsB ← arsenite/antimonite transporter
RA 2,595,701 G→T 7.5% A299A (GCC→GCA)  arsB ← arsenite/antimonite transporter
RA 2,595,719 A→G 10.8% V293V (GTT→GTC)  arsB ← arsenite/antimonite transporter
RA 2,595,725 C→G 12.5% L291L (CTG→CTC) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,727 G→T 11.6% L291M (CTG→ATG) ‡ arsB ← arsenite/antimonite transporter
RA 2,595,728 A→G 11.9% Y290Y (TAT→TAC)  arsB ← arsenite/antimonite transporter
RA 2,595,737 G→C 14.9% L287L (CTC→CTG)  arsB ← arsenite/antimonite transporter
RA 2,595,740 C→T 15.1% S286S (TCG→TCA)  arsB ← arsenite/antimonite transporter
RA 2,595,746 G→A 15.5% I284I (ATC→ATT)  arsB ← arsenite/antimonite transporter
RA 2,595,749 G→A 14.5% V283V (GTC→GTT)  arsB ← arsenite/antimonite transporter
RA 2,595,752 A→G 14.6% I282I (ATT→ATC)  arsB ← arsenite/antimonite transporter
RA 2,595,761 G→T 11.0% P279P (CCC→CCA)  arsB ← arsenite/antimonite transporter
RA 2,595,764 G→C 11.1% A278A (GCC→GCG)  arsB ← arsenite/antimonite transporter
RA 2,595,782 A→T 9.0% G272G (GGT→GGA)  arsB ← arsenite/antimonite transporter
RA 2,595,785 C→G 9.1% T271T (ACG→ACC)  arsB ← arsenite/antimonite transporter
RA 2,595,788 A→G 8.3% N270N (AAT→AAC)  arsB ← arsenite/antimonite transporter
RA 2,595,791 A→G 8.0% I269I (ATT→ATC)  arsB ← arsenite/antimonite transporter
RA 2,595,796 C→A 6.7% A268S (GCG→TCG)  arsB ← arsenite/antimonite transporter
RA 2,596,103 A→C 9.0% A165A (GCT→GCG)  arsB ← arsenite/antimonite transporter
RA 2,596,106 G→C 9.2% S164S (TCC→TCG)  arsB ← arsenite/antimonite transporter
RA 2,596,109 A→G 9.6% V163V (GTT→GTC)  arsB ← arsenite/antimonite transporter
RA 2,596,127 G→A 26.8% S157S (TCC→TCT)  arsB ← arsenite/antimonite transporter
RA 2,596,130 G→A 26.5% V156V (GTC→GTT)  arsB ← arsenite/antimonite transporter
RA 2,596,136 A→G 28.3% L154L (CTT→CTC)  arsB ← arsenite/antimonite transporter
RA 2,596,151 G→C 28.8% T149T (ACC→ACG)  arsB ← arsenite/antimonite transporter
RA 2,596,157 G→T 28.8% A147A (GCC→GCA)  arsB ← arsenite/antimonite transporter
RA 2,596,163 G→A 18.5% F145F (TTC→TTT)  arsB ← arsenite/antimonite transporter
RA 2,596,169 G→T 19.2% A143A (GCC→GCA)  arsB ← arsenite/antimonite transporter
RA 2,596,172 C→A 18.6% A142A (GCG→GCT)  arsB ← arsenite/antimonite transporter
RA 2,596,178 C→G 14.5% V140V (GTG→GTC)  arsB ← arsenite/antimonite transporter
RA 2,596,181 G→A 10.7% F139F (TTC→TTT)  arsB ← arsenite/antimonite transporter
RA 2,596,184 C→G 10.3% A138A (GCG→GCC)  arsB ← arsenite/antimonite transporter
RA 2,603,818 A→G 24.1% Y285H (TAC→CAC)  yhiP ← predicted transporter
RA 2,605,504 A→G 23.9% intergenic (‑83/‑308) uspA ← / → yhiO universal stress global response regulator/predicted universal stress (ethanol tolerance) protein B
RA 2,608,096 T→C 21.0% intergenic (‑206/+104) pitA ← / ← nikR phosphate transporter, low‑affinity/DNA‑binding transcriptional regulator, Ni‑binding
RA 2,608,105:1 +C 20.6% intergenic (‑215/+95) pitA ← / ← nikR phosphate transporter, low‑affinity/DNA‑binding transcriptional regulator, Ni‑binding
RA 2,636,243 G→A 10.2% intergenic (+63/‑35) ugpB → / → ugpA glycerol‑3‑phosphate transporter subunit/glycerol‑3‑phosphate transporter subunit
RA 2,645,155 A→G 13.4% E374E (GAA→GAG)  gntU → gluconate transporter, low affinity GNT 1 system
RA 2,663,990 G→A 17.6% G325E (GGG→GAG)  rtcB → conserved hypothetical protein
RA 2,673,919 C→A 22.7% G207C (GGT→TGT)  gntT ← gluconate transporter, high‑affinity GNT I system
RA 2,675,295 G→A 24.3% L60L (CTG→TTG)  gntY ← predicted gluconate transport associated protein
RA 2,677,365 T→A 7.8% M189L (ATG→TTG)  yhgA ← predicted transposase
RA 2,677,369 G→A 7.7% D187D (GAC→GAT)  yhgA ← predicted transposase
RA 2,677,375 T→C 7.8% Q185Q (CAA→CAG)  yhgA ← predicted transposase
RA 2,677,390 T→C 13.0% Q180Q (CAA→CAG)  yhgA ← predicted transposase
RA 2,695,039 C→T 16.4% F31F (TTC→TTT)  nudE → ADP‑ribose diphosphatase
RA 2,704,553 G→A 9.8% R255H (CGC→CAC)  damX → hypothetical protein
RA 2,705,682 A→T 8.1% D167V (GAT→GTT)  dam → DNA adenine methylase
RA 2,708,913 G→A 49.4% E54E (GAG→GAA)  yhfZ → conserved hypothetical protein
RA 2,747,793 T→C 14.7% I103T (ATC→ACC)  rplO → 50S ribosomal subunit protein L15
RA 2,749,714 A→T 6.1% D54V (GAC→GTC)  rpsM → 30S ribosomal subunit protein S13
RA 2,749,720 T→A 5.1% L56Q (CTG→CAG)  rpsM → 30S ribosomal subunit protein S13
RA 2,754,270 A→G 16.4% V413A (GTG→GCG)  trkA ← NAD‑binding component of TrK potassium transporter
RA 2,772,254 C→T 15.5% P527S (CCA→TCA)  aceB → malate synthase A
RA 2,790,638 C→T 13.2% intergenic (+33/‑742) pgi → / → ubiC glucosephosphate isomerase/chorismate pyruvate lyase
RA 2,790,674 G→T 24.3% intergenic (+69/‑706) pgi → / → ubiC glucosephosphate isomerase/chorismate pyruvate lyase
RA 2,790,849 C→T 44.7% intergenic (+244/‑531) pgi → / → ubiC glucosephosphate isomerase/chorismate pyruvate lyase
RA 2,816,309 T→C 22.0% intergenic (‑52/‑34) soxS ← / → soxR DNA‑binding transcriptional dual regulator/DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
RA 2,823,628 G→A 57.4% intergenic (+373/+585) nrfG → / ← pheU heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA 2,823,871 A→G 38.6% intergenic (+616/+342) nrfG → / ← pheU heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA 2,870,827 G→A 8.5% intergenic (+70/‑110) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,831 A→G 8.7% intergenic (+74/‑106) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,832 C→T 8.0% intergenic (+75/‑105) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,833 G→A 8.3% intergenic (+76/‑104) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,836 T→A 9.1% intergenic (+79/‑101) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,847 Δ1 bp 8.0% intergenic (+90/‑90) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,848 C→G 8.0% intergenic (+91/‑89) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,850 T→A 7.8% intergenic (+93/‑87) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,855 A→G 10.0% intergenic (+98/‑82) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,870,865 A→T 8.6% intergenic (+108/‑72) rnr → / → rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA 2,886,319 G→A 11.3% G191S (GGT→AGT)  ytfI → hypothetical protein
RA 2,891,414 C→A 54.4% P23P (CCC→CCA)  ytfQ → predicted sugar transporter subunit
RA 2,892,325 T→C 18.2% intergenic (+23/‑117) ytfQ → / → ytfR predicted sugar transporter subunit/predicted sugar transporter subunit
RA 2,892,345 C→T 38.7% intergenic (+43/‑97) ytfQ → / → ytfR predicted sugar transporter subunit/predicted sugar transporter subunit
RA 2,892,346 T→C 11.6% intergenic (+44/‑96) ytfQ → / → ytfR predicted sugar transporter subunit/predicted sugar transporter subunit
RA 2,892,348 G→A 33.3% intergenic (+46/‑94) ytfQ → / → ytfR predicted sugar transporter subunit/predicted sugar transporter subunit
RA 2,913,962 G→A 11.7% intergenic (‑45/+236) pyrL ← / ← yjgH pyrBI operon leader peptide/predicted mRNA endoribonuclease
RA 2,918,721 T→C 12.5% K325K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,724 G→A 11.8% I324I (ATC→ATT)  argI ← ornithine carbamoyltransferase 1
RA 2,918,727 A→C 12.5% T323T (ACT→ACG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,736 A→C 15.5% R320R (CGT→CGG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,751 A→G 17.1% D315D (GAT→GAC)  argI ← ornithine carbamoyltransferase 1
RA 2,918,754 A→G 14.3% F314F (TTT→TTC)  argI ← ornithine carbamoyltransferase 1
RA 2,918,757 A→C 14.3% V313V (GTT→GTG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,760 A→G 12.6% I312I (ATT→ATC)  argI ← ornithine carbamoyltransferase 1
RA 2,918,766 G→C 8.8% A310A (GCC→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,769 G→C 8.8% A309A (GCC→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,772 A→C 7.9% S308S (TCT→TCG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,775 T→C 7.8% E307E (GAA→GAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,778 G→A 6.3% F306F (TTC→TTT)  argI ← ornithine carbamoyltransferase 1
RA 2,918,781 G→C 6.3% V305V (GTC→GTG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,787 A→G 6.7% D303D (GAT→GAC)  argI ← ornithine carbamoyltransferase 1
RA 2,918,790 A→C 6.8% T302T (ACT→ACG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,793 G→C 6.4% V301V (GTC→GTG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,796 T→C 5.1% E300E (GAA→GAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,948 A→G 10.0% L250L (TTG→CTG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,949 T→C 10.0% A249A (GCA→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,958 T→C 13.5% E246E (GAA→GAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,961 C→T 13.5% A245A (GCG→GCA)  argI ← ornithine carbamoyltransferase 1
RA 2,918,967 T→C 14.1% K243K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,976 T→G 14.6% A240A (GCA→GCC)  argI ← ornithine carbamoyltransferase 1
RA 2,918,979 T→C 14.8% E239E (GAA→GAG)  argI ← ornithine carbamoyltransferase 1
RA 2,918,982 C→G 15.3% G238G (GGG→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,000 A→G 13.6% D232D (GAT→GAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,018 A→C 11.5% A226A (GCT→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,021 A→G 11.2% G225G (GGT→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,024 T→C 9.5% E224E (GAA→GAG) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,026 C→T 9.5% E224K (GAA→AAA) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,030 T→G 7.3% G222G (GGA→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,033 C→T 7.5% K221K (AAG→AAA) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,034 T→G 7.4% K221T (AAG→ACG) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,035 T→C 7.4% K221E (AAG→GAG) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,039 G→C 7.7% V219V (GTC→GTG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,042 A→G 7.3% D218D (GAT→GAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,048 A→C 7.5% T216T (ACT→ACG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,054 C→A 7.0% T214T (ACG→ACT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,153 A→C 9.7% G181G (GGT→GGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,159 A→C 10.0% L179L (CTT→CTG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,168 A→C 10.1% A176A (GCT→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,174 G→C 10.1% L174L (CTC→CTG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,183 A→G 15.6% N171N (AAT→AAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,198 A→G 20.3% R166R (CGT→CGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,204 G→A 23.5% D164D (GAC→GAT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,207 A→G 25.0% G163G (GGT→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,210 T→C 23.7% A162A (GCA→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,213 A→G 23.0% Y161Y (TAT→TAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,228 T→C 20.8% E156E (GAA→GAG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,234 G→A 21.6% F154F (TTC→TTT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,240 T→C 23.1% K152K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,246 G→C 22.6% P150P (CCC→CCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,251 A→G 20.7% L149L (TTG→CTG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,252 A→G 21.0% H148H (CAT→CAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,267 G→C 13.9% L143L (CTC→CTG) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,269 G→T 14.2% L143I (CTC→ATC) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,270 A→C 14.2% L142L (CTT→CTG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,273 A→G 14.3% D141D (GAT→GAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,288 C→G 8.9% T136T (ACG→ACC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,291 G→C 8.7% P135P (CCC→CCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,294 A→G 8.8% H134H (CAT→CAC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,399 G→C 7.8% R99R (CGC→CGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,402 A→C 7.9% G98G (GGT→GGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,405 A→G 7.8% L97L (CTT→CTC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,408 C→A 6.3% V96V (GTG→GTT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,411 G→C 5.8% R95R (CGC→CGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,423 T→C 8.9% K91K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,429 C→T 10.4% S89S (TCG→TCA)  argI ← ornithine carbamoyltransferase 1
RA 2,919,441 A→C 12.8% G85G (GGT→GGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,459 T→C 16.3% P79P (CCA→CCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,462 G→C 14.5% G78G (GGC→GGG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,465 G→T 14.5% L77L (CTC→CTA) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,467 G→A 14.6% L77F (CTC→TTC) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,471 A→G 14.6% T75T (ACT→ACC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,480 A→C 16.5% A72A (GCT→GCG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,483 A→G 16.8% G71G (GGT→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,493 T→A 22.0% Y68F (TAT→TTT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,516 T→A 30.3% R60R (CGA→CGT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,564 A→G 21.2% T44T (ACT→ACC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,567 G→A 19.8% L43L (CTC→CTT)  argI ← ornithine carbamoyltransferase 1
RA 2,919,570 T→C 13.7% K42K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,573 G→C 14.3% A41A (GCC→GCG) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,574 G→T 14.0% A41D (GCC→GAC) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,575 C→G 17.6% A41P (GCC→CCC) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,577 T→A 17.6% E40V (GAA→GTA)  argI ← ornithine carbamoyltransferase 1
RA 2,919,582 T→C 17.6% K38K (AAA→AAG)  argI ← ornithine carbamoyltransferase 1
RA 2,919,585 A→G 15.4% G37G (GGT→GGC)  argI ← ornithine carbamoyltransferase 1
RA 2,919,588 G→A 14.6% S36S (AGC→AGT) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,919,589 C→T 14.4% S36N (AGC→AAC) ‡ argI ← ornithine carbamoyltransferase 1
RA 2,924,237 G→A 18.6% P329S (CCT→TCT)  valS ← valyl‑tRNA synthetase
RA 2,931,105 G→A 19.4% L115L (CTG→TTG)  yjgR ← predicted ATPase
RA 2,933,019 G→A 28.9% G297G (GGC→GGT)  idnT ← L‑idonate and D‑gluconate transporter
RA 2,936,917 T→C 18.2% K226R (AAA→AGA)  yjgB ← predicted alcohol dehydrogenase, Zn‑dependent and NAD(P)‑binding
RA 2,946,407 G→A 57.1% intergenic (‑121/+121) fecI ← / ← dnaC RNA polymerase, sigma 19 factor/DNA biosynthesis protein
RA 2,947,541 G→A 15.0% F89F (TTC→TTT)  dnaT ← DNA biosynthesis protein
RA 2,952,864 G→A 22.5% intergenic (‑173/+95) leuQ ← / ← rsmC tRNA‑Leu/16S RNA m2G1207 methylase
RA 2,952,884 G→A 12.9% intergenic (‑193/+75) leuQ ← / ← rsmC tRNA‑Leu/16S RNA m2G1207 methylase
RA 2,960,632 Δ1 bp 8.2% intergenic (+82/+338) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,960,726 T→G 9.6% intergenic (+176/+244) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,960,735 G→C 9.2% intergenic (+185/+235) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,960,737 C→G 8.2% intergenic (+187/+233) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,960,739 Δ1 bp 10.6% intergenic (+189/+231) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,960,746 A→C 11.1% intergenic (+196/+224) yjjV → / ← yjjW predicted DNase/predicted pyruvate formate lyase activating enzyme
RA 2,970,436 C→T 25.4% *215* (TGA→TAA)  ytjB ← conserved hypothetical protein

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ minE 251983 252041 59 13 [11] [12] 13 malZ maltodextrin glucosidase
* * ÷ minE 1231136 1231173 38 13 [12] [12] 13 ptrB protease II

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? minE = 560046 (0.890)15 (0.380)
+ACGCTGCGATTT
8/78 NT 29.4% intergenic (+70/+83) yaaX/yaaA hypothetical protein/conserved hypothetical protein
?minE 2636227 = 48 (0.930)intergenic (+47/‑51) ugpB/ugpA glycerol‑3‑phosphate transporter subunit/glycerol‑3‑phosphate transporter subunit
* ? minE = 567148 (0.930)18 (0.380) 10/94 NT 35.9% intergenic (+141/+12) yaaX/yaaA hypothetical protein/conserved hypothetical protein
?minE 2094909 = 20 (0.420)intergenic (‑58/+394) tdcG/rnpB L‑serine dehydratase 3/RNase P
* ? minE 15385 =37 (0.710)10 (0.200) 9/100 NT 29.7% intergenic (+87/+60) dnaJ/mokC chaperone Hsp40, co‑chaperone with DnaK/regulatory protein for HokC, overlaps CDS of hokC
?minE = 1570889 11 (0.220)intergenic (+26/+210) nupC/alaX nucleoside (except guanosine) transporter/tRNA‑Ala
* ? minE = 1824157 (1.100)25 (0.480) 21/102 NT 37.6% intergenic (+80/+252) nhaR/rpsT DNA‑binding transcriptional activator/30S ribosomal subunit protein S20
?minE 1502766 = 26 (0.500)intergenic (‑139/‑781) lrhA/yfbQ DNA‑binding transcriptional repressor/predicted aminotransferase
* ? minE 75112 =54 (1.040)4 (0.090) 3/84 NT 7.4% coding (279/942 nt) mraW S‑adenosyl‑dependent methyltransferase activity on membrane‑located substrates
?minE 75141 = 55 (1.290)coding (308/942 nt) mraW S‑adenosyl‑dependent methyltransferase activity on membrane‑located substrates
* ? minE 95427 =70 (1.350)4 (0.090) 3/92 NT 6.4% coding (2409/2706 nt) secA preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
?minE 95453 = 53 (1.130)coding (2435/2706 nt) secA preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
* ? minE 126195 =45 (0.870)3 (0.060) 3/96 NT 7.1% coding (25/537 nt) hpt hypoxanthine phosphoribosyltransferase
?minE 126212 = 36 (0.740)coding (42/537 nt) hpt hypoxanthine phosphoribosyltransferase
* ? minE 134415 =41 (0.790)4 (0.100) 3/76 NT 13.7% intergenic (‑74/+40) panB/yadC 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase/predicted fimbrial‑like adhesin protein
?minE 134452 = 20 (0.520)intergenic (‑111/+3) panB/yadC 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase/predicted fimbrial‑like adhesin protein
* ? minE = 13852565 (1.250)4 (0.090) 3/92 NT 6.8% coding (1642/2598 nt) htrE predicted outer membrane usher protein
?minE = 138536 51 (1.090)coding (1631/2598 nt) htrE predicted outer membrane usher protein
* ? minE 139150 =50 (0.960)5 (0.100) 3/102 NT 8.3% coding (1017/2598 nt) htrE predicted outer membrane usher protein
?minE 139171 = 61 (1.180)coding (996/2598 nt) htrE predicted outer membrane usher protein
* ? minE = 17425154 (1.040)4 (0.080) 3/96 NT 7.9% coding (524/762 nt) ispU undecaprenyl pyrophosphate synthase
?minE = 174268 42 (0.860)coding (541/762 nt) ispU undecaprenyl pyrophosphate synthase
* ? minE = 18889668 (1.310)19 (0.520)
+GAACAGGGTCGCTAA
10/72 NT 32.5% coding (393/2142 nt) ldcC lysine decarboxylase 2, constitutive
?minE = 924830 44 (0.850)coding (516/589 nt) yncA predicted acyltransferase with acyl‑CoA N‑acyltransferase domain
* ? minE 202882 =NA (NA)7 (0.140) 3/100 NT NA noncoding (287/1542 nt) rrsH 16S ribosomal RNA
?minE 202909 = NA (NA)noncoding (314/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 202915NA (NA)3 (0.060) 3/92 NT NA noncoding (320/1542 nt) rrsH 16S ribosomal RNA
?minE = 202927 NA (NA)noncoding (332/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203199NA (NA)4 (0.090) 4/88 NT NA noncoding (604/1542 nt) rrsH 16S ribosomal RNA
?minE = 203228 NA (NA)noncoding (633/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203909NA (NA)5 (0.110) 5/88 NT NA noncoding (1314/1542 nt) rrsH 16S ribosomal RNA
?minE = 203917 NA (NA)noncoding (1322/1542 nt) rrsH 16S ribosomal RNA
* ? minE = 203945NA (NA)7 (0.140) 4/100 NT NA noncoding (1350/1542 nt) rrsH 16S ribosomal RNA
?minE = 203966 NA (NA)noncoding (1371/1542 nt) rrsH 16S ribosomal RNA
* ? minE 203947 =NA (NA)5 (0.110) 4/92 NT NA noncoding (1352/1542 nt) rrsH 16S ribosomal RNA
?minE 203966 = NA (NA)noncoding (1371/1542 nt) rrsH 16S ribosomal RNA
* ? minE 204033 =NA (NA)4 (0.080) 4/94 NT NA noncoding (1438/1542 nt) rrsH 16S ribosomal RNA
?minE 204063 = NA (NA)noncoding (1468/1542 nt) rrsH 16S ribosomal RNA
* ? minE 204714 =NA (NA)4 (0.090) 3/88 NT NA noncoding (131/2904 nt) rrlH 23S ribosomal RNA
?minE 204732 = NA (NA)noncoding (149/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 204740NA (NA)9 (0.210) 7/86 NT NA noncoding (157/2904 nt) rrlH 23S ribosomal RNA
?minE = 204751 NA (NA)noncoding (168/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205114NA (NA)7 (0.150) 5/94 NT NA noncoding (531/2904 nt) rrlH 23S ribosomal RNA
?minE = 205125 NA (NA)noncoding (542/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 205178NA (NA)11 (0.240) 4/92 NT NA noncoding (595/2904 nt) rrlH 23S ribosomal RNA
?minE = 205194 NA (NA)noncoding (611/2904 nt) rrlH 23S ribosomal RNA
* ? minE 205529 =NA (NA)5 (0.100) 3/94 NT NA noncoding (946/2904 nt) rrlH 23S ribosomal RNA
?minE 205555 = NA (NA)noncoding (972/2904 nt) rrlH 23S ribosomal RNA
* ? minE 205640 =NA (NA)7 (0.140) 3/96 NT NA noncoding (1057/2904 nt) rrlH 23S ribosomal RNA
?minE 205665 = NA (NA)noncoding (1082/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 206767NA (NA)6 (0.120) 4/98 NT NA noncoding (2184/2904 nt) rrlH 23S ribosomal RNA
?minE = 206784 NA (NA)noncoding (2201/2904 nt) rrlH 23S ribosomal RNA
* ? minE = 206886NA (NA)3 (0.060) 3/92 NT NA noncoding (2303/2904 nt) rrlH 23S ribosomal RNA
?minE = 206895 NA (NA)noncoding (2312/2904 nt) rrlH 23S ribosomal RNA
* ? minE 208968 =48 (0.930)7 (0.150) 3/90 NT 15.0% coding (738/915 nt) yafC predicted DNA‑binding transcriptional regulator
?minE 208993 = 37 (0.810)coding (713/915 nt) yafC predicted DNA‑binding transcriptional regulator
* ? minE = 21562239 (0.750)57 (2.340)
+27 bp
37/48 NT 71.2% coding (732/732 nt) dnaQ DNA polymerase III epsilon subunit
?minE 2705182 = 59 (1.140)intergenic (+106/‑1) damX/dam hypothetical protein/DNA adenine methylase
* ? minE 222160 =61 (1.180)5 (0.110) 3/92 NT 8.5% intergenic (‑33/‑207) fadE/lpcA acyl coenzyme A dehydrogenase/D‑sedoheptulose 7‑phosphate isomerase
?minE 222187 = 52 (1.110)intergenic (‑60/‑180) fadE/lpcA acyl coenzyme A dehydrogenase/D‑sedoheptulose 7‑phosphate isomerase
* ? minE = 22303749 (0.950)20 (0.560)
+TAGCACTGCCACGTAT
10/70 NT 42.8% intergenic (+92/‑88) lpcA/prfH D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
?minE 1019195 = 29 (0.560)intergenic (+144/+82) ydgA/uidC conserved hypothetical protein/predicted outer membrane porin protein
* ? minE 298441 =35 (0.680)3 (0.070)
+AACCACC
3/88 NT 10.4% coding (1102/1773 nt) mdlA fused predicted multidrug transporter subunits and ATP‑binding components of ABC superfamily
?minE 706827 = 25 (0.480)coding (584/921 nt) lpxL lauryl‑acyl carrier protein (ACP)‑dependent acyltransferase
* ? minE = 29953656 (1.080)5 (0.100) 3/94 NT 8.8% coding (432/1782 nt) mdlB fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
?minE = 299550 52 (1.090)coding (446/1782 nt) mdlB fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
* ? minE 299638 =46 (0.890)6 (0.130) 4/90 NT 11.6% coding (534/1782 nt) mdlB fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
?minE 299664 = 51 (1.120)coding (560/1782 nt) mdlB fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
* ? minE = 35057042 (0.810)19 (0.430)
+CACGCCGC
9/86 NT 33.4% intergenic (+167/+32) glxR/purK tartronate semialdehyde reductase, NADH‑dependent/N5‑carboxyaminoimidazole ribonucleotide synthase
?minE 1941687 = 48 (0.930)intergenic (+126/+70) ygfZ/yqfA predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
* ? minE = 37002964 (1.240)3 (0.070)
+TTAATG
3/90 NT 5.5% coding (976/3882 nt) entF enterobactin synthase multienzyme complex component, ATP‑dependent
?minE = 555160 53 (1.020)coding (602/663 nt) fsaA fructose‑6‑phosphate aldolase 1
* ? minE = 39153440 (0.770)4 (0.090) 3/88 NT 9.4% intergenic (‑68/+79) ybdN/ybdO conserved hypothetical protein/predicted DNA‑binding transcriptional regulator
?minE = 391543 43 (0.960)intergenic (‑77/+70) ybdN/ybdO conserved hypothetical protein/predicted DNA‑binding transcriptional regulator
* ? minE 397368 =62 (1.200)4 (0.080) 3/96 NT 6.9% coding (421/966 nt) lipA lipoate synthase
?minE 397397 = 50 (1.030)coding (392/966 nt) lipA lipoate synthase
* ? minE 436259 =61 (1.180)110 (2.300) 55/94 NT 70.5% intergenic (‑156/‑29) ybfF/seqA conserved hypothetical protein/regulatory protein for replication initiation
?minE = 2706018 36 (0.750)coding (836/837 nt) dam DNA adenine methylase
* ? minE = 43683360 (1.160)149 (2.880) 63/102 NT 74.3% coding (546/546 nt) seqA regulatory protein for replication initiation
?minE 1803907 = 43 (0.830)intergenic (+63/‑28) ygaH/mprA predicted inner membrane protein/DNA‑binding transcriptional regulator
* ? minE 464953 =42 (0.810)8 (0.250)
+AAGTTCAGCGATCTACATTA
6/62 NT 24.3% intergenic (+93/‑208) sdhB/sucA succinate dehydrogenase, FeS subunit/2‑oxoglutarate decarboxylase, thiamin‑requiring
?minE = 2870826 40 (0.770)intergenic (+69/‑111) rnr/rlmB exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
* ? minE = 49427655 (1.060)3 (0.070) 3/90 NT 5.4% coding (1017/1041 nt) galM galactose‑1‑epimerase
?minE = 494284 57 (1.250)coding (1009/1041 nt) galM galactose‑1‑epimerase
* ? minE = 50757479 (1.520)5 (0.110) 3/92 NT 6.3% coding (361/1053 nt) ybhH conserved hypothetical protein
?minE = 507593 77 (1.650)coding (380/1053 nt) ybhH conserved hypothetical protein
* ? minE = 55846919 (0.370)12 (0.240)
+GT
7/98 NT 29.7% intergenic (+19/‑285) iaaA/cmr L‑asparaginase/multidrug efflux system protein
?minE 1659293 = 40 (0.770)coding (1493/1542 nt) ppx exopolyphosphatase
* ? minE = 60547632 (0.620)3 (0.060) 3/92 NT 8.0% coding (792/909 nt) ycaN predicted DNA‑binding transcriptional regulator
?minE = 605486 40 (0.860)coding (782/909 nt) ycaN predicted DNA‑binding transcriptional regulator
* ? minE = 63146926 (0.500)4 (0.090) 3/90 NT 13.1% coding (452/1323 nt) mukF Involved in chromosome partioning, Ca2+ binding protein
?minE = 631495 30 (0.660)coding (478/1323 nt) mukF Involved in chromosome partioning, Ca2+ binding protein
* ? minE = 76108037 (0.710)3 (0.060) 3/94 NT 7.5% coding (1005/1047 nt) potD polyamine transporter subunit
?minE = 761099 40 (0.840)coding (986/1047 nt) potD polyamine transporter subunit
* ? minE 764598 =57 (1.100)3 (0.060) 3/94 NT 5.8% coding (252/1137 nt) potA polyamine transporter subunit
?minE 764619 = 45 (0.940)coding (231/1137 nt) potA polyamine transporter subunit
* ? minE = 81501440 (0.770)3 (0.070) 3/88 NT 7.5% coding (78/852 nt) ispE 4‑diphosphocytidyl‑2‑C‑methylerythritol kinase
?minE = 815027 40 (0.890)coding (65/852 nt) ispE 4‑diphosphocytidyl‑2‑C‑methylerythritol kinase
* ? minE 815317 =52 (1.000)3 (0.060) 3/94 NT 5.9% coding (398/624 nt) lolB chaperone for lipoproteins
?minE 815343 = 48 (1.010)coding (372/624 nt) lolB chaperone for lipoproteins
* ? minE = 85503341 (0.790)3 (0.070) 3/86 NT 8.0% intergenic (‑44/+337) yciG/trpA hypothetical protein/tryptophan synthase, alpha subunit
?minE = 855042 34 (0.780)intergenic (‑53/+328) yciG/trpA hypothetical protein/tryptophan synthase, alpha subunit
* ? minE 865596 =7 (0.140)5 (0.100) 3/100 NT 17.6% intergenic (+1/‑210) yciQ/rluB predicted inner membrane protein/23S rRNA pseudouridylate synthase
?minE 865626 = 40 (0.790)intergenic (+31/‑180) yciQ/rluB predicted inner membrane protein/23S rRNA pseudouridylate synthase
* ? minE 886884 =32 (0.620)4 (0.090) 3/92 NT 11.1% coding (983/1935 nt) rnb ribonuclease II
?minE 886912 = 35 (0.750)coding (955/1935 nt) rnb ribonuclease II
* ? minE 901743 =54 (1.040)3 (0.070) 3/88 NT 6.6% coding (1588/1680 nt) ycjM predicted glucosyltransferase
?minE 901773 = 38 (0.850)coding (1618/1680 nt) ycjM predicted glucosyltransferase
* ? minE 919665 =37 (0.710)3 (0.060) 3/94 NT 7.0% coding (796/966 nt) ycjG L‑Ala‑D/L‑Glu epimerase
?minE 919715 = 46 (0.960)coding (846/966 nt) ycjG L‑Ala‑D/L‑Glu epimerase
* ? minE 957613 =51 (0.980)3 (0.070) 3/90 NT 7.0% coding (2693/2796 nt) pqqL predicted peptidase
?minE 957637 = 35 (0.770)coding (2669/2796 nt) pqqL predicted peptidase
* ? minE 979119 =56 (1.080)3 (0.060) 3/94 NT 6.2% coding (26/2046 nt) dcp dipeptidyl carboxypeptidase II
?minE 979139 = 39 (0.820)coding (6/2046 nt) dcp dipeptidyl carboxypeptidase II
* ? minE = 98452441 (0.790)3 (0.070) 3/86 NT 6.7% coding (625/711 nt) ynfC hypothetical protein
?minE = 984538 49 (1.120)coding (611/711 nt) ynfC hypothetical protein
* ? minE 998811 =43 (0.830)3 (0.060) 3/94 NT 8.0% intergenic (+168/‑256) ynfM/asr predicted transporter/acid shock‑inducible periplasmic protein
?minE 998856 = 29 (0.610)intergenic (+213/‑211) ynfM/asr predicted transporter/acid shock‑inducible periplasmic protein
* ? minE 1039924 =45 (0.870)3 (0.060) 3/92 NT 6.5% intergenic (+75/‑536) nth/ydgR DNA glycosylase and apyrimidinic (AP) lyase/predicted transporter
?minE 1039951 = 46 (0.980)intergenic (+102/‑509) nth/ydgR DNA glycosylase and apyrimidinic (AP) lyase/predicted transporter
* ? minE 1098680 =42 (0.810)4 (0.090) 3/92 NT 9.5% intergenic (+18/‑82) ydiL/ydiM conserved hypothetical protein/predicted transporter
?minE 1098700 = 38 (0.810)intergenic (+38/‑62) ydiL/ydiM conserved hypothetical protein/predicted transporter
* ? minE = 116858161 (1.180)4 (0.080) 3/96 NT 7.2% coding (514/621 nt) ynjF predicted phosphatidyl transferase, inner membrane protein
?minE = 1168598 46 (0.940)coding (497/621 nt) ynjF predicted phosphatidyl transferase, inner membrane protein
* ? minE = 121689154 (1.040)3 (0.070) 3/90 NT 5.2% coding (1842/2049 nt) prc carboxy‑terminal protease for penicillin‑binding protein 3
?minE = 1216912 61 (1.330)coding (1821/2049 nt) prc carboxy‑terminal protease for penicillin‑binding protein 3
* ? minE 1249724 =52 (1.000)3 (0.060) 3/96 NT 6.3% coding (169/612 nt) ruvA component of RuvABC resolvasome, regulatory subunit
?minE 1249756 = 41 (0.840)coding (137/612 nt) ruvA component of RuvABC resolvasome, regulatory subunit
* ? minE 1258762 =57 (1.100)4 (0.090)
+CAACGT
3/90 NT 8.0% coding (2162/2430 nt) torZ trimethylamine N‑oxide reductase system III, catalytic subunit
?minE = 1519712 47 (0.910)coding (282/660 nt) dedA conserved inner membrane protein
* ? minE 1262029 =29 (0.560)4 (0.090) 3/92 NT 13.5% coding (20/1101 nt) torY TMAO reductase III (TorYZ), cytochrome c‑type subunit
?minE 1262049 = 25 (0.530)intergenic (‑1/+387) torY/cutC TMAO reductase III (TorYZ), cytochrome c‑type subunit/copper homeostasis protein
* ? minE = 126244037 (0.710)5 (0.110) 3/88 NT 13.3% coding (743/747 nt) cutC copper homeostasis protein
?minE = 1262456 33 (0.740)coding (727/747 nt) cutC copper homeostasis protein
* ? minE = 128040342 (0.810)6 (0.130) 3/88 NT 12.5% coding (2182/7104 nt) yeeJ adhesin
?minE = 1280416 48 (1.070)coding (2195/7104 nt) yeeJ adhesin
* ? minE 1298934 =52 (1.000)6 (0.130) 4/88 NT 11.1% coding (142/546 nt) cobU bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase
?minE 1298968 = 51 (1.140)coding (108/546 nt) cobU bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase
* ? minE 1310343 =66 (1.270)3 (0.070) 3/86 NT 6.1% intergenic (+19/‑127) hisL/hisG his operon leader peptide/ATP phosphoribosyltransferase
?minE 1310367 = 36 (0.820)intergenic (+43/‑103) hisL/hisG his operon leader peptide/ATP phosphoribosyltransferase
* ? minE 1396187 =42 (0.810)4 (0.090) 3/90 NT 10.4% coding (893/1182 nt) setB lactose/glucose efflux system
?minE 1396206 = 32 (0.700)coding (912/1182 nt) setB lactose/glucose efflux system
* ? minE = 140836456 (1.080)3 (0.070) 3/90 NT 5.3% coding (633/1590 nt) yejF fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
?minE = 1408381 57 (1.250)coding (650/1590 nt) yejF fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
* ? minE 1435980 =60 (1.160)5 (0.130)
+TGTGGTGGTGGC
4/78 NT 8.1% coding (188/1644 nt) yojI fused predicted multidrug transport subunits and membrane component and ATP‑binding component of ABC superfamily
?minE = 2059288 88 (1.700)coding (552/1464 nt) ygjE predicted tartrate:succinate antiporter
* ? minE = 144372862 (1.200)4 (0.090) 3/92 NT 5.8% intergenic (+16/‑1) rcsD/rcsB phosphotransfer intermediate protein in two‑component regulatory system with RcsBC/DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
?minE = 1443743 74 (1.580)coding (15/651 nt) rcsB DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
* ? minE = 144453728 (0.540)10 (0.380)
+25 bp
10/52 NT 46.6% intergenic (+158/+42) rcsB/rcsC DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN/hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
?minE 2477862 = 17 (0.330)intergenic (+17/‑166) pstA/pstB phosphate transporter subunit/phosphate transporter subunit
* ? minE = 145650446 (0.890)5 (0.110) 3/90 NT 11.8% coding (846/1650 nt) yfaQ hypothetical protein
?minE = 1456521 34 (0.740)coding (829/1650 nt) yfaQ hypothetical protein
* ? minE = 147600968 (1.310)6 (0.130) 3/92 NT 8.5% coding (1074/1131 nt) nrdB ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
?minE = 1476015 68 (1.450)coding (1080/1131 nt) nrdB ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
* ? minE = 150126466 (1.270)3 (0.070) 3/90 NT 5.7% intergenic (‑206/+425) nuoA/lrhA NADH:ubiquinone oxidoreductase, membrane subunit A/DNA‑binding transcriptional repressor
?minE = 1501324 41 (0.900)intergenic (‑266/+365) nuoA/lrhA NADH:ubiquinone oxidoreductase, membrane subunit A/DNA‑binding transcriptional repressor
* ? minE = 154591946 (0.890)6 (0.130) 5/92 NT 12.2% coding (268/285 nt) yfcZ conserved hypothetical protein
?minE = 1545933 45 (0.960)coding (254/285 nt) yfcZ conserved hypothetical protein
* ? minE 1583045 =35 (0.680)6 (0.130) 3/88 NT 15.0% coding (190/2016 nt) ligA DNA ligase, NAD(+)‑dependent
?minE 1583066 = 38 (0.850)coding (169/2016 nt) ligA DNA ligase, NAD(+)‑dependent
* ? minE 1591595 =33 (0.640)49 (1.100)
+ACATCAA
17/88 NT 56.9% intergenic (+54/+135) yfeS/cysM conserved hypothetical protein/cysteine synthase B
?minE 1864319 = 53 (1.020)intergenic (+66/+82) ygcP/ygcQ predicted anti‑terminator regulatory protein/predicted flavoprotein
* ? minE = 167593089 (1.720)6 (0.130) 3/88 NT 7.5% coding (1040/1155 nt) yfgB hypothetical protein
?minE = 1675947 71 (1.590)coding (1023/1155 nt) yfgB hypothetical protein
* ? minE = 168768534 (0.660)33 (0.830)
+GATTCTTGCGCC
18/78 NT 52.2% intergenic (‑66/+76) sseB/pepB rhodanase‑like enzyme, sulfur transfer from thiosulfate/aminopeptidase B
?minE 2892324 = 45 (0.870)intergenic (+22/‑118) ytfQ/ytfR predicted sugar transporter subunit/predicted sugar transporter subunit
* ? minE 1735927 =50 (0.960)3 (0.060) 3/96 NT 6.4% coding (146/906 nt) era membrane‑associated, 16S rRNA‑binding GTPase
?minE 1735964 = 40 (0.820)coding (109/906 nt) era membrane‑associated, 16S rRNA‑binding GTPase
* ? minE 1761923 =50 (0.960)6 (0.130) 3/90 NT 12.6% intergenic (‑53/+132) rrlG/gltW 23S ribosomal RNA/tRNA‑Glu
?minE 1761941 = 39 (0.850)intergenic (‑71/+114) rrlG/gltW 23S ribosomal RNA/tRNA‑Glu
* ? minE = 176690054 (1.040)3 (0.060) 3/96 NT 5.5% intergenic (‑41/+89) clpB/yfiH protein disaggregation chaperone/conserved hypothetical protein
?minE = 1766917 52 (1.070)intergenic (‑58/+72) clpB/yfiH protein disaggregation chaperone/conserved hypothetical protein
* ? minE 1837010 =67 (1.290)5 (0.110) 3/90 NT 8.1% coding (90/876 nt) rpoS RNA polymerase, sigma S (sigma 38) factor
?minE 1837032 = 55 (1.200)coding (68/876 nt) rpoS RNA polymerase, sigma S (sigma 38) factor
* ? minE 1869856 =43 (0.830)5 (0.110) 4/90 NT 11.0% intergenic (‑101/‑218) ygcW/yqcE predicted deoxygluconate dehydrogenase/predicted transporter
?minE 1869880 = 43 (0.940)intergenic (‑125/‑194) ygcW/yqcE predicted deoxygluconate dehydrogenase/predicted transporter
* ? minE 1916933 =60 (1.160)5 (0.100) 3/98 NT 9.4% coding (235/690 nt) mutH methyl‑directed mismatch repair protein
?minE 1916957 = 39 (0.780)coding (259/690 nt) mutH methyl‑directed mismatch repair protein
* ? minE 1958332 =36 (0.690)3 (0.070) 3/88 NT 7.7% coding (262/660 nt) rpiA ribosephosphate isomerase, constitutive
?minE 1958358 = 41 (0.920)coding (236/660 nt) rpiA ribosephosphate isomerase, constitutive
* ? minE 1985422 =52 (1.000)8 (0.220)
+TACGCCGCATCCGGC
4/72 NT 16.3% intergenic (+25/+130) yggW/yggM predicted oxidoreductase/conserved hypothetical protein
?minE 2901792 = 64 (1.240)intergenic (‑44/+114) nrdG/nrdD anaerobic ribonucleotide reductase activating protein/anaerobic ribonucleoside‑triphosphate reductase
* ? minE 2000859 =104 (2.010)6 (0.120) 4/96 NT 6.9% coding (424/1860 nt) gss fused glutathionylspermidine amidase and glutathionylspermidine synthetase
?minE 2000891 = 65 (1.330)coding (392/1860 nt) gss fused glutathionylspermidine amidase and glutathionylspermidine synthetase
* ? minE = 205169156 (1.080)4 (0.090) 3/90 NT 6.9% intergenic (‑13/‑229) ygiF/htrG predicted adenylate cyclase/predicted signal transduction protein
?minE = 2051703 59 (1.290)intergenic (‑25/‑217) ygiF/htrG predicted adenylate cyclase/predicted signal transduction protein
* ? minE = 208397378 (1.510)5 (0.110) 3/92 NT 6.7% coding (333/384 nt) yqjB conserved hypothetical protein
?minE = 2083985 69 (1.480)coding (345/384 nt) yqjB conserved hypothetical protein
* ? minE 2140433 =60 (1.160)3 (0.060) 3/94 NT 6.0% coding (675/2673 nt) infB fused protein chain initiation factor 2, IF2
?minE 2140452 = 38 (0.800)coding (656/2673 nt) infB fused protein chain initiation factor 2, IF2
* ? minE = 216818144 (0.850)3 (0.060) 3/94 NT 6.2% coding (253/576 nt) yrbK conserved hypothetical protein
?minE = 2168207 51 (1.070)coding (279/576 nt) yrbK conserved hypothetical protein
* ? minE = 2232336NA (NA)4 (0.080) 3/94 NT NA noncoding (9/2904 nt) rrlD 23S ribosomal RNA
?minE = 2232398 NA (NA)intergenic (‑54/+140) rrlD/gltV 23S ribosomal RNA/tRNA‑Glu
* ? minE 2254588 =75 (1.450)4 (0.080) 3/96 NT 5.7% coding (2450/4224 nt) rpoC RNA polymerase, beta prime subunit
?minE 2254616 = 62 (1.270)coding (2422/4224 nt) rpoC RNA polymerase, beta prime subunit
* ? minE 2261783 =46 (0.890)3 (0.060) 3/96 NT 6.2% coding (45/366 nt) rplL 50S ribosomal subunit protein L7/L12
?minE 2261805 = 48 (0.980)coding (23/366 nt) rplL 50S ribosomal subunit protein L7/L12
* ? minE 2270768 =NA (NA)5 (0.110) 3/90 NT 44.7% intergenic (‑18/+75) rrfB/rrlB 5S ribosomal RNA/23S ribosomal RNA
?minE 2358126 = 7 (0.140)intergenic (‑30/+64) rrfA/rrlA 5S ribosomal RNA/23S ribosomal RNA
* ? minE 2275478 =NA (NA)4 (0.090) 3/90 NT 100% noncoding (251/1542 nt) rrsB 16S ribosomal RNA
?minE 2362809 = 0 (0.000)noncoding (274/1542 nt) rrsA 16S ribosomal RNA
* ? minE = 227768132 (0.620)3 (0.060) 3/96 NT 7.6% coding (1068/1845 nt) btuB vitamin B12/cobalamin outer membrane transporter
?minE = 2277705 43 (0.880)coding (1044/1845 nt) btuB vitamin B12/cobalamin outer membrane transporter
* ? minE = 232711440 (0.770)4 (0.090) 3/92 NT 9.7% coding (185/1374 nt) cpxA sensory histidine kinase in two‑component regulatory system with CpxR
?minE = 2327131 38 (0.810)coding (202/1374 nt) cpxA sensory histidine kinase in two‑component regulatory system with CpxR
* ? minE = 237700447 (0.910)5 (0.110) 4/88 NT 10.7% coding (1384/1641 nt) ubiB 2‑octaprenylphenol hydroxylase
?minE = 2377016 43 (0.960)coding (1372/1641 nt) ubiB 2‑octaprenylphenol hydroxylase
* ? minE 2388519 =55 (1.060)3 (0.060) 3/92 NT 6.5% coding (925/1023 nt) pldB lysophospholipase L(2)
?minE 2388544 = 37 (0.790)coding (900/1023 nt) pldB lysophospholipase L(2)
* ? minE 2395347 =40 (0.770)4 (0.090) 4/86 NT 11.0% intergenic (+22/‑73) rarD/yigG predicted chloramphenical resistance permease/predicted inner membrane protein
?minE 2395381 = 31 (0.710)intergenic (+56/‑39) rarD/yigG predicted chloramphenical resistance permease/predicted inner membrane protein
* ? minE 2403490 =77 (1.490)5 (0.100) 3/96 NT 6.4% coding (362/825 nt) dapF diaminopimelate epimerase
?minE 2403514 = 75 (1.540)coding (338/825 nt) dapF diaminopimelate epimerase
* ? minE 2409481 =65 (1.250)4 (0.080) 3/96 NT 7.0% coding (697/741 nt) hemD uroporphyrinogen III synthase
?minE 2409516 = 45 (0.920)coding (732/741 nt) hemD uroporphyrinogen III synthase
* ? minE = 2455285NA (NA)6 (0.130) 3/92 NT NA noncoding (1524/1542 nt) rrsC 16S ribosomal RNA
?minE 2764774 = NA (NA)noncoding (1512/1542 nt) rrsE 16S ribosomal RNA
* ? minE = 252651763 (1.220)5 (0.100) 3/94 NT 7.7% coding (465/597 nt) ttk division inhibitor
?minE = 2526530 62 (1.300)coding (452/597 nt) ttk division inhibitor
* ? minE = 254013870 (1.350)4 (0.090) 3/90 NT 6.0% coding (663/1017 nt) rfaJ UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
?minE = 2540152 63 (1.380)coding (677/1017 nt) rfaJ UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
* ? minE 2540259 =55 (1.060)16 (0.350)
+GGTGTT
9/90 NT 31.7% coding (784/1017 nt) rfaJ UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
?minE 2791155 = 23 (0.440)intergenic (+550/‑225) pgi/ubiC glucosephosphate isomerase/chorismate pyruvate lyase
* ? minE = 254327657 (1.100)6 (0.130) 6/94 NT 10.9% coding (1252/1260 nt) rfaL O‑antigen ligase
?minE = 2543288 46 (0.960)coding (1240/1260 nt) rfaL O‑antigen ligase
* ? minE 2547200 =62 (1.200)3 (0.060) 3/92 NT 5.4% coding (289/933 nt) rfaD ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
?minE 2547230 = 50 (1.070)coding (259/933 nt) rfaD ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
* ? minE = 259394946 (0.890)3 (0.060) 3/100 NT 5.6% intergenic (‑220/+921) slp/arsC outer membrane lipoprotein/arsenate reductase
?minE = 2593974 57 (1.120)intergenic (‑245/+896) slp/arsC outer membrane lipoprotein/arsenate reductase
* ? minE 2621754 =60 (1.160)3 (0.060) 3/96 NT 5.2% coding (176/360 nt) yhhM conserved hypothetical protein
?minE 2621780 = 52 (1.070)coding (202/360 nt) yhhM conserved hypothetical protein
* ? minE 2626177 =48 (0.930)3 (0.080) 3/78 NT 9.6% intergenic (+16/‑229) ftsX/rpoH predicted transporter subunit/RNA polymerase, sigma 32 (sigma H) factor
?minE 2626214 = 20 (0.500)intergenic (+53/‑192) ftsX/rpoH predicted transporter subunit/RNA polymerase, sigma 32 (sigma H) factor
* ? minE = 263328847 (0.910)8 (0.170) 3/92 NT 15.6% coding (306/768 nt) livG leucine/isoleucine/valine transporter subunit
?minE = 2633300 44 (0.940)coding (318/768 nt) livG leucine/isoleucine/valine transporter subunit
* ? minE 2733620 =82 (1.580)4 (0.080) 3/94 NT 5.3% coding (215/288 nt) yheL predicted intracellular sulfur oxidation protein
?minE 2733654 = 68 (1.420)coding (249/288 nt) yheL predicted intracellular sulfur oxidation protein
* ? minE = 273689651 (0.980)5 (0.110) 3/86 NT 9.6% coding (2040/2115 nt) fusA protein chain elongation factor EF‑G
?minE = 2736913 51 (1.170)coding (2057/2115 nt) fusA protein chain elongation factor EF‑G
* ? minE 2776814 =44 (0.850)4 (0.090) 4/86 NT 11.7% coding (872/2187 nt) arpA regulator of acetyl CoA synthetase
?minE 2776838 = 23 (0.530)coding (848/2187 nt) arpA regulator of acetyl CoA synthetase
* ? minE = 281661057 (1.100)5 (0.110) 4/90 NT 7.9% coding (268/441 nt) soxR DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
?minE = 2816621 67 (1.470)coding (279/441 nt) soxR DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
* ? minE = 282593285 (1.640)5 (0.110) 5/92 NT 6.7% coding (773/1698 nt) dipZ fused thiol:disulfide interchange protein
?minE = 2825965 62 (1.330)coding (740/1698 nt) dipZ fused thiol:disulfide interchange protein
* ? minE = 282897669 (1.330)4 (0.080) 3/96 NT 5.9% coding (1014/1437 nt) aspA aspartate ammonia‑lyase
?minE = 2829001 63 (1.290)coding (989/1437 nt) aspA aspartate ammonia‑lyase
* ? minE = 283579142 (0.810)3 (0.070) 3/86 NT 7.1% coding (106/870 nt) yjeJ hypothetical protein
?minE = 2835797 43 (0.980)coding (100/870 nt) yjeJ hypothetical protein
* ? minE = 284350762 (1.200)4 (0.090) 3/88 NT 6.2% coding (474/1809 nt) frdA fumarate reductase (anaerobic) catalytic and NAD/flavoprotein subunit
?minE = 2843526 67 (1.500)coding (455/1809 nt) frdA fumarate reductase (anaerobic) catalytic and NAD/flavoprotein subunit
* ? minE 2903481 =76 (1.470)6 (0.130) 3/94 NT 7.8% coding (564/2139 nt) nrdD anaerobic ribonucleoside‑triphosphate reductase
?minE 2903505 = 72 (1.510)coding (540/2139 nt) nrdD anaerobic ribonucleoside‑triphosphate reductase
* ? minE = 290867953 (1.020)4 (0.090) 3/90 NT 7.1% intergenic (‑49/‑330) treR/mgtA DNA‑binding transcriptional repressor/magnesium transporter
?minE = 2908693 58 (1.270)intergenic (‑63/‑316) treR/mgtA DNA‑binding transcriptional repressor/magnesium transporter
* ? minE 2918569 =51 (0.980)3 (0.070) 3/90 NT 7.1% coding (1749/1815 nt) yjgL hypothetical protein
?minE 2918613 = 34 (0.740)coding (1793/1815 nt) yjgL hypothetical protein
* ? minE 2957605 =57 (1.100)3 (0.060) 3/94 NT 5.5% intergenic (+312/‑81) prfC/osmY peptide chain release factor RF‑3/periplasmic protein
?minE 2957623 = 51 (1.070)intergenic (+330/‑63) prfC/osmY peptide chain release factor RF‑3/periplasmic protein
* ? minE = 296206542 (0.810)4 (0.080) 3/96 NT 8.5% coding (1291/1551 nt) yjjI conserved hypothetical protein
?minE = 2962083 47 (0.960)coding (1273/1551 nt) yjjI conserved hypothetical protein
* ? minE = 297125952 (1.000)4 (0.090) 3/92 NT 6.7% coding (75/969 nt) serB 3‑phosphoserine phosphatase
?minE = 2971281 65 (1.390)coding (97/969 nt) serB 3‑phosphoserine phosphatase
* ? minE 2975691 =49 (0.950)3 (0.070) 3/88 NT 7.4% coding (1122/1668 nt) yjjK fused predicted transporter subunits and ATP‑binding components of ABC superfamily
?minE 2975721 = 33 (0.740)coding (1092/1668 nt) yjjK fused predicted transporter subunits and ATP‑binding components of ABC superfamily